1. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617128 (Microviridae sp. isolate ctfe585, complete genome) position: , mismatch: 1, identity: 0.967
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaacccgcatggataaattatatgac Protospacer
*********.********************
2. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617085 (Microviridae sp. isolate ctjj553, complete genome) position: , mismatch: 1, identity: 0.967
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaacctgcatggataaattacatgac Protospacer
************************.*****
3. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH616800 (Microviridae sp. isolate ctbe523, complete genome) position: , mismatch: 1, identity: 0.967
taaaacattggctaataacagaactagggc CRISPR spacer
taaaacattggctaataacagaactaggac Protospacer
****************************.*
4. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617325 (Microviridae sp. isolate ctca570, complete genome) position: , mismatch: 2, identity: 0.933
aaaacaacctgcatggataaattatatgac CRISPR spacer
taaacaacctgcatggataaactatatgac Protospacer
********************.********
5. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MG945288 (UNVERIFIED: Microviridae sp. isolate 291-1702, partial genome) position: , mismatch: 2, identity: 0.933
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaacctgcatggatagattacatgac Protospacer
*******************.****.*****
6. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617195 (Microviridae sp. isolate ctch587, complete genome) position: , mismatch: 2, identity: 0.933
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaaccagcatggataaattacatgac Protospacer
********* **************.*****
7. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH616940 (Microviridae sp. isolate ctdg534, complete genome) position: , mismatch: 2, identity: 0.933
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaacctgcatggataaactacatgac Protospacer
*********************.**.*****
8. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617027 (Microviridae sp. isolate ctda548, complete genome) position: , mismatch: 2, identity: 0.933
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaaccagcatggataaactatatgac Protospacer
********* ***********.********
9. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH622915 (Microviridae sp. isolate ctbb557, complete genome) position: , mismatch: 2, identity: 0.933
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaacctgcctggataaactatatgac Protospacer
************ ********.********
10. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH616731 (Microviridae sp. isolate ctdb576, complete genome) position: , mismatch: 2, identity: 0.933
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaagcaacctgcatggataaattacatgac Protospacer
***.********************.*****
11. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617339 (Microviridae sp. isolate ctjd540, complete genome) position: , mismatch: 2, identity: 0.933
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaaccagcatggataaattacatgac Protospacer
********* **************.*****
12. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617187 (Microviridae sp. isolate ctci549, complete genome) position: , mismatch: 3, identity: 0.9
aaaacaacctgcatggataaattatatgac CRISPR spacer
taaacaaccagcatggataaactatatgac Protospacer
******** ***********.********
13. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617030 (Microviridae sp. isolate ctbd804, complete genome) position: , mismatch: 3, identity: 0.9
aaaacaacctgcatggataaattatatgac CRISPR spacer
taaacaaccagcatggttaaattatatgac Protospacer
******** ****** *************
14. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MK765564 (Tortoise microvirus 14 isolate 14_SP_70, complete genome) position: , mismatch: 3, identity: 0.9
aaaacaacctgcatggataaattatatgac CRISPR spacer
caaacaaccagcctggataaattatatgac Protospacer
******** ** *****************
15. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH617125 (Microviridae sp. isolate ctcd912, complete genome) position: , mismatch: 3, identity: 0.9
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaaccagcatggataaattacatgag Protospacer
********* **************.****
16. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH616926 (Microviridae sp. isolate ctfd934, complete genome) position: , mismatch: 3, identity: 0.9
aaaacaacctgcatggataaattatatgac CRISPR spacer
taaacaacctgcatggataaactacatgac Protospacer
********************.**.*****
17. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MK765568 (Tortoise microvirus 18 isolate 18_SP_84, complete genome) position: , mismatch: 3, identity: 0.9
taaaacattggctaataacagaactagggc CRISPR spacer
caaaacattggctaataacagaattaggac Protospacer
.**********************.****.*
18. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MG883728 (Microviridae sp. isolate Flamingo05, partial genome) position: , mismatch: 3, identity: 0.9
taaaacattggctaataacagaactagggc CRISPR spacer
taaaacattggctagtaacagaattaggac Protospacer
**************.********.****.*
19. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617743 (Microviridae sp. isolate ctba531, complete genome) position: , mismatch: 3, identity: 0.9
taaaacattggctaataacagaactagggc CRISPR spacer
taagacactggctaataacagaactaggac Protospacer
***.***.********************.*
20. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH622925 (Microviridae sp. isolate ctci533, complete genome) position: , mismatch: 3, identity: 0.9
taaaacattggctaataacagaactagggc CRISPR spacer
taaaacattggctggtaacagaactaggac Protospacer
*************..*************.*
21. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617194 (Microviridae sp. isolate ctbf575, complete genome) position: , mismatch: 3, identity: 0.9
taaaacattggctaataacagaactagggc CRISPR spacer
taaaacactggctagtaacagaactaggac Protospacer
*******.******.*************.*
22. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617122 (Microviridae sp. isolate ctcf586, complete genome) position: , mismatch: 3, identity: 0.9
taaaacattggctaataacagaactagggc CRISPR spacer
taagacattggctagtaacagaactaggac Protospacer
***.**********.*************.*
23. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH616874 (Microviridae sp. isolate ctca606, complete genome) position: , mismatch: 3, identity: 0.9
taaaacattggctaataacagaactagggc CRISPR spacer
taaaacattggctagttacagaactaggac Protospacer
**************.* ***********.*
24. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617085 (Microviridae sp. isolate ctjj553, complete genome) position: , mismatch: 3, identity: 0.9
taaaacattggctaataacagaactagggc CRISPR spacer
taaaacactggctagtaacagaactaggac Protospacer
*******.******.*************.*
25. spacer 2.7|224338|30|NC_014734|CRT,PILER-CR matches to NZ_CP045608 (Bacillus cereus strain SB1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.867
--gaattaggattatgagtttatatagtttga CRISPR spacer
tagaat--ggattatctgtttatatagtttga Protospacer
**** ******* ***************
26. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NC_018687 (Bacillus thuringiensis MC28 plasmid pMC189, complete sequence) position: , mismatch: 4, identity: 0.867
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gcgatcaaaatattgattcttcagtagcta Protospacer
* .******* ******************
27. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617724 (Microviridae sp. isolate ctjc960, complete genome) position: , mismatch: 4, identity: 0.867
taaaacattggctaataacagaactagggc CRISPR spacer
agaaacattggctagtaacagaactaggcc Protospacer
.************.************* *
28. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617064 (Microviridae sp. isolate ctei560, complete genome) position: , mismatch: 4, identity: 0.867
taaaacattggctaataacagaactagggc CRISPR spacer
caaaacattggttaataacagagctaggac Protospacer
.**********.**********.*****.*
29. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617178 (Microviridae sp. isolate ctdb909, complete genome) position: , mismatch: 4, identity: 0.867
taaaacattggctaataacagaactagggc CRISPR spacer
tcaaacactggctaataacagaaataggac Protospacer
* *****.*************** ****.*
30. spacer 2.7|224338|30|NC_014734|CRT,PILER-CR matches to MN737622 (Methanobacterium virus PhiF3, complete genome) position: , mismatch: 5, identity: 0.833
gaattaggattatgagtttatatagtttga CRISPR spacer
ggaataggaatatgagtttgtatagtttgt Protospacer
*.* ***** *********.*********
31. spacer 2.12|224668|30|NC_014734|CRT,PILER-CR matches to NZ_CP051678 (Spirosoma sp. CJU-R4 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ctcttactggctggtgccgggcttgctgca- CRISPR spacer
ctattactggctggtgcggggc-tacggcaa Protospacer
** ************** **** *.* ***
32. spacer 2.16|224932|30|NC_014734|CRT,PILER-CR matches to MH616800 (Microviridae sp. isolate ctbe523, complete genome) position: , mismatch: 5, identity: 0.833
aaaacaacctgcatggataaattatatgac CRISPR spacer
aaaacaacctgcatgggtaaactacaccac Protospacer
****************.****.**.*. **
33. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP015351 (Bacillus thuringiensis strain MYBT18246 plasmid p150790, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gtgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
34. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP043832 (Bacillus sp. BS98 plasmid unnamed2) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gcgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
35. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP020747 (Bacillus mycoides strain Gnyt1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gcgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
36. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP015730 (Bacillus cereus strain A1 plasmid pBCA1, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gtgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
37. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NC_010283 (Bacillus thuringiensis plasmid pFR55, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gtgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
38. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to AP022644 (Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gtgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
39. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP016596 (Bacillus cereus strain K8 plasmid pBCM301, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gtgatcaaaatattgattcttcagtagcaa Protospacer
* .******* *****************
40. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gtgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
41. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to CP024686 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-2-313K, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gtgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
42. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NC_018688 (Bacillus thuringiensis MC28 plasmid pMC319, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gcgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
43. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP020434 (Bacillus sp. FDAARGOS_235 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
agaaatcaaaa-attgattcttcagtagctt CRISPR spacer
-gcgatcaaaatattgattcttcagtagcga Protospacer
* .******* *****************
44. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617323 (Microviridae sp. isolate ctba509, complete genome) position: , mismatch: 5, identity: 0.833
taaaacattggctaataacagaactagggc CRISPR spacer
ctagacactggctaataacagagctagggc Protospacer
. *.***.**************.*******
45. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617325 (Microviridae sp. isolate ctca570, complete genome) position: , mismatch: 5, identity: 0.833
taaaacattggctaataacagaactagggc CRISPR spacer
ttaaacattggctagtaacggaactaggag Protospacer
* ************.****.********.
46. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MG945900 (UNVERIFIED: Microviridae sp. isolate 2915-1602, partial genome) position: , mismatch: 5, identity: 0.833
taaaacattggctaataacagaactagggc CRISPR spacer
tacgccattggctaattacagaacttgggc Protospacer
** . *********** ******** ****
47. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617129 (Microviridae sp. isolate ctcg532, complete genome) position: , mismatch: 5, identity: 0.833
taaaacattggctaataacagaactagggc CRISPR spacer
tgagacactggctaataacagaaataggcc Protospacer
*.*.***.*************** **** *
48. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH617085 (Microviridae sp. isolate ctjj553, complete genome) position: , mismatch: 5, identity: 0.868
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
caggaaaacaacctgcatggataaattacatgacaaac Protospacer
**.*************************.*****. *
49. spacer 2.8|224404|30|NC_014734|CRT,PILER-CR matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 6, identity: 0.8
taaacattaaaacaataaacggaagttcga CRISPR spacer
caaatattaaaacaataaacggtaataaga Protospacer
.***.***************** *.* **
50. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 6, identity: 0.8
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gagaaaaaaatgaacagaaaacaattagaa Protospacer
.*.. *********** ********* ***
51. spacer 2.12|224668|30|NC_014734|CRT,PILER-CR matches to MK291444 (Paracoccus phage vB_PthS_Pthi1, complete genome) position: , mismatch: 6, identity: 0.8
ctcttactggctggtgccgggcttgctgca CRISPR spacer
cctgaactggctggtgcagggcttgctgga Protospacer
*.. ************ ********** *
52. spacer 2.15|224866|30|NC_014734|CRT,PILER-CR matches to NZ_CP010658 (Phaeobacter piscinae strain P71 plasmid pP71_b, complete sequence) position: , mismatch: 6, identity: 0.8
tgtgattaatgatattaccgta--gctaacgg CRISPR spacer
cgtgattaatgatattaccgaagcgccgac-- Protospacer
.******************* * **..**
53. spacer 2.15|224866|30|NC_014734|CRT,PILER-CR matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 6, identity: 0.8
tgtgattaatgatattaccgta--gctaacgg CRISPR spacer
cgtgattaatgatattaccgaagcgccgac-- Protospacer
.******************* * **..**
54. spacer 2.18|225064|30|NC_014734|CRT,PILER-CR matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 6, identity: 0.8
tgctattcggaatagatttttaccccacca CRISPR spacer
tactattcggaatatatttttacaaaaccc Protospacer
*.************ ******** ***
55. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to CP016970 (Staphylococcus epidermidis strain DAR1907 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
ataaatcaaaaattaattcttcatttattt Protospacer
* ************.******** * ..**
56. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to MK044828 (Streptococcus phage 33888, complete genome) position: , mismatch: 6, identity: 0.8
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
acaattttaaaattgattcttcagtatcta Protospacer
* ** *. ****************** **
57. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NC_031907 (Streptococcus phage phiARI0746, complete genome) position: , mismatch: 6, identity: 0.8
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
ataattttaaaattgattcttcagtatcta Protospacer
* ** *. ****************** **
58. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to KT337362 (Streptococcus phage phiARI0598b, partial genome) position: , mismatch: 6, identity: 0.8
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
ataattttaaaattgattcttcagtatcta Protospacer
* ** *. ****************** **
59. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to MK448733 (Streptococcus phage Javan345, complete genome) position: , mismatch: 6, identity: 0.8
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
acaattttaaaattgattcttcagtatcta Protospacer
* ** *. ****************** **
60. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617187 (Microviridae sp. isolate ctci549, complete genome) position: , mismatch: 6, identity: 0.8
taaaacattggctaataacagaactagggc CRISPR spacer
tgaggcactggctagtaacagaactaggac Protospacer
*.*..**.******.*************.*
61. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH617035 (Microviridae sp. isolate ctcj515, complete genome) position: , mismatch: 6, identity: 0.8
taaaacattggctaataacagaactagggc CRISPR spacer
tgaggcactggttaataacagaactaggac Protospacer
*.*..**.***.****************.*
62. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH617128 (Microviridae sp. isolate ctfe585, complete genome) position: , mismatch: 6, identity: 0.842
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
caggaaaacaacccgcatggataaattatatgactaat Protospacer
**.**********.******************** .
63. spacer 5.1|3132679|27|NC_014734|PILER-CR matches to NZ_AP022320 (Burkholderia sp. THE68 plasmid BTHE68_p2, complete sequence) position: , mismatch: 6, identity: 0.778
atggaaaatataacgagtagaccaact CRISPR spacer
tgggaaaatacaacgagcagaccaagc Protospacer
********.******.******* .
64. spacer 5.1|3132679|27|NC_014734|PILER-CR matches to KU510289 (Acinetobacter phage LZ35, complete genome) position: , mismatch: 6, identity: 0.778
atggaaaatataacgagtagaccaact CRISPR spacer
tggaaaaatataacgagtggaccaaaa Protospacer
*.**************.******
65. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to MH552525 (Siphoviridae sp. isolate ctbc8, complete genome) position: , mismatch: 6, identity: 0.8
tattaattgaaaataaagaactaattttga CRISPR spacer
tgtaaattgaaaataacaaactaatttagc Protospacer
*.* ************ .********* *
66. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to KT997857 (Uncultured Mediterranean phage uvDeep-CGR2-KM18-C269, complete genome) position: , mismatch: 6, identity: 0.8
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
ttcgtcatttgttttgttgaaatagttttt Protospacer
* ** .*********** **********.
67. spacer 2.1|223944|30|NC_014734|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 7, identity: 0.767
agaaaaacatgtgggtatgtgcatgtcctt CRISPR spacer
atttaaacatgtgggtatgtgaatgctgtt Protospacer
* ***************** ***.. **
68. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
69. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_KY270852 (Enterobacter cloacae strain T5282 plasmid pT5282-mphA, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
70. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
71. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_LN830952 (Enterobacter sp. 247 strain 247 BMC plasmid pEB247, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
72. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
73. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP048350 (Raoultella ornithinolytica strain 23 plasmid p23_A-OXA140, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
74. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
75. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP027678 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
76. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP035634 (Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
77. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP042506 (Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
78. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
79. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to MT077886 (Escherichia coli plasmid p39, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
80. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
81. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
82. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
83. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
84. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
85. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP022696 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
86. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP052871 (Enterobacter cloacae strain 3849 plasmid p3846_IncHI2_mcr, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
87. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
88. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_LT991958 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-VIM4) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
89. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP043855 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
90. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP044215 (Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
91. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to CP049309 (Salmonella enterica subsp. enterica serovar Johannesburg strain CVM N58011 plasmid p58011, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
92. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NC_010870 (Klebsiella pneumoniae plasmid pK29, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
93. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP024813 (Enterobacter sp. CRENT-193 plasmid pCRENT-193_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
94. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
95. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
96. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP042494 (Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
97. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP040696 (Citrobacter freundii strain R47 plasmid pR47-309, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
98. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
99. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP008906 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-08e, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
100. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP042552 (Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
101. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP039271 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
102. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
103. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to CP050163 (Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
104. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP041734 (Enterobacter hormaechei subsp. steigerwaltii strain ME-1 plasmid pME-1a, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
105. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to MK933279 (Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
106. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to LC532224 (Enterobacter hormaechei subsp. xiangfangensis A2483 plasmid pA2483mcr-9 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
107. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to LC532226 (Enterobacter hormaechei subsp. xiangfangensis A2504 plasmid pA2504mcr-9 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
108. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
109. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
110. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to LN794248 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid incHI2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
111. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP029248 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
112. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
113. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP031102 (Leclercia sp. W17 plasmid pW17-1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
114. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
115. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to LC542971 (Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
116. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
117. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
118. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NC_024983 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTm-A54650, strain A54560, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
119. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
120. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
121. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP021463 (Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
122. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NC_012556 (Enterobacter cloacae plasmid pEC-IMPQ, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
123. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NC_012555 (Enterobacter cloacae plasmid pEC-IMP, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
124. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
125. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
126. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP051135 (Enterobacter hormaechei strain AMS-38 plasmid pAMS-38c, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
127. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
128. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP042525 (Citrobacter freundii strain E11 plasmid pE11_001, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
129. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_LT991955 (Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-VIM4) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
130. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP022533 (Enterobacter hormaechei strain MS7884A plasmid pMS7884A, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
131. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP038659 (Citrobacter freundii strain 680 plasmid p680_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
132. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
133. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP024910 (Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
134. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
135. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP042489 (Enterobacter hormaechei strain C15 plasmid pC15_001, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
136. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MN540571 (Escherichia coli strain E.coli4feg plasmid pIV_IncHI2_CTX_M_15, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
137. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP033103 (Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
138. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
139. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MK736669 (Enterobacter cloacae strain EclC2185 plasmid pEclC2185CTXM15, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
140. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_LC511997 (Enterobacter hormaechei subsp. xiangfangensis strain MY460 plasmid pMY460-rmtE, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
141. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MF344580 (Enterobacter cloacae strain 30860 plasmid p30860-HI2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
142. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MF344583 (Enterobacter cloacae strain N1863 plasmid pN1863-HI2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
143. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MH399264 (Enterobacter cloacae strain RJ702 plasmid pIMP26, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
144. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_KY863418 (Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
145. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_KY978628 (Cronobacter sakazakii strain 505108 plasmid p505108-MDR, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
146. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MF788071 (Raoultella ornithinolytica strain 23141 plasmid p23141-3, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
147. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP031724 (Enterobacter hormaechei strain WCHEH020038 plasmid pCTXM9_020038, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
148. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP053191 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37a, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
149. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_KX810825 (Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
150. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_KP975077 (Enterobacter cloacae strain MRSN17626 plasmid pMRVIM0813, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
151. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
152. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
153. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
154. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
155. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP048293 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
156. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP020529 (Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
157. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP031567 (Enterobacter hormaechei strain 2013_1a plasmid pIncHI2-1301491, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
158. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP040888 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
159. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
160. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP031575 (Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
161. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP023570 (Enterobacter hormaechei strain BW plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
162. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to AP018320 (Nostoc sp. HK-01 plasmid plasmid2 DNA, complete genome) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
aatatacaaaattataaaatcaataaattc Protospacer
.* * ********** ***********
163. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP043767 (Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
164. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP027144 (Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
165. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
166. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_AP018352 (Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
167. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP038654 (Citrobacter freundii strain 154 plasmid p154_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
168. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP038657 (Citrobacter freundii strain 565 plasmid p565_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
169. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP044051 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
170. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MH105051 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncHI2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
171. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_CP049047 (Enterobacter hormaechei strain Y233 plasmid pIHI2-233, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
172. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MF083142 (Citrobacter freundii strain D36-1 plasmid pD36-1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
173. spacer 2.4|224140|30|NC_014734|CRT,PILER-CR matches to NZ_MG878867 (Escherichia coli strain Ec21617 plasmid pEc21617-310, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaacgaaaattataacttcaataaattc CRISPR spacer
gtaaacaaaatttataacttcaatactgac Protospacer
* ****.*** ************** *
174. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MG869626 (Polaromonas sp. W5N plasmid pW5NP1, complete sequence) position: , mismatch: 7, identity: 0.767
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
cgaagtgcggatttgagcgaagcgattggg Protospacer
* .**************** **** * *
175. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to NZ_AP019741 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
aaaggaaaaatgaacacaaaactcattact Protospacer
**** ***************** **.
176. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.767
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
catgcaaaactgaacaaaaaacaattaata Protospacer
* ****** ****** ********* . *
177. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to MG945262 (UNVERIFIED: Microviridae sp. isolate 4223-1801, complete genome) position: , mismatch: 7, identity: 0.767
agaaatcaaaaattgattctt----cagtagctt CRISPR spacer
agaaattaaaaattgattcttatggcaaaa---- Protospacer
******.************** **. *
178. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.767
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
ataaatcaaaaattgattcatcaattaatc Protospacer
* ***************** ***.* . *.
179. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to MK496814 (Capybara microvirus Cap3_SP_578, complete genome) position: , mismatch: 7, identity: 0.767
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
aataatcaaaaattgactcttcagcaaatc Protospacer
*. *************.*******.*. *.
180. spacer 2.21|225262|30|NC_014734|CRT,PILER-CR matches to MF001358 (Enterococcus phage EF1, partial genome) position: , mismatch: 7, identity: 0.767
cgaatcctaatggttatattactgcttcat CRISPR spacer
ccatacctaatggtaatgttactgcttctg Protospacer
* * ********* **.**********
181. spacer 2.21|225262|30|NC_014734|CRT,PILER-CR matches to MF001361 (Enterococcus phage EF5, partial genome) position: , mismatch: 7, identity: 0.767
cgaatcctaatggttatattactgcttcat CRISPR spacer
ccatacctaatggtaatgttactgcttctg Protospacer
* * ********* **.**********
182. spacer 2.26|225592|30|NC_014734|CRT,PILER-CR matches to MH616660 (Microviridae sp. isolate ctbb538, complete genome) position: , mismatch: 7, identity: 0.767
taaaacattggctaataacagaactagggc CRISPR spacer
ctcggcactggttaataacagaactagggc Protospacer
. ..**.***.******************
183. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH622915 (Microviridae sp. isolate ctbb557, complete genome) position: , mismatch: 7, identity: 0.816
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
taggaaaacaacctgcctggataaactatatgacagac Protospacer
.*.************* ********.********. *
184. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH617125 (Microviridae sp. isolate ctcd912, complete genome) position: , mismatch: 7, identity: 0.816
caagaaaacaacctgcatggataaattatatgacgttc- CRISPR spacer
tgggaaaacaaccagcatggataaattacatga-gtgca Protospacer
...********** **************.**** ** *
185. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
ctttaattgaaaataaagaagtaagcttag Protospacer
. ****************** *** .**..
186. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NZ_CP024394 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-2) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
aattaatagaaaataaataactaaataata Protospacer
****** ********* ****** * *
187. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NZ_CP024331 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-12) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
aattaatagaaaataaataactaaataata Protospacer
****** ********* ****** * *
188. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NZ_CP024396 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp29, complete sequence) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
aattaatagaaaataaataactaaataata Protospacer
****** ********* ****** * *
189. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NZ_CP004876 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
ttgtaatcgaaaataaagcactaattgggt Protospacer
* ****.********** ******* *
190. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NZ_CP024212 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-5) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
aattaatagaaaataaataactaaataata Protospacer
****** ********* ****** * *
191. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NZ_CP024345 (Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-10) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
aattaatagaaaataaataactaaataata Protospacer
****** ********* ****** * *
192. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NZ_CP024359 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-5) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
aattaatagaaaataaataactaaataata Protospacer
****** ********* ****** * *
193. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to MN693352 (Marine virus AFVG_25M558, complete genome) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaactaattttga CRISPR spacer
taccgggtgaaaataaaaaattaattttga Protospacer
**.... **********.**.*********
194. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to MN692999 (Marine virus AFVG_117M75, complete genome) position: , mismatch: 7, identity: 0.767
tattaattgaaaataaagaacta----attttga CRISPR spacer
aattaattgaaaatcaagaattaaagcatt---- Protospacer
************* *****.** ***
195. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to MN694267 (Marine virus AFVG_250M705, complete genome) position: , mismatch: 7, identity: 0.767
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
tattctgttagttttgttctaatagttttc Protospacer
*.. *** ********* **********
196. spacer 2.2|224010|29|NC_014734|CRT,PILER-CR matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724
tattactgctgcaatgcagattggcgtat CRISPR spacer
aattgctggtgcaatgcagattgggcggc Protospacer
***.*** *************** ..
197. spacer 2.3|224075|29|NC_014734|CRT,PILER-CR matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724
tattactgctgcaatgcagattggcgtat CRISPR spacer
aattgctggtgcaatgcagattgggcggc Protospacer
***.*** *************** ..
198. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023180 (Brevibacterium phage AGM5, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
199. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023191 (Brevibacterium phage AGM16, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
200. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023185 (Brevibacterium phage AGM10, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
201. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023176 (Brevibacterium phage AGM1, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
202. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023181 (Brevibacterium phage AGM6, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
203. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023179 (Brevibacterium phage AGM4, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
204. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023178 (Brevibacterium phage AGM3, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
205. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023189 (Brevibacterium phage AGM14, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
206. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023183 (Brevibacterium phage AGM8, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
207. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023184 (Brevibacterium phage AGM9, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
208. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023190 (Brevibacterium phage AGM15, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
209. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023186 (Brevibacterium phage AGM11, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
210. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023188 (Brevibacterium phage AGM13, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
211. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023177 (Brevibacterium phage AGM2, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
212. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023187 (Brevibacterium phage AGM12, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
213. spacer 2.6|224272|30|NC_014734|CRT,PILER-CR matches to MN023182 (Brevibacterium phage AGM7, complete genome) position: , mismatch: 8, identity: 0.733
agcggtgcggatttgagcgatgcgaatttg CRISPR spacer
tgtggtgcggatttgagcgttgcggaccaa Protospacer
*.**************** ****.*.. .
214. spacer 2.8|224404|30|NC_014734|CRT,PILER-CR matches to NZ_CP011543 (Corynebacterium mustelae strain DSM 45274 plasmid pCmus45274, complete sequence) position: , mismatch: 8, identity: 0.733
taaacattaaaacaataaacggaagttcga--- CRISPR spacer
caaacgttaaaacaataaacg---gctaaaacg Protospacer
.****.*************** *.* .*
215. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to NC_019516 (Cyanophage S-TIM5, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtctctaaaatgaactcaaagcaatttgag Protospacer
. * ********* ****.********.
216. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689511 (Lactococcus phage CHPC1183, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
217. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MF443123 (Lactococcus phage 62606, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
218. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689529 (Lactococcus phage CHPC973, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
219. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MF443125 (Lactococcus phage 50102, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
220. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689515 (Lactococcus phage CHPC134, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
221. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN337887 (Lactococcus phage vB_LacS_15, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
222. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689532 (Lactococcus phage PC_B3, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
223. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MH779522 (Lactococcus phage vB_Llc_bIBBA3, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
224. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689503 (Lactococcus phage 5171F, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
225. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MK301443 (Lactococcus phage CW09, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaaattgaa Protospacer
. *. .**** ************ *****
226. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689531 (Lactococcus phage PC_B1, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
227. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689504 (Lactococcus phage 5205F, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
228. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689506 (Lactococcus phage CHPC1161, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
229. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689510 (Lactococcus phage CHPC1182, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
230. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MH779527 (Lactococcus phage vB_Llc_bIBBp6/4, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
231. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MH779524 (Lactococcus phage vB_Llc_bIBBD4, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
232. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MK301442 (Lactococcus phage 20R03M, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaaattgaa Protospacer
. *. .**** ************ *****
233. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MH779526 (Lactococcus phage vB_Llc_bIBBL81, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
234. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689526 (Lactococcus phage CHPC966, partial genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
235. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to KX373685 (Lactococcus phage D4410, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaatgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
236. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to KX373686 (Lactococcus phage D4412, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaatgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
237. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689505 (Lactococcus phage CHPC1020, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
238. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MN689533 (Lactococcus phage PC_S1, complete genome) position: , mismatch: 8, identity: 0.733
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtaaacgaaattaacacaaaacaagttgaa Protospacer
. *. .**** ************ *****
239. spacer 2.12|224668|30|NC_014734|CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
ctcttactggctggtgccgggcttgctgca CRISPR spacer
gaaggactggctggtgccgggcatcctgcc Protospacer
***************** * ****
240. spacer 2.12|224668|30|NC_014734|CRT,PILER-CR matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 8, identity: 0.733
ctcttactggctggtgccgggcttgctgca CRISPR spacer
taggcattgtctggcgccgggcttgctgca Protospacer
. .*.** ****.***************
241. spacer 2.12|224668|30|NC_014734|CRT,PILER-CR matches to MH651189 (Gordonia phage Schmidt, complete genome) position: , mismatch: 8, identity: 0.733
ctcttactggctggtgccgggcttgctgca CRISPR spacer
gcacgactggctggtgccggggctgctgga Protospacer
. . **************** .***** *
242. spacer 2.15|224866|30|NC_014734|CRT,PILER-CR matches to NC_016515 (Enterobacter ludwigii strain EcWSU1 plasmid pEcWSU1_A, complete sequence) position: , mismatch: 8, identity: 0.733
tgtgattaatgatattaccgtagctaacgg CRISPR spacer
aatgattaatgatattaacgtagatctatg Protospacer
.*************** ***** * *
243. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to KY554763 (Lactococcus phage LW32, complete genome) position: , mismatch: 8, identity: 0.733
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
caaaatcagaaattgattcatcagtttcaa Protospacer
.******.********** ***** *
244. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NC_049806 (Lactococcus phage LW31, complete genome) position: , mismatch: 8, identity: 0.733
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
caaaatcagaaattgattcatcagtttcaa Protospacer
.******.********** ***** *
245. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to KY554765 (Lactococcus phage LW4, complete genome) position: , mismatch: 8, identity: 0.733
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
caaaatcagaaattgattcatcagtttcaa Protospacer
.******.********** ***** *
246. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to KY554764 (Lactococcus phage LW33, complete genome) position: , mismatch: 8, identity: 0.733
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
caaaatcagaaattgattcatcagtttcaa Protospacer
.******.********** ***** *
247. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MG945288 (UNVERIFIED: Microviridae sp. isolate 291-1702, partial genome) position: , mismatch: 8, identity: 0.789
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
taggaaaacaacctgcatggatagattacatgactaat Protospacer
.*.********************.****.***** .
248. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH617195 (Microviridae sp. isolate ctch587, complete genome) position: , mismatch: 8, identity: 0.789
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
taggaaaacaaccagcatggataaattacatgactgaa Protospacer
.*.********** **************.*****
249. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH617325 (Microviridae sp. isolate ctca570, complete genome) position: , mismatch: 8, identity: 0.789
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
taggtaaacaacctgcatggataaactatatgacagat Protospacer
.*.* ********************.********. .
250. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH616731 (Microviridae sp. isolate ctdb576, complete genome) position: , mismatch: 8, identity: 0.789
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
taggaaagcaacctgcatggataaattacatgacagca Protospacer
.*.****.********************.*****. .
251. spacer 5.12|3133008|30|NC_014734|PILER-CR matches to NC_030920 (Bacillus phage Eldridge, complete genome) position: , mismatch: 8, identity: 0.733
tattaattgaaaataaagaactaattttga CRISPR spacer
aattatttgaaaataaagaactacaaaaca Protospacer
**** ***************** *
252. spacer 5.13|3133074|30|NC_014734|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 8, identity: 0.733
attttgtacttttacatcagtttaaaacaa CRISPR spacer
catcctcactttcacatcaatttaaaacaa Protospacer
*.. .*****.******.**********
253. spacer 5.13|3133074|30|NC_014734|PILER-CR matches to NC_010405 (Paulownia witches'-broom phytoplasma plasmid pPaWBNy-1, complete sequence) position: , mismatch: 8, identity: 0.733
attttgtacttttacatcagtttaaaacaa CRISPR spacer
attttgtatttttaaatcagtttgagggtc Protospacer
********.***** ********.*..
254. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to NZ_CP011027 (Pseudoalteromonas arctica A 37-1-2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
atttcactttgtttttttcaaatagttttg Protospacer
. * ******** *************
255. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to AP011616 (Thermus phage phiYS40 DNA, complete genome) position: , mismatch: 8, identity: 0.733
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
taaacggtttgttctgttaaaatagtttta Protospacer
*. . .*******.**** **********
256. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to NC_024355 (Staphylococcus phage 6ec, complete genome) position: , mismatch: 8, identity: 0.733
tgcgaagt---ttgttttgttcaaatagttttc CRISPR spacer
---ataatctattgttttgttctaatagttttg Protospacer
. *.* *********** *********
257. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to DQ997624 (Thermus thermophilus phage YS40, complete genome) position: , mismatch: 8, identity: 0.733
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
taaacggtttgttctgttaaaatagtttta Protospacer
*. . .*******.**** **********
258. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to KF929199 (Staphylococcus phage vB_SepS_SEP9, complete genome) position: , mismatch: 8, identity: 0.733
tgcgaagt---ttgttttgttcaaatagttttc CRISPR spacer
---ataatctattgttttgttctaatagttttg Protospacer
. *.* *********** *********
259. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to NC_015937 (Thermus phage TMA, complete genome) position: , mismatch: 8, identity: 0.733
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
taaacggtttgttctgttaaaatagtttta Protospacer
*. . .*******.**** **********
260. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to NC_008584 (Thermus phage phiYS40, complete genome) position: , mismatch: 8, identity: 0.733
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
taaacggtttgttctgttaaaatagtttta Protospacer
*. . .*******.**** **********
261. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to AP011617 (Thermus phage TMA DNA, complete genome) position: , mismatch: 8, identity: 0.733
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
taaacggtttgttctgttaaaatagtttta Protospacer
*. . .*******.**** **********
262. spacer 2.5|224206|30|NC_014734|CRT,PILER-CR matches to NC_012226 (Brachyspira hyodysenteriae WA1 plasmid pBHWA1, complete sequence) position: , mismatch: 9, identity: 0.7
agtaaaaccgtacaatggagaagataacgt CRISPR spacer
taacaaaccatacaatgaagaagataaaac Protospacer
. *****.*******.********* ..
263. spacer 2.5|224206|30|NC_014734|CRT,PILER-CR matches to NZ_CP016085 (Brachyspira hyodysenteriae ATCC 27164 strain B-78 plasmid pBhyoB78, complete sequence) position: , mismatch: 9, identity: 0.7
agtaaaaccgtacaatggagaagataacgt CRISPR spacer
taacaaaccatacaatgaagaagataaaac Protospacer
. *****.*******.********* ..
264. spacer 2.5|224206|30|NC_014734|CRT,PILER-CR matches to NZ_CP019601 (Brachyspira hyodysenteriae strain BH718 plasmid pBH718, complete sequence) position: , mismatch: 9, identity: 0.7
agtaaaaccgtacaatggagaagataacgt CRISPR spacer
taacaaaccatacaatgaagaagataaaac Protospacer
. *****.*******.********* ..
265. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to NC_001706 (Lactococcus phage c2, complete genome) position: , mismatch: 9, identity: 0.7
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtgaacgaaatcaacacaaaacaagttgaa Protospacer
. .. .**** ************ *****
266. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to L48605 (Bacteriophage c2 complete genome) position: , mismatch: 9, identity: 0.7
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtgaacgaaatcaacacaaaacaagttgaa Protospacer
. .. .**** ************ *****
267. spacer 2.9|224470|30|NC_014734|CRT,PILER-CR matches to MF443124 (Lactococcus phage 50504, complete genome) position: , mismatch: 9, identity: 0.7
aaagcaaaaatgaacacaaaacaatttgaa CRISPR spacer
gtgaacgaaatcaacacaaaacaagttgaa Protospacer
. .. .**** ************ *****
268. spacer 2.13|224734|30|NC_014734|CRT,PILER-CR matches to NC_013930 (Thioalkalivibrio sp. K90mix plasmid pTK9001, complete sequence) position: , mismatch: 9, identity: 0.7
agaaagagtgatgaacgacgagcaggatat CRISPR spacer
tcgggcagtgatgaacgacggacaggatac Protospacer
... **************..*******.
269. spacer 2.17|224998|30|NC_014734|CRT,PILER-CR matches to NC_048660 (Aeromonas phage phiA8-29, complete genome) position: , mismatch: 9, identity: 0.7
taaaaacatatttgctgaagactatggaag CRISPR spacer
gttgcgcatatttgctgaagaaaatggaac Protospacer
. .*************** ******
270. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP013276 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence) position: , mismatch: 9, identity: 0.7
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
gtgatctaaatattgattcttcagtagcga Protospacer
. .* ..*** *****************
271. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP039722 (Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
gtgatctaaatattgattcttcagtagcga Protospacer
. .* ..*** *****************
272. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
ttccatcaaaaattccttcttcagtagaaa Protospacer
********** ***********
273. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP009349 (Bacillus thuringiensis HD1002 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.7
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
gtgatctaaatattgattcttcagtagcga Protospacer
. .* ..*** *****************
274. spacer 2.20|225196|30|NC_014734|CRT,PILER-CR matches to NZ_CP045023 (Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7
agaaatcaaaaattgattcttcagtagctt CRISPR spacer
gtgatctaaatattgattcttcagtagcga Protospacer
. .* ..*** *****************
275. spacer 2.21|225262|30|NC_014734|CRT,PILER-CR matches to NZ_CP009266 (Vibrio coralliilyticus strain OCN014 plasmid pOCN014, complete sequence) position: , mismatch: 9, identity: 0.7
cgaatcctaatggttatattactgcttcat CRISPR spacer
cgaatcctaatggtaatattaagagtcttg Protospacer
************** ****** . *..
276. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH617030 (Microviridae sp. isolate ctbd804, complete genome) position: , mismatch: 9, identity: 0.763
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
cgggtaaacaaccagcatggttaaattatatgacaaat Protospacer
*..* ******** ****** *************. .
277. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MK765564 (Tortoise microvirus 14 isolate 14_SP_70, complete genome) position: , mismatch: 9, identity: 0.763
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
cgggcaaacaaccagcctggataaattatatgaccaat Protospacer
*..* ******** ** ***************** .
278. spacer 2.42|224928|38|NC_014734|CRISPRCasFinder matches to MH616926 (Microviridae sp. isolate ctfd934, complete genome) position: , mismatch: 9, identity: 0.763
caagaaaacaacctgcatggataaattatatgacgttc CRISPR spacer
taggtaaacaacctgcatggataaactacatgacagca Protospacer
.*.* ********************.**.*****. .
279. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MH616800 (Microviridae sp. isolate ctbe523, complete genome) position: , mismatch: 9, identity: 0.763
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
tccataaaacattggctaataacagaactaggacacaa Protospacer
. .****************************.*..
280. spacer 5.2|3132745|30|NC_014734|PILER-CR matches to MN582077 (Podoviridae sp. ctLUJ1, complete genome) position: , mismatch: 9, identity: 0.7
aaaaagccgcaccaatagcaacagagatag CRISPR spacer
taacagccgcacctatagcaacagtctgga Protospacer
** ********* ********** ..
281. spacer 5.11|3132938|34|NC_014734|PILER-CR matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.735
catgctacttattttattacagcttatgaagttg CRISPR spacer
tatgctgcttattttattacaggttaactttttt Protospacer
.*****.*************** *** **
282. spacer 5.14|3133140|30|NC_014734|PILER-CR matches to MK552327 (Pseudomonas phage Psa21, complete genome) position: , mismatch: 9, identity: 0.7
tgcgaagtttgttttgttcaaatagttttc CRISPR spacer
tgcgaagtttgtttctttcaaatgcgccag Protospacer
**************. *******. ..
283. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MK765568 (Tortoise microvirus 18 isolate 18_SP_84, complete genome) position: , mismatch: 10, identity: 0.737
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
gcaccaaaacattggctaataacagaattaggacacaa Protospacer
* .**********************.****.*..
284. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MH622925 (Microviridae sp. isolate ctci533, complete genome) position: , mismatch: 10, identity: 0.737
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
agcgtaaaacattggctggtaacagaactaggacaacc Protospacer
. **************..*************.*. ..
285. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MH616874 (Microviridae sp. isolate ctca606, complete genome) position: , mismatch: 10, identity: 0.737
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
agcgtaaaacattggctagttacagaactaggacacaa Protospacer
. ***************.* ***********.*..
286. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MH617085 (Microviridae sp. isolate ctjj553, complete genome) position: , mismatch: 10, identity: 0.737
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
agcgtaaaacactggctagtaacagaactaggacacaa Protospacer
. ********.******.*************.*..
287. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MG883728 (Microviridae sp. isolate Flamingo05, partial genome) position: , mismatch: 10, identity: 0.737
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
tcaataaaacattggctagtaacagaattaggacaaaa Protospacer
. *.**************.********.****.*.
288. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MH617743 (Microviridae sp. isolate ctba531, complete genome) position: , mismatch: 10, identity: 0.737
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
agcctaagacactggctaataacagaactaggacataa Protospacer
. ***.***.********************.*.*
289. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MH617194 (Microviridae sp. isolate ctbf575, complete genome) position: , mismatch: 11, identity: 0.711
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
agcataaaacactggctagtaacagaactaggacaaga Protospacer
. .*******.******.*************.*.
290. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MH617122 (Microviridae sp. isolate ctcf586, complete genome) position: , mismatch: 11, identity: 0.711
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
agtctaagacattggctagtaacagaactaggacacaa Protospacer
. ***.**********.*************.*..
291. spacer 2.52|225588|38|NC_014734|CRISPRCasFinder matches to MH617064 (Microviridae sp. isolate ctei560, complete genome) position: , mismatch: 12, identity: 0.684
caagtaaaacattggctaataacagaactagggcgttt CRISPR spacer
agtccaaaacattggttaataacagagctaggacacaa Protospacer
. .**********.**********.*****.*..
