1. spacer 1.1|134958|32|NC_014753|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
gaaaaactacttcaaacgctattgcttcgaat CRISPR spacer
gaaaaactacttcaaacgctattgcttcgaat Protospacer
********************************
2. spacer 1.2|135019|33|NC_014753|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
agagatgggcgcgcttggtgcagctatggcaag CRISPR spacer
agagatgggcgcgcttggtgcagctatggcaag Protospacer
*********************************
3. spacer 1.3|135081|33|NC_014753|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
gagctattggatcatcgacagtggttttacctc CRISPR spacer
gagctattggatcatcgacagtggttttacctc Protospacer
*********************************
4. spacer 1.4|135143|32|NC_014753|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
aacaccaataaagcgcataagtcggtcctgtt CRISPR spacer
aacaccaataaagcgcataagtcggtcctgtt Protospacer
********************************
5. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgcagatcggcgtgaacgaagtgcgcgg Protospacer
*********************************
6. spacer 1.6|135266|32|NC_014753|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
ctcgaggccggcgagtccctcaaacttgaggc CRISPR spacer
ctcgaggccggcgagtccctcaaacttgaggc Protospacer
********************************
7. spacer 1.7|134958|34|NC_014753|CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
gaaaaactacttcaaacgctattgcttcgaattt CRISPR spacer
gaaaaactacttcaaacgctattgcttcgaattt Protospacer
**********************************
8. spacer 1.8|135019|35|NC_014753|CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
agagatgggcgcgcttggtgcagctatggcaagcg CRISPR spacer
agagatgggcgcgcttggtgcagctatggcaagcg Protospacer
***********************************
9. spacer 1.9|135081|35|NC_014753|CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
gagctattggatcatcgacagtggttttacctccg CRISPR spacer
gagctattggatcatcgacagtggttttacctccg Protospacer
***********************************
10. spacer 1.10|135143|34|NC_014753|CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
aacaccaataaagcgcataagtcggtcctgttcg CRISPR spacer
aacaccaataaagcgcataagtcggtcctgttcg Protospacer
**********************************
11. spacer 1.11|135204|35|NC_014753|CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
gctgctgcagatcggcgtgaacgaagtgcgcggcg CRISPR spacer
gctgctgcagatcggcgtgaacgaagtgcgcggcg Protospacer
***********************************
12. spacer 1.12|135266|34|NC_014753|CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
ctcgaggccggcgagtccctcaaacttgaggccg CRISPR spacer
ctcgaggccggcgagtccctcaaacttgaggccg Protospacer
**********************************
13. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 5, identity: 0.848
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgcagttcggcgtgagcg-agcgcgcagg Protospacer
********** *********.** **.****.*
14. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP054600 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gcagggcgaggtcggcgtgatcgaagtgcgcgg Protospacer
** * **.********* ************
15. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
16. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
17. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
18. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
19. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
20. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
21. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
22. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
23. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcctgaacgagac-cgaggc Protospacer
******** ******* *******... ** **
24. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
25. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
26. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
gctgctgcagatcggcgtgaacgaagtgcgcgg- CRISPR spacer
gctgctgccgatcggcatgaacgagac-cgaggc Protospacer
******** *******.*******... ** **
27. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
28. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
29. spacer 1.11|135204|35|NC_014753|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
30. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
31. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
32. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
33. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
34. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
35. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
36. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
37. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
38. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
39. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
40. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
41. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
42. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
43. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
44. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
45. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
46. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
47. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
48. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
49. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
50. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
51. spacer 1.11|135204|35|NC_014753|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
52. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
53. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
54. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
55. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
56. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
57. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
58. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
59. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
60. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
61. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
62. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
63. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
64. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
65. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
66. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
67. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
68. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
69. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
70. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
71. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
72. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
73. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
74. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
75. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
76. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
77. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
78. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
79. spacer 1.11|135204|35|NC_014753|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
80. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
81. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
82. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
83. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
84. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
85. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
86. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
87. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
88. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.8
gctgctgcagatcggcgtgaacgaagtgcgcggcg- CRISPR spacer
gctgctgccgatcggcatgaacgaaac-cgaagcgc Protospacer
******** *******.********.. ** .***
89. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgacgc Protospacer
******** *******.********.. .**
90. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
ccagggcgagatcggcgtgatcgaggtgcgcgg Protospacer
* * ************ ***.********
91. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771
gctgctgcagatcggcgtgaacgaagtgcgcggcg--- CRISPR spacer
gctgctgccgatcggcatgaacgaaac---cgacgcgc Protospacer
******** *******.********.. **.**
92. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
93. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
94. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
95. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
96. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
97. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
98. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
99. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
100. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
101. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
102. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
103. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
104. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
105. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
106. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
107. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
108. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
109. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
110. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
111. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
112. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
113. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
114. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
115. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
116. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
117. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
118. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
119. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
120. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
121. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
122. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
123. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
124. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
125. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
126. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
127. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
128. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
129. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
130. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
131. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
132. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
133. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
134. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
135. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
136. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
137. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
138. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
139. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
140. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
141. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
142. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
143. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
144. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
145. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
146. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
147. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
148. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
149. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
150. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
151. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
152. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
153. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgaaaccgaagc Protospacer
******** *******.********.. . *
154. spacer 1.11|135204|35|NC_014753|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.743
gctgctgcagatcggcgtgaacgaagtgcgcggcg CRISPR spacer
ccagggcgagatcggcgtgatcgaggtgcgcggcc Protospacer
* * ************ ***.*********
155. spacer 1.11|135204|35|NC_014753|CRT matches to NZ_CP054600 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
gctgctgcagatcggcgtgaacgaagtgcgcggcg CRISPR spacer
gcagggcgaggtcggcgtgatcgaagtgcgcgggc Protospacer
** * **.********* ************
156. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgagaccgaagc Protospacer
******** *******.*******... . *
157. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
gctgctgccgatcggcatgaacgagaccgaagc Protospacer
******** *******.*******... . *
158. spacer 1.5|135204|33|NC_014753|CRISPRCasFinder matches to NC_021295 (Burkholderia insecticola plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.697
gctgctgcagatcggcgtgaacgaagtgcgcgg CRISPR spacer
ggaattgcagatcggcatgaacgacgtgctgca Protospacer
* ..***********.******* **** .
159. spacer 1.6|135266|32|NC_014753|CRISPRCasFinder matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 10, identity: 0.688
ctcgaggccggcgagtccctcaaacttgaggc CRISPR spacer
gtcgaggccggcgagtcgctcgaaagctgtgt Protospacer
**************** ***.** . . *.
