Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017583 Spirochaeta thermophila DSM 6578, complete sequence 3 crisprs cas3HD,cas1,cas2,DinG,cas3,cas10d,cas11d,csc2gr7,cas4,cas6,csa3,DEDDh 0 1 5 0

Results visualization

1. NC_017583
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017583_1 706868-707012 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017583_2 795764-797434 TypeI-D NA
22 spacers
cas3,cas3HD,cas10d,cas11d,csc2gr7,cas4,cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017583_3 807201-809617 TypeI-D NA
32 spacers
csc2gr7,cas11d,cas10d,cas3HD,cas3,cas4,cas2,cas1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017583_3 3.17|808426|36|NC_017583|CRT,PILER-CR,CRISPRCasFinder 808426-808461 36 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 591915-591950 10 0.722

1. spacer 3.17|808426|36|NC_017583|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 10, identity: 0.722

tacagcacaccggcgcgactggccgctctgatgcgc	CRISPR spacer
ggtgggcctgcggctcgactggtcgctctgatgcgc	Protospacer
 ...*  *  **** *******.*************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 528599 : 593462 57 Indivirus(18.18%) tRNA,transposase NA
DBSCAN-SWA_2 1009951 : 1060965 51 Mycobacterium_phage(18.18%) protease,tRNA,transposase NA
DBSCAN-SWA_3 1442514 : 1452756 7 Microbacterium_phage(16.67%) NA NA
DBSCAN-SWA_4 2317174 : 2374455 47 Tupanvirus(12.5%) tRNA,transposase NA
DBSCAN-SWA_5 2440161 : 2492793 49 Bacillus_phage(25.0%) protease,tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage