Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014830 Intrasporangium calvum DSM 43043, complete sequence 4 crisprs csa3,RT,cas3,DEDDh,cas4,WYL,DinG 0 1 4 0

Results visualization

1. NC_014830
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014830_1 471397-471506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014830_2 1213827-1213933 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014830_3 1535621-1535695 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014830_4 1938140-1938199 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014830_3 3.1|1535645|27|NC_014830|CRISPRCasFinder 1535645-1535671 27 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 77956-77982 5 0.815

1. spacer 3.1|1535645|27|NC_014830|CRISPRCasFinder matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

caagtggtgcggtttccctgcaggccg	CRISPR spacer
taagcggtgcggtttcccagcaggggg	Protospacer
.***.************* *****  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 338194 : 374885 31 Bacillus_virus(33.33%) integrase,transposase attL 337612:337632|attR 379145:379165
DBSCAN-SWA_2 851479 : 865174 11 Mycobacterium_phage(100.0%) integrase,transposase attL 842827:842843|attR 870209:870225
DBSCAN-SWA_3 937919 : 990035 43 Acidithiobacillus_phage(16.67%) integrase,protease,transposase attL 933158:933178|attR 1000755:1000775
DBSCAN-SWA_4 3870249 : 3918097 51 Gordonia_phage(14.29%) holin,integrase,transposase attL 3869343:3869361|attR 3880734:3880752
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage