Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017304 Hungateiclostridium thermocellum DSM 1313, complete sequence 5 crisprs WYL,cas8b1,cas6,csx1,cas10,csm3gr7,csx10gr5,csx19,cas2,cas4,cas3,csa3,DEDDh,DinG,csm2gr11,cas1,cas5,cas7 0 8 5 0

Results visualization

1. NC_017304
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017304_1 879396-879663 TypeIII ?
3 spacers
csx1,csm3gr7,csx19,csx10gr5,cas10,cas2,cas4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017304_2 976887-982276 Orphan NA
80 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017304_3 1914892-1916668 Unclear NA
26 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017304_4 1930002-1933245 Unclear NA
48 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017304_5 3480109-3481947 TypeI-B NA
27 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017304_2 2.32|978995|36|NC_017304|CRISPRCasFinder,CRT,PILER-CR 978995-979030 36 NZ_CP048423 Sphingomonas insulae strain KCTC 12872 plasmid unnamed4, complete sequence 7989-8024 7 0.806
NC_017304_3 3.24|1916466|39|NC_017304|CRISPRCasFinder,CRT 1916466-1916504 39 MT330372 Cronobacter phage JC01, complete genome 8028-8066 7 0.821
NC_017304_4 4.16|1931043|36|NC_017304|CRISPRCasFinder,CRT 1931043-1931078 36 NZ_KT020842 Clostridium perfringens strain JP838 plasmid pJP838B, complete sequence 16212-16247 7 0.806
NC_017304_4 4.64|1931044|36|NC_017304|PILER-CR 1931044-1931079 36 NZ_KT020842 Clostridium perfringens strain JP838 plasmid pJP838B, complete sequence 16212-16247 7 0.806
NC_017304_3 3.47|1916466|40|NC_017304|PILER-CR 1916466-1916505 40 MT330372 Cronobacter phage JC01, complete genome 8027-8066 8 0.8
NC_017304_2 2.52|980337|36|NC_017304|CRISPRCasFinder,CRT,PILER-CR 980337-980372 36 NC_015511 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY01, complete sequence 123093-123128 9 0.75
NC_017304_4 4.27|1931778|37|NC_017304|CRISPRCasFinder,CRT 1931778-1931814 37 NC_010929 Agrobacterium tumefaciens Ti plasmid pTiBo542, complete sequence 26866-26902 12 0.676
NC_017304_4 4.27|1931778|37|NC_017304|CRISPRCasFinder,CRT 1931778-1931814 37 NZ_KY000026 Agrobacterium genomosp. 6 strain CFBP1873 plasmid pTi_CFBP1873, complete sequence 26868-26904 12 0.676
NC_017304_4 4.75|1931779|37|NC_017304|PILER-CR 1931779-1931815 37 NC_010929 Agrobacterium tumefaciens Ti plasmid pTiBo542, complete sequence 26866-26902 12 0.676
NC_017304_4 4.75|1931779|37|NC_017304|PILER-CR 1931779-1931815 37 NZ_KY000026 Agrobacterium genomosp. 6 strain CFBP1873 plasmid pTi_CFBP1873, complete sequence 26868-26904 12 0.676

1. spacer 2.32|978995|36|NC_017304|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048423 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.806

ccgcca-gctccggacggaagcgaggcaacggcggaa	CRISPR spacer
-ggcgacgctgcggacggaagcggggcaacggcgaac	Protospacer
  ** * *** ************.**********.* 

2. spacer 3.24|1916466|39|NC_017304|CRISPRCasFinder,CRT matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 7, identity: 0.821

ctagacagtcacgcgcgattgcctgtacaatgttttcaa	CRISPR spacer
ccagcacgtcacgcgcgatagcctgtacgatgttttcca	Protospacer
*.**   ************ ********.******** *

3. spacer 4.16|1931043|36|NC_017304|CRISPRCasFinder,CRT matches to NZ_KT020842 (Clostridium perfringens strain JP838 plasmid pJP838B, complete sequence) position: , mismatch: 7, identity: 0.806

-gtggtacgttctgccataccatttagccttatactc	CRISPR spacer
aacagtat-ttcttccataccatttagccttatattc	Protospacer
 ...***. **** ********************.**

4. spacer 4.64|1931044|36|NC_017304|PILER-CR matches to NZ_KT020842 (Clostridium perfringens strain JP838 plasmid pJP838B, complete sequence) position: , mismatch: 7, identity: 0.806

-gtggtacgttctgccataccatttagccttatactc	CRISPR spacer
aacagtat-ttcttccataccatttagccttatattc	Protospacer
 ...***. **** ********************.**

5. spacer 3.47|1916466|40|NC_017304|PILER-CR matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 8, identity: 0.8

ctagacagtcacgcgcgattgcctgtacaatgttttcaaa	CRISPR spacer
ccagcacgtcacgcgcgatagcctgtacgatgttttccac	Protospacer
*.**   ************ ********.******** * 

6. spacer 2.52|980337|36|NC_017304|CRISPRCasFinder,CRT,PILER-CR matches to NC_015511 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY01, complete sequence) position: , mismatch: 9, identity: 0.75

tatagtagatgcagaagaagccttgcaggaaatact	CRISPR spacer
gttgggcattgccgaagaagtcttgcaggaaatact	Protospacer
  *.*  . *** *******.***************

7. spacer 4.27|1931778|37|NC_017304|CRISPRCasFinder,CRT matches to NC_010929 (Agrobacterium tumefaciens Ti plasmid pTiBo542, complete sequence) position: , mismatch: 12, identity: 0.676

ttggtcaaggtgttgacgaggacaaagacaaaattgg	CRISPR spacer
tcggtcaagatgttgacgaggacaacgaaggtcgcaa	Protospacer
*.*******.*************** ** ..   ...

8. spacer 4.27|1931778|37|NC_017304|CRISPRCasFinder,CRT matches to NZ_KY000026 (Agrobacterium genomosp. 6 strain CFBP1873 plasmid pTi_CFBP1873, complete sequence) position: , mismatch: 12, identity: 0.676

ttggtcaaggtgttgacgaggacaaagacaaaattgg	CRISPR spacer
tcggtcaagatgttgacgaggacaacgaaggtcgcaa	Protospacer
*.*******.*************** ** ..   ...

9. spacer 4.75|1931779|37|NC_017304|PILER-CR matches to NC_010929 (Agrobacterium tumefaciens Ti plasmid pTiBo542, complete sequence) position: , mismatch: 12, identity: 0.676

ttggtcaaggtgttgacgaggacaaagacaaaattgg	CRISPR spacer
tcggtcaagatgttgacgaggacaacgaaggtcgcaa	Protospacer
*.*******.*************** ** ..   ...

10. spacer 4.75|1931779|37|NC_017304|PILER-CR matches to NZ_KY000026 (Agrobacterium genomosp. 6 strain CFBP1873 plasmid pTi_CFBP1873, complete sequence) position: , mismatch: 12, identity: 0.676

ttggtcaaggtgttgacgaggacaaagacaaaattgg	CRISPR spacer
tcggtcaagatgttgacgaggacaacgaaggtcgcaa	Protospacer
*.*******.*************** ** ..   ...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 881639 : 954098 57 uncultured_virus(22.22%) transposase NA
DBSCAN-SWA_2 1179125 : 1188548 8 Prochlorococcus_phage(28.57%) NA NA
DBSCAN-SWA_3 2217048 : 2286526 51 Bacillus_phage(21.43%) tRNA,coat,protease,transposase NA
DBSCAN-SWA_4 2783691 : 2862003 78 Erysipelothrix_phage(69.23%) holin,protease,capsid,tail,terminase,portal,head,tRNA,transposase NA
DBSCAN-SWA_5 3124567 : 3205645 57 Enterobacteria_phage(28.57%) tRNA,holin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage