Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014924 Pseudoxanthomonas suwonensis 11-1, complete sequence 6 crisprs DinG,csa3,DEDDh,WYL,Cas9_archaeal,cas3 0 1 2 0

Results visualization

1. NC_014924
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014924_1 414010-414122 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014924_2 2402024-2402130 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014924_3 2405447-2405602 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014924_4 2518299-2518431 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014924_5 2839966-2840129 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014924_6 3224300-3224485 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014924_1 1.1|414051|31|NC_014924|CRISPRCasFinder 414051-414081 31 MN850571 Escherichia phage nepoznato, complete genome 63071-63101 10 0.677

1. spacer 1.1|414051|31|NC_014924|CRISPRCasFinder matches to MN850571 (Escherichia phage nepoznato, complete genome) position: , mismatch: 10, identity: 0.677

agaattccaaaattgtacgccgtgaccctca	CRISPR spacer
agaattccaaaactgtaagccgtccgttgtg	Protospacer
************.**** *****   .. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1274516 : 1294685 31 Xylella_phage(26.67%) terminase NA
DBSCAN-SWA_2 1969876 : 1977666 9 Erysipelothrix_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage