Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014933 Bacteroides helcogenes P 36-108, complete sequence 2 crisprs PD-DExK,DEDDh,PrimPol,DinG,WYL,cas2,cas1,cas4,cas7,cas8c,cas5,cas3 0 3 0 1

Results visualization

1. NC_014933
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014933_1 2407959-2408059 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014933_2 3657027-3657915 TypeI I-C
13 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014933_2 2.13|3657851|33|NC_014933|PILER-CR,CRISPRCasFinder,CRT 3657851-3657883 33 LT960610 Bacillus phage SBSphiC genome assembly, complete genome: monopartite 21081-21113 8 0.758
NC_014933_2 2.10|3657652|34|NC_014933|PILER-CR,CRISPRCasFinder,CRT 3657652-3657685 34 NC_013940 Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence 302904-302937 9 0.735
NC_014933_2 2.7|3657455|34|NC_014933|PILER-CR,CRISPRCasFinder,CRT 3657455-3657488 34 NC_019763 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence 150312-150345 10 0.706
NC_014933_2 2.10|3657652|34|NC_014933|PILER-CR,CRISPRCasFinder,CRT 3657652-3657685 34 MN693152 Marine virus AFVG_25M11, complete genome 2030-2063 10 0.706

1. spacer 2.13|3657851|33|NC_014933|PILER-CR,CRISPRCasFinder,CRT matches to LT960610 (Bacillus phage SBSphiC genome assembly, complete genome: monopartite) position: , mismatch: 8, identity: 0.758

atccaaaaagttgcacctttgcac----cggacatca	CRISPR spacer
atccaaaaagtggcacctttgtactctttcgac----	Protospacer
*********** *********.**    . ***    

2. spacer 2.10|3657652|34|NC_014933|PILER-CR,CRISPRCasFinder,CRT matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 9, identity: 0.735

gtcaaatttttgtttaactgctccatcacgtaat	CRISPR spacer
aacaaatttttgtttaaatgatccattttgtcaa	Protospacer
. *************** ** *****. .** * 

3. spacer 2.7|3657455|34|NC_014933|PILER-CR,CRISPRCasFinder,CRT matches to NC_019763 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence) position: , mismatch: 10, identity: 0.706

catttctttgtagtccaattctgttccacaaaag	CRISPR spacer
catttctttgaagtctaattctgtcatctagtaa	Protospacer
********** ****.********. . .*. *.

4. spacer 2.10|3657652|34|NC_014933|PILER-CR,CRISPRCasFinder,CRT matches to MN693152 (Marine virus AFVG_25M11, complete genome) position: , mismatch: 10, identity: 0.706

gtcaaatttttgtttaactgctccatcacgtaat	CRISPR spacer
ttcaaaattttgtttaagtgctccaggtcttgga	Protospacer
 ***** ********** *******   * *.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_014933.1|WP_013547366.1|2228444_2228855_-|PcfK-like-family-protein 2228444_2228855_- 136 aa aa 40 HTH_XRE NA No NA