Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015147 Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence 0 crisprs NA 0 0 0 0
NC_015145 Pseudarthrobacter phenanthrenivorans Sphe3, complete sequence 1 crisprs csa3,cas3,DinG,WYL,DEDDh 0 1 2 0
NC_015146 Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE301, complete sequence 0 crisprs csa3 0 0 2 0

Results visualization

1. NC_015145
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015145_1 1499929-1500041 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015145_1 1.1|1499967|37|NC_015145|CRISPRCasFinder 1499967-1500003 37 JN699007 Mycobacterium phage Acadian, complete genome 23764-23800 10 0.73
NC_015145_1 1.1|1499967|37|NC_015145|CRISPRCasFinder 1499967-1500003 37 KY224000 Mycobacterium phage Rich, complete genome 23508-23544 11 0.703
NC_015145_1 1.1|1499967|37|NC_015145|CRISPRCasFinder 1499967-1500003 37 KR080199 Mycobacterium phage Baee, complete genome 23514-23550 11 0.703

1. spacer 1.1|1499967|37|NC_015145|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.73

cggccgcggcggggacggcgagcgtgctccccgtccc	CRISPR spacer
cgctgcaggcggcgacggcgggcgtgctccccggcgg	Protospacer
** .   ***** *******.************ *  

2. spacer 1.1|1499967|37|NC_015145|CRISPRCasFinder matches to KY224000 (Mycobacterium phage Rich, complete genome) position: , mismatch: 11, identity: 0.703

cggccgcggcggggacggcgagcgtgctccccgtccc	CRISPR spacer
ccctgcaggcggcgacgtcgagcgtgctccccggcgg	Protospacer
*  .   ***** **** *************** *  

3. spacer 1.1|1499967|37|NC_015145|CRISPRCasFinder matches to KR080199 (Mycobacterium phage Baee, complete genome) position: , mismatch: 11, identity: 0.703

cggccgcggcggggacggcgagcgtgctccccgtccc	CRISPR spacer
ccctgcaggcggcgacgtcgagcgtgctccccggcgg	Protospacer
*  .   ***** **** *************** *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2335095 : 2372693 36 Shigella_phage(54.55%) integrase,transposase attL 2347485:2347500|attR 2371580:2371595
DBSCAN-SWA_2 2973984 : 2994335 28 Tupanvirus(25.0%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_015146
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 16025 : 71586 46 Acinetobacter_phage(30.0%) integrase,transposase attL 11516:11533|attR 31309:31326
DBSCAN-SWA_2 90014 : 104494 13 Acinetobacter_phage(40.0%) integrase,transposase attL 92878:92892|attR 112375:112389
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage