Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017469 Lactobacillus delbrueckii subsp. bulgaricus 2038, complete genome 4 crisprs cas3,cas14j,DEDDh,cas2,csn2,DinG,csa3,Cas14u_CAS-V,c2c9_V-U4 1 18 4 0

Results visualization

1. NC_017469
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017469_1 41080-41236 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017469_2 688366-688492 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017469_3 755503-756792 TypeII-A NA
19 spacers
csn2,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017469_4 1782878-1782980 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_017469_3 3.10|756133|30|NC_017469|CRISPRCasFinder,CRT 756133-756162 30 NC_017469.1 1353838-1353867 0 1.0

1. spacer 3.10|756133|30|NC_017469|CRISPRCasFinder,CRT matches to position: 1353838-1353867, mismatch: 0, identity: 1.0

atctccgcggatatcctcgaaactctcatc	CRISPR spacer
atctccgcggatatcctcgaaactctcatc	Protospacer
******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017469_3 3.3|755671|30|NC_017469|CRISPRCasFinder,CRT 755671-755700 30 EF455602 Lactobacillus phage LL-H, complete genome 29270-29299 0 1.0
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NC_022775 Lactobacillus phage phiJB, complete genome 19317-19346 0 1.0
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 EF455602 Lactobacillus phage LL-H, complete genome 1015-1044 0 1.0
NC_017469_3 3.11|756199|30|NC_017469|CRISPRCasFinder,CRT 756199-756228 30 EU409559 Lactobacillus phage JCL1032, complete genome 20172-20201 0 1.0
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 NC_022775 Lactobacillus phage phiJB, complete genome 23885-23914 0 1.0
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 NC_022775 Lactobacillus phage phiJB, complete genome 23885-23915 0 1.0
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 EF455602 Lactobacillus phage LL-H, complete genome 3815-3844 1 0.967
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 CP031025 Lactobacillus phage ViSo-2018b, partial genome 24666-24695 1 0.967
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 EF455602 Lactobacillus phage LL-H, complete genome 6404-6433 1 0.967
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 CP031025 Lactobacillus phage ViSo-2018b, partial genome 20092-20121 1 0.967
NC_017469_3 3.21|756198|31|NC_017469|PILER-CR 756198-756228 31 EU409559 Lactobacillus phage JCL1032, complete genome 20171-20201 1 0.968
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 CP031025 Lactobacillus phage ViSo-2018b, partial genome 20091-20121 1 0.968
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 EF455602 Lactobacillus phage LL-H, complete genome 6404-6434 1 0.968
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 CP031025 Lactobacillus phage ViSo-2018b, partial genome 22694-22723 2 0.933
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NC_022775 Lactobacillus phage phiJB, complete genome 21284-21313 4 0.867
NC_017469_3 3.6|755869|30|NC_017469|CRISPRCasFinder,CRT 755869-755898 30 NC_049384 Enterobacter phage EspM4VN DNA, complete genome 99481-99510 5 0.833
NC_017469_3 3.6|755869|30|NC_017469|CRISPRCasFinder,CRT 755869-755898 30 LC373201 Enterobacter phage phiEM4 DNA, complete genome 99481-99510 5 0.833
NC_017469_3 3.7|755935|30|NC_017469|CRISPRCasFinder,CRT 755935-755964 30 NC_012855 Ralstonia pickettii 12D plasmid pRp12D01, complete sequence 223408-223437 5 0.833
NC_017469_3 3.1|755539|30|NC_017469|CRISPRCasFinder,CRT 755539-755568 30 LN681542 Clostridium phage phiMMP03, complete genome 37585-37614 6 0.8
NC_017469_3 3.1|755539|30|NC_017469|CRISPRCasFinder,CRT 755539-755568 30 NC_009231 Clostridium phage phiC2, complete genome 41122-41151 6 0.8
NC_017469_3 3.1|755539|30|NC_017469|CRISPRCasFinder,CRT 755539-755568 30 LN681541 Clostridium phage phiMMP01, complete genome 35003-35032 6 0.8
NC_017469_3 3.1|755539|30|NC_017469|CRISPRCasFinder,CRT 755539-755568 30 NC_048642 Clostridium phage CDKM9, complete genome 39069-39098 6 0.8
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP016845 Carnobacterium maltaromaticum strain TMW 2.1581 plasmid pL21581-1, complete sequence 70593-70622 6 0.8
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP022465 Enterocloster bolteae strain ATCC BAA-613 plasmid unnamed, complete sequence 31080-31109 6 0.8
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP021658 Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence 11432-11461 6 0.8
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 MH133207 Acinetobacter phage vB_AbaM_B9, complete genome 17534-17563 7 0.767
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 AP013432 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-U-MedDCM-OCT-S25-C65 17118-17147 7 0.767
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 MN694565 Marine virus AFVG_250M316, complete genome 38955-38984 7 0.767
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 773329-773358 7 0.767
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 KX578042 Leuconostoc phage Ln-7, complete genome 12730-12759 7 0.767
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 AP013515 Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S27-C25 29145-29174 7 0.767
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 GQ451696 Leuconostoc phage 1-A4, complete genome 12255-12284 7 0.767
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 KM262191 Leuconostoc phage Ln-8, complete genome 12730-12759 7 0.767
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 KC013026 Leuconostoc phage phiLN25, complete genome 12722-12751 7 0.767
NC_017469_3 3.10|756133|30|NC_017469|CRISPRCasFinder,CRT 756133-756162 30 NZ_CP020910 Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence 37997-38026 7 0.767
NC_017469_3 3.10|756133|30|NC_017469|CRISPRCasFinder,CRT 756133-756162 30 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 163886-163915 7 0.767
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 KF437907 Phormidium phage MIS-PhV1A, complete genome 30001-30030 7 0.767
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP031260 Klebsiella quasipneumoniae strain L22 plasmid pL22-3, complete sequence 26972-27001 8 0.733
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP025497 Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence 53278-53307 8 0.733
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP016860 Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence 53278-53307 8 0.733
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP012121 Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence 53313-53342 8 0.733
NC_017469_3 3.7|755935|30|NC_017469|CRISPRCasFinder,CRT 755935-755964 30 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 14618-14647 8 0.733
NC_017469_3 3.8|756001|30|NC_017469|CRISPRCasFinder,CRT 756001-756030 30 MN693516 Marine virus AFVG_25M345, complete genome 7921-7950 8 0.733
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP018028 Alteromonas mediterranea strain CP49 plasmid MCP49-600, complete sequence 565054-565083 8 0.733
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP018025 Alteromonas mediterranea strain CP48 plasmid pAMCP48-600, complete sequence 558462-558491 8 0.733
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 KR131711 Fusobacterium phage Funu2 supercont1.1, partial genome 30713-30742 8 0.733
NC_017469_3 3.10|756133|30|NC_017469|CRISPRCasFinder,CRT 756133-756162 30 NZ_CP016488 Synechococcus sp. PCC 8807 plasmid unnamed5, complete sequence 24149-24178 8 0.733
NC_017469_3 3.11|756199|30|NC_017469|CRISPRCasFinder,CRT 756199-756228 30 NC_049384 Enterobacter phage EspM4VN DNA, complete genome 22230-22259 8 0.733
NC_017469_3 3.11|756199|30|NC_017469|CRISPRCasFinder,CRT 756199-756228 30 LC373201 Enterobacter phage phiEM4 DNA, complete genome 22230-22259 8 0.733
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1327522-1327551 8 0.733
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1327522-1327551 8 0.733
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1327522-1327551 8 0.733
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1327526-1327555 8 0.733
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1327521-1327550 8 0.733
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 L02497 Bacteriophage mv4 ORF1, 3' end; minor structural protein (g20) gene, complete cds; major capsid protein (g34) gene, complete cds; ORF4-5, complete cds; ORF6, 5' end 370-399 8 0.733
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 NC_028782 Bacillus phage Pavlov, complete genome 4664-4693 8 0.733
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 NC_022770 Bacillus phage Pony, complete genome 4665-4694 8 0.733
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 KM236248 Bacillus phage Pookie, complete genome 4664-4693 8 0.733
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 KF669655 Bacillus phage Page, complete genome 4656-4685 8 0.733
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 KF669657 Bacillus phage poppyseed, complete genome 4656-4685 8 0.733
NC_017469_3 3.17|756595|30|NC_017469|CRISPRCasFinder,CRT 756595-756624 30 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 98191-98220 8 0.733
NC_017469_3 3.20|756132|31|NC_017469|PILER-CR 756132-756162 31 NZ_CP020910 Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence 37997-38027 8 0.742
NC_017469_3 3.20|756132|31|NC_017469|PILER-CR 756132-756162 31 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 163886-163916 8 0.742
NC_017469_3 3.20|756132|31|NC_017469|PILER-CR 756132-756162 31 NZ_CP016488 Synechococcus sp. PCC 8807 plasmid unnamed5, complete sequence 24148-24178 8 0.742
NC_017469_3 3.22|756264|31|NC_017469|PILER-CR 756264-756294 31 NZ_CP031226 Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence 171400-171430 8 0.742
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 L02497 Bacteriophage mv4 ORF1, 3' end; minor structural protein (g20) gene, complete cds; major capsid protein (g34) gene, complete cds; ORF4-5, complete cds; ORF6, 5' end 370-400 8 0.742
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 KF437907 Phormidium phage MIS-PhV1A, complete genome 30001-30031 8 0.742
NC_017469_3 3.2|755605|30|NC_017469|CRISPRCasFinder,CRT 755605-755634 30 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 369936-369965 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP022078 Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence 46016-46045 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 CP047483 Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence 47827-47856 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP045046 Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence 17029-17058 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP017857 Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence 19182-19211 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP017854 Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence 2277-2306 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP028186 Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence 36111-36140 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 CP013735 Campylobacter coli strain OR12 plasmid pOR12TET, complete sequence 1979-2008 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_CP044170 Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence 20806-20835 9 0.7
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NZ_MK541987 Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence 24048-24077 9 0.7
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP040376 Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed2, complete sequence 53970-53999 9 0.7
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP032752 Lactobacillus plantarum subsp. argentoratensis strain DSM 16365 plasmid unnamed1, complete sequence 10106-10135 9 0.7
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP023175 Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2A, complete sequence 4312-4341 9 0.7
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP028236 Lactobacillus plantarum strain SRCM101511 plasmid unnamed1, complete sequence 24327-24356 9 0.7
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP040375 Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed1, complete sequence 1527-1556 9 0.7
NC_017469_3 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT 756067-756096 30 NZ_CP018790 Campylobacter sp. RM6137 plasmid pSUIS6137, complete sequence 4467-4496 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1356274-1356303 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1361459-1361488 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 898463-898492 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1049386-1049415 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 543089-543118 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 548274-548303 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1593712-1593741 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1598450-1598479 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1049490-1049519 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 702922-702951 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1769269-1769298 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1774454-1774483 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1049191-1049220 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1751662-1751691 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 711961-711990 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 717134-717163 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1049137-1049166 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 686576-686605 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 691761-691790 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 698050-698079 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 816155-816184 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 824200-824229 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1432266-1432295 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 674798-674827 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 682843-682872 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 690035-690064 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 674798-674827 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 682843-682872 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 690035-690064 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1298781-1298810 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1304935-1304964 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1446067-1446096 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1269574-1269603 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1274744-1274773 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1399361-1399390 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1361015-1361044 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1218248-1218277 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1226670-1226699 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1339391-1339420 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1345655-1345684 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1350839-1350868 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1358123-1358152 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1399329-1399358 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1524548-1524577 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1529662-1529691 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1094260-1094289 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1100548-1100577 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1105733-1105762 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1139991-1140020 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1399368-1399397 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1269456-1269485 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1274641-1274670 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1346822-1346851 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1353111-1353140 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1358296-1358325 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1277949-1277978 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1282649-1282678 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1290020-1290049 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1460264-1460293 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1465449-1465478 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1060800-1060829 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1067089-1067118 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1275641-1275670 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1280814-1280843 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1312389-1312418 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1317573-1317602 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1217345-1217374 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1225767-1225796 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1255502-1255531 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1261390-1261419 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1268345-1268374 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1255493-1255522 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1261381-1261410 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1268336-1268365 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1272378-1272407 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1277551-1277580 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1457356-1457385 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1463645-1463674 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1468830-1468859 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1218240-1218269 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1226662-1226691 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1217595-1217624 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1226017-1226046 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1218231-1218260 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1226653-1226682 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1234928-1234957 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1239577-1239606 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1244691-1244720 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1346811-1346840 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1353100-1353129 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1358285-1358314 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1364574-1364603 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1369759-1369788 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1457323-1457352 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1463612-1463641 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1468797-1468826 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1332707-1332736 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1360962-1360991 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1369007-1369036 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1456129-1456158 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1462418-1462447 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1467603-1467632 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1358120-1358149 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1256823-1256852 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1262008-1262037 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1268165-1268194 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1332707-1332736 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1360962-1360991 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1369007-1369036 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1317984-1318013 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1129901-1129930 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1456165-1456194 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1462454-1462483 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1467639-1467668 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1332707-1332736 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1263604-1263633 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1298919-1298948 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1305073-1305102 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1256845-1256874 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1262030-1262059 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1268187-1268216 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1332711-1332740 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1360962-1360991 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1369007-1369036 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1360962-1360991 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1369007-1369036 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1360962-1360991 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1369007-1369036 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1456165-1456194 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1462454-1462483 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1467639-1467668 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1456154-1456183 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1462443-1462472 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1467628-1467657 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1256845-1256874 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1262030-1262059 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1268187-1268216 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1268736-1268765 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1275025-1275054 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1298902-1298931 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1305056-1305085 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1249399-1249428 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1255687-1255716 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1297077-1297106 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1303366-1303395 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1308551-1308580 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1343505-1343534 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1348690-1348719 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1456154-1456183 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1462443-1462472 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1467628-1467657 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1256845-1256874 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1262030-1262059 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1268187-1268216 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1332706-1332735 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1457144-1457173 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1463433-1463462 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1468618-1468647 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1256845-1256874 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1262030-1262059 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1268187-1268216 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1256845-1256874 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1262030-1262059 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1268187-1268216 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1456165-1456194 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1462454-1462483 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1467639-1467668 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1360965-1360994 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1369010-1369039 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1456176-1456205 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1462465-1462494 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1467650-1467679 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1455977-1456006 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1462266-1462295 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1467451-1467480 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1298891-1298920 9 0.7
NC_017469_3 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT 756331-756360 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1305044-1305073 9 0.7
NC_017469_3 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT 756463-756492 30 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 503-532 9 0.7
NC_017469_3 3.21|756198|31|NC_017469|PILER-CR 756198-756228 31 NC_049384 Enterobacter phage EspM4VN DNA, complete genome 22230-22260 9 0.71
NC_017469_3 3.21|756198|31|NC_017469|PILER-CR 756198-756228 31 LC373201 Enterobacter phage phiEM4 DNA, complete genome 22230-22260 9 0.71
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 NC_028782 Bacillus phage Pavlov, complete genome 4664-4694 9 0.71
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 NC_022770 Bacillus phage Pony, complete genome 4665-4695 9 0.71
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 KM236248 Bacillus phage Pookie, complete genome 4664-4694 9 0.71
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 KF669655 Bacillus phage Page, complete genome 4656-4686 9 0.71
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 KF669657 Bacillus phage poppyseed, complete genome 4656-4686 9 0.71
NC_017469_3 3.27|756594|31|NC_017469|PILER-CR 756594-756624 31 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 98190-98220 9 0.71
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 NC_027204 Sinorhizobium phage phiM12, complete genome 167800-167829 10 0.667
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 KR052482 Sinorhizobium phage phiN3, complete genome 172769-172798 10 0.667
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 KR052481 Sinorhizobium phage phiM19, complete genome 170498-170527 10 0.667
NC_017469_3 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT 755737-755766 30 KR052480 Sinorhizobium phage phiM7, complete genome 170878-170907 10 0.667
NC_017469_3 3.25|756462|31|NC_017469|PILER-CR 756462-756492 31 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 503-533 10 0.677

1. spacer 3.3|755671|30|NC_017469|CRISPRCasFinder,CRT matches to EF455602 (Lactobacillus phage LL-H, complete genome) position: , mismatch: 0, identity: 1.0

tgcctctgtcttgcttaatcaatcgtgcca	CRISPR spacer
tgcctctgtcttgcttaatcaatcgtgcca	Protospacer
******************************

2. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NC_022775 (Lactobacillus phage phiJB, complete genome) position: , mismatch: 0, identity: 1.0

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttgtttaattattttttcctccaa	Protospacer
******************************

3. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to EF455602 (Lactobacillus phage LL-H, complete genome) position: , mismatch: 0, identity: 1.0

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttgtttaattattttttcctccaa	Protospacer
******************************

4. spacer 3.11|756199|30|NC_017469|CRISPRCasFinder,CRT matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 0, identity: 1.0

cgaatacgaaaagacattgtacggctattc	CRISPR spacer
cgaatacgaaaagacattgtacggctattc	Protospacer
******************************

5. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to NC_022775 (Lactobacillus phage phiJB, complete genome) position: , mismatch: 0, identity: 1.0

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
ttttaacgacttgcccaggtcgattcccgg	Protospacer
******************************

6. spacer 3.25|756462|31|NC_017469|PILER-CR matches to NC_022775 (Lactobacillus phage phiJB, complete genome) position: , mismatch: 0, identity: 1.0

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
cttttaacgacttgcccaggtcgattcccgg	Protospacer
*******************************

7. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to EF455602 (Lactobacillus phage LL-H, complete genome) position: , mismatch: 1, identity: 0.967

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
ctgcacttcctttccgaaataagtttttga	Protospacer
***************.**************

8. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to CP031025 (Lactobacillus phage ViSo-2018b, partial genome) position: , mismatch: 1, identity: 0.967

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttatttaattattttttcctccaa	Protospacer
********.*********************

9. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to EF455602 (Lactobacillus phage LL-H, complete genome) position: , mismatch: 1, identity: 0.967

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
ttttaacgacttacccaggtcgattcccgg	Protospacer
************.*****************

10. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to CP031025 (Lactobacillus phage ViSo-2018b, partial genome) position: , mismatch: 1, identity: 0.967

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
ttttaacgacttacccaggtcgattcccgg	Protospacer
************.*****************

11. spacer 3.21|756198|31|NC_017469|PILER-CR matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 1, identity: 0.968

ccgaatacgaaaagacattgtacggctattc	CRISPR spacer
gcgaatacgaaaagacattgtacggctattc	Protospacer
 ******************************

12. spacer 3.25|756462|31|NC_017469|PILER-CR matches to CP031025 (Lactobacillus phage ViSo-2018b, partial genome) position: , mismatch: 1, identity: 0.968

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
cttttaacgacttacccaggtcgattcccgg	Protospacer
*************.*****************

13. spacer 3.25|756462|31|NC_017469|PILER-CR matches to EF455602 (Lactobacillus phage LL-H, complete genome) position: , mismatch: 1, identity: 0.968

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
cttttaacgacttacccaggtcgattcccgg	Protospacer
*************.*****************

14. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to CP031025 (Lactobacillus phage ViSo-2018b, partial genome) position: , mismatch: 2, identity: 0.933

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
ctgcacttcctttccaaaataaatttctga	Protospacer
**********************.***.***

15. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NC_022775 (Lactobacillus phage phiJB, complete genome) position: , mismatch: 4, identity: 0.867

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
ctgcacttcctttccgaaataggtttctaa	Protospacer
***************.*****.****.*.*

16. spacer 3.6|755869|30|NC_017469|CRISPRCasFinder,CRT matches to NC_049384 (Enterobacter phage EspM4VN DNA, complete genome) position: , mismatch: 5, identity: 0.833

agtgtttttgaatggggaagcagttcacaa	CRISPR spacer
cgtgtttgtgaatggggaagcagttgggaa	Protospacer
 ****** ***************** . **

17. spacer 3.6|755869|30|NC_017469|CRISPRCasFinder,CRT matches to LC373201 (Enterobacter phage phiEM4 DNA, complete genome) position: , mismatch: 5, identity: 0.833

agtgtttttgaatggggaagcagttcacaa	CRISPR spacer
cgtgtttgtgaatggggaagcagttgggaa	Protospacer
 ****** ***************** . **

18. spacer 3.7|755935|30|NC_017469|CRISPRCasFinder,CRT matches to NC_012855 (Ralstonia pickettii 12D plasmid pRp12D01, complete sequence) position: , mismatch: 5, identity: 0.833

gccggggcaatagcccccgccagagcgtcg	CRISPR spacer
accggcgcaatagcccccggcagagcggcc	Protospacer
.**** ************* ******* * 

19. spacer 3.1|755539|30|NC_017469|CRISPRCasFinder,CRT matches to LN681542 (Clostridium phage phiMMP03, complete genome) position: , mismatch: 6, identity: 0.8

atcat-gaatgtaatgtctaaattgtcgtta	CRISPR spacer
-tcatctaatgtaatgtctaaatagtcggct	Protospacer
 ****  **************** **** . 

20. spacer 3.1|755539|30|NC_017469|CRISPRCasFinder,CRT matches to NC_009231 (Clostridium phage phiC2, complete genome) position: , mismatch: 6, identity: 0.8

atcat-gaatgtaatgtctaaattgtcgtta	CRISPR spacer
-tcatctaatgtaatgtctaaatagtcggct	Protospacer
 ****  **************** **** . 

21. spacer 3.1|755539|30|NC_017469|CRISPRCasFinder,CRT matches to LN681541 (Clostridium phage phiMMP01, complete genome) position: , mismatch: 6, identity: 0.8

atcat-gaatgtaatgtctaaattgtcgtta	CRISPR spacer
-tcatctaatgtaatgtctaaatagtcggct	Protospacer
 ****  **************** **** . 

22. spacer 3.1|755539|30|NC_017469|CRISPRCasFinder,CRT matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 6, identity: 0.8

atcat-gaatgtaatgtctaaattgtcgtta	CRISPR spacer
-tcatctaatgtaatgtctaaatagtcggct	Protospacer
 ****  **************** **** . 

23. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016845 (Carnobacterium maltaromaticum strain TMW 2.1581 plasmid pL21581-1, complete sequence) position: , mismatch: 6, identity: 0.8

aactctttgtttaattattttttcctccaa	CRISPR spacer
aagtctttgtttaattatttttttatcttt	Protospacer
** ********************. **.  

24. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022465 (Enterocloster bolteae strain ATCC BAA-613 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

aactctttgtttaattattttttcctccaa	CRISPR spacer
aataaattatttaattatttttttctccaa	Protospacer
**.   **.**************.******

25. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 6, identity: 0.8

aactctttgtttaattattttttcctccaa	CRISPR spacer
ttctcattgtttatttattttttcctgaaa	Protospacer
  *** ******* ************  **

26. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to MH133207 (Acinetobacter phage vB_AbaM_B9, complete genome) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttgtttaattctattttctggata	Protospacer
**************** * *****.    *

27. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to AP013432 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-U-MedDCM-OCT-S25-C65) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
tgctctttgtttacttattttatccatcat	Protospacer
 .*********** ******* *** .** 

28. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to MN694565 (Marine virus AFVG_250M316, complete genome) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
taatctttgtttaatttttttttctttaac	Protospacer
 * ************* *******.*. * 

29. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
agacattcgtttcattattttttcctccca	Protospacer
*. . **.**** *************** *

30. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to KX578042 (Leuconostoc phage Ln-7, complete genome) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
aaccctttatttaattatttttttatggta	Protospacer
***.****.**************. *   *

31. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to AP013515 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S27-C25) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactatttatttaattatttttttgtatat	Protospacer
**** ***.**************. * .* 

32. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to GQ451696 (Leuconostoc phage 1-A4, complete genome) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
aaccctttatttaattatttttttatggta	Protospacer
***.****.**************. *   *

33. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to KM262191 (Leuconostoc phage Ln-8, complete genome) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
aaccctttatttaattatttttttatggta	Protospacer
***.****.**************. *   *

34. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to KC013026 (Leuconostoc phage phiLN25, complete genome) position: , mismatch: 7, identity: 0.767

aactctttgtttaattattttttcctccaa	CRISPR spacer
aaccctttatttaattatttttttatggta	Protospacer
***.****.**************. *   *

35. spacer 3.10|756133|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 7, identity: 0.767

atctccgcggatatcctcgaaactctcatc	CRISPR spacer
atagccgacgatatcctcgaaactctcggg	Protospacer
**  ***  ******************.  

36. spacer 3.10|756133|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.767

atctccgcggatatcctcgaaactctcatc	CRISPR spacer
atagccgacgatatcctcgaaactctcggg	Protospacer
**  ***  ******************.  

37. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 7, identity: 0.767

ttttaacgacttgcccaggtcgattcccgg-----	CRISPR spacer
ttttaacgacttactcaggtcga-----gggatta	Protospacer
************.*.********     **     

38. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP031260 (Klebsiella quasipneumoniae strain L22 plasmid pL22-3, complete sequence) position: , mismatch: 8, identity: 0.733

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
taattcttccttttcaaaattagtttttgc	Protospacer
. .. ********.****** ******** 

39. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 8, identity: 0.733

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
taattcttccttttcaaaattagtttttgc	Protospacer
. .. ********.****** ******** 

40. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 8, identity: 0.733

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
taattcttccttttcaaaattagtttttgc	Protospacer
. .. ********.****** ******** 

41. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 8, identity: 0.733

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
taattcttccttttcaaaattagtttttgc	Protospacer
. .. ********.****** ******** 

42. spacer 3.7|755935|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

gccggggcaatagcccccgccagagcgtcg	CRISPR spacer
agaggggcaatggccgccgccagagcttgc	Protospacer
.  ********.*** ********** *  

43. spacer 3.8|756001|30|NC_017469|CRISPRCasFinder,CRT matches to MN693516 (Marine virus AFVG_25M345, complete genome) position: , mismatch: 8, identity: 0.733

atctgattttcagtcttgcaagtaactaaa	CRISPR spacer
gtgcctttttcagacttgcgagtaactaac	Protospacer
.* .  ******* *****.********* 

44. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP018028 (Alteromonas mediterranea strain CP49 plasmid MCP49-600, complete sequence) position: , mismatch: 8, identity: 0.733

aactctttgtttaattattttttcctccaa	CRISPR spacer
tactctttgtctaattattttatcatattt	Protospacer
 *********.********** ** * .  

45. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP018025 (Alteromonas mediterranea strain CP48 plasmid pAMCP48-600, complete sequence) position: , mismatch: 8, identity: 0.733

aactctttgtttaattattttttcctccaa	CRISPR spacer
tactctttgtctaattattttatcatattt	Protospacer
 *********.********** ** * .  

46. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to KR131711 (Fusobacterium phage Funu2 supercont1.1, partial genome) position: , mismatch: 8, identity: 0.733

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactgtttttttaattatttttttattttt	Protospacer
**** *** **************. *..  

47. spacer 3.10|756133|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016488 (Synechococcus sp. PCC 8807 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733

atctccgcggatatcctcgaaactctcatc	CRISPR spacer
actaaggcggatatcctcgaaaccttcata	Protospacer
*..   *****************..**** 

48. spacer 3.11|756199|30|NC_017469|CRISPRCasFinder,CRT matches to NC_049384 (Enterobacter phage EspM4VN DNA, complete genome) position: , mismatch: 8, identity: 0.733

cgaatacgaaaagacattgtacggctattc	CRISPR spacer
agaatacgaaaagacattctgcggcgggga	Protospacer
 ***************** *.**** .   

49. spacer 3.11|756199|30|NC_017469|CRISPRCasFinder,CRT matches to LC373201 (Enterobacter phage phiEM4 DNA, complete genome) position: , mismatch: 8, identity: 0.733

cgaatacgaaaagacattgtacggctattc	CRISPR spacer
agaatacgaaaagacattctgcggcgggga	Protospacer
 ***************** *.**** .   

50. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
tggcacgcagcagcagagccaggacaacca	Protospacer
**   . ************* *******..

51. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
tggcacgcagcagcagagccaggacaacca	Protospacer
**   . ************* *******..

52. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
tggcacgcagcagcagagccaggacaacca	Protospacer
**   . ************* *******..

53. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
tggcacgcagcagcagagccaggacaacca	Protospacer
**   . ************* *******..

54. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
tggcacgcagcagcagagccaggacaacca	Protospacer
**   . ************* *******..

55. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to L02497 (Bacteriophage mv4 ORF1, 3' end; minor structural protein (g20) gene, complete cds; major capsid protein (g34) gene, complete cds; ORF4-5, complete cds; ORF6, 5' end) position: , mismatch: 8, identity: 0.733

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
ttttaacgacttgcccaggtcggaaattaa	Protospacer
**********************.   ....

56. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to NC_028782 (Bacillus phage Pavlov, complete genome) position: , mismatch: 8, identity: 0.733

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
atttaacgacttgctcaggtcgagatatga	Protospacer
 *************.********  . .*.

57. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to NC_022770 (Bacillus phage Pony, complete genome) position: , mismatch: 8, identity: 0.733

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
atttaacgacttgctcaggtcgagatatga	Protospacer
 *************.********  . .*.

58. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to KM236248 (Bacillus phage Pookie, complete genome) position: , mismatch: 8, identity: 0.733

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
atttaacgacttgctcaggtcgagatatga	Protospacer
 *************.********  . .*.

59. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to KF669655 (Bacillus phage Page, complete genome) position: , mismatch: 8, identity: 0.733

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
atttaacgacttgctcaggtcgagatatga	Protospacer
 *************.********  . .*.

60. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to KF669657 (Bacillus phage poppyseed, complete genome) position: , mismatch: 8, identity: 0.733

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
atttaacgacttgctcaggtcgagatatga	Protospacer
 *************.********  . .*.

61. spacer 3.17|756595|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733

tacgcaatctacacaagacacgccaaggga	CRISPR spacer
ctgatcatctacactggacacgccaaggga	Protospacer
.  .. ******** .**************

62. spacer 3.20|756132|31|NC_017469|PILER-CR matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 8, identity: 0.742

catctccgcggatatcctcgaaactctcatc	CRISPR spacer
gatagccgacgatatcctcgaaactctcggg	Protospacer
 **  ***  ******************.  

63. spacer 3.20|756132|31|NC_017469|PILER-CR matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 8, identity: 0.742

catctccgcggatatcctcgaaactctcatc	CRISPR spacer
gatagccgacgatatcctcgaaactctcggg	Protospacer
 **  ***  ******************.  

64. spacer 3.20|756132|31|NC_017469|PILER-CR matches to NZ_CP016488 (Synechococcus sp. PCC 8807 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742

catctccgcggatatcctcgaaactctcatc	CRISPR spacer
cactaaggcggatatcctcgaaaccttcata	Protospacer
**..   *****************..**** 

65. spacer 3.22|756264|31|NC_017469|PILER-CR matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 8, identity: 0.742

ccttccctggtgctggtgtcgattgctccca	CRISPR spacer
ccttccctggtgacggtgtcgatgtattcat	Protospacer
************ .*********   *.*  

66. spacer 3.25|756462|31|NC_017469|PILER-CR matches to L02497 (Bacteriophage mv4 ORF1, 3' end; minor structural protein (g20) gene, complete cds; major capsid protein (g34) gene, complete cds; ORF4-5, complete cds; ORF6, 5' end) position: , mismatch: 8, identity: 0.742

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
cttttaacgacttgcccaggtcggaaattaa	Protospacer
***********************.   ....

67. spacer 3.25|756462|31|NC_017469|PILER-CR matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 8, identity: 0.742

cttttaacgacttgcccaggtcgattcccgg-----	CRISPR spacer
gttttaacgacttactcaggtcga-----gggatta	Protospacer
 ************.*.********     **     

68. spacer 3.2|755605|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 9, identity: 0.7

agagcttgcagtttacgccgctgagtgata	CRISPR spacer
caagctggctgtttacgccgctgagaaggg	Protospacer
 .**** ** *************** .. .

69. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022078 (Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

70. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to CP047483 (Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

71. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

72. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

73. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

74. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP028186 (Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

75. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to CP013735 (Campylobacter coli strain OR12 plasmid pOR12TET, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

76. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP044170 (Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

77. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_MK541987 (Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence) position: , mismatch: 9, identity: 0.7

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
attttattcctttcgaaaataagttttaat	Protospacer
 * .  ******** ************ . 

78. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP040376 (Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttgtttaattaattttaaacattg	Protospacer
***************** ****   . . .

79. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP032752 (Lactobacillus plantarum subsp. argentoratensis strain DSM 16365 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttgtttaattaattttaaacattg	Protospacer
***************** ****   . . .

80. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP023175 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2A, complete sequence) position: , mismatch: 9, identity: 0.7

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttgtttaattaattttaaacattg	Protospacer
***************** ****   . . .

81. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP028236 (Lactobacillus plantarum strain SRCM101511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttgtttaattaattttaaacattg	Protospacer
***************** ****   . . .

82. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP040375 (Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

aactctttgtttaattattttttcctccaa	CRISPR spacer
aactctttgtttaattaattttaaacattg	Protospacer
***************** ****   . . .

83. spacer 3.9|756067|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP018790 (Campylobacter sp. RM6137 plasmid pSUIS6137, complete sequence) position: , mismatch: 9, identity: 0.7

aactctttgtttaattattttttcctccaa	CRISPR spacer
tgttctttgtttaataatttcttccttttt	Protospacer
 ..************ ****.*****..  

84. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

85. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

86. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

87. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

88. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

89. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

90. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

91. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

92. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

93. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

94. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

95. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

96. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

97. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

98. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

99. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

100. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

101. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

102. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

103. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

104. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

105. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

106. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

107. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

108. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

109. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

110. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

111. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

112. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

113. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

114. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

115. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

116. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

117. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

118. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

119. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

120. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

121. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

122. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

123. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

124. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

125. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
yggcacgcagcagcagagccaggacaacca	Protospacer
 *   . ************* *******..

126. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

127. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

128. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

129. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

130. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

131. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

132. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

133. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

134. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

135. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

136. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

137. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

138. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

139. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

140. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

141. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

142. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

143. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

144. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

145. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

146. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

147. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

148. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

149. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

150. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

151. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

152. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

153. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

154. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

155. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

156. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

157. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

158. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

159. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

160. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

161. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

162. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

163. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

164. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

165. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

166. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

167. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

168. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

169. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

170. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

171. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

172. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

173. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

174. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

175. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

176. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

177. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

178. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

179. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

180. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

181. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

182. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

183. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

184. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

185. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

186. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

187. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

188. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

189. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

190. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

191. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

192. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

193. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

194. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

195. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

196. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

197. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

198. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

199. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

200. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

201. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

202. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

203. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

204. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

205. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

206. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

207. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

208. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

209. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

210. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

211. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

212. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

213. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

214. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

215. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

216. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

217. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

218. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

219. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

220. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

221. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

222. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

223. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

224. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

225. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

226. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

227. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

228. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

229. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

230. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

231. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

232. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

233. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

234. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

235. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

236. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

237. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

238. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

239. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

240. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

241. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

242. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

243. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

244. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

245. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

246. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

247. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

248. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

249. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

250. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

251. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacccagcagcagagccaggacaacca	Protospacer
.*   ..************* *******..

252. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

253. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

254. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

255. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

256. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

257. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

258. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

259. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

260. spacer 3.13|756331|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttcagcagcagagcctggacaactg	CRISPR spacer
cggcacgcagcagcagagccaggacaacca	Protospacer
.*   . ************* *******..

261. spacer 3.15|756463|30|NC_017469|CRISPRCasFinder,CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 9, identity: 0.7

ttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
cgagaacgacttgaccaggtcgaatccgcc	Protospacer
.   ********* ********* ***   

262. spacer 3.21|756198|31|NC_017469|PILER-CR matches to NC_049384 (Enterobacter phage EspM4VN DNA, complete genome) position: , mismatch: 9, identity: 0.71

ccgaatacgaaaagacattgtacggctattc	CRISPR spacer
aagaatacgaaaagacattctgcggcgggga	Protospacer
  ***************** *.**** .   

263. spacer 3.21|756198|31|NC_017469|PILER-CR matches to LC373201 (Enterobacter phage phiEM4 DNA, complete genome) position: , mismatch: 9, identity: 0.71

ccgaatacgaaaagacattgtacggctattc	CRISPR spacer
aagaatacgaaaagacattctgcggcgggga	Protospacer
  ***************** *.**** .   

264. spacer 3.25|756462|31|NC_017469|PILER-CR matches to NC_028782 (Bacillus phage Pavlov, complete genome) position: , mismatch: 9, identity: 0.71

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
gatttaacgacttgctcaggtcgagatatga	Protospacer
  *************.********  . .*.

265. spacer 3.25|756462|31|NC_017469|PILER-CR matches to NC_022770 (Bacillus phage Pony, complete genome) position: , mismatch: 9, identity: 0.71

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
gatttaacgacttgctcaggtcgagatatga	Protospacer
  *************.********  . .*.

266. spacer 3.25|756462|31|NC_017469|PILER-CR matches to KM236248 (Bacillus phage Pookie, complete genome) position: , mismatch: 9, identity: 0.71

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
gatttaacgacttgctcaggtcgagatatga	Protospacer
  *************.********  . .*.

267. spacer 3.25|756462|31|NC_017469|PILER-CR matches to KF669655 (Bacillus phage Page, complete genome) position: , mismatch: 9, identity: 0.71

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
gatttaacgacttgctcaggtcgagatatga	Protospacer
  *************.********  . .*.

268. spacer 3.25|756462|31|NC_017469|PILER-CR matches to KF669657 (Bacillus phage poppyseed, complete genome) position: , mismatch: 9, identity: 0.71

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
gatttaacgacttgctcaggtcgagatatga	Protospacer
  *************.********  . .*.

269. spacer 3.27|756594|31|NC_017469|PILER-CR matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

ctacgcaatctacacaagacacgccaaggga	CRISPR spacer
gctgatcatctacactggacacgccaaggga	Protospacer
 .  .. ******** .**************

270. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to NC_027204 (Sinorhizobium phage phiM12, complete genome) position: , mismatch: 10, identity: 0.667

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
tcattattccattccaaaataagttttgat	Protospacer
....  **** **************** . 

271. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to KR052482 (Sinorhizobium phage phiN3, complete genome) position: , mismatch: 10, identity: 0.667

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
tcattattccattccaaaataagttttgat	Protospacer
....  **** **************** . 

272. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to KR052481 (Sinorhizobium phage phiM19, complete genome) position: , mismatch: 10, identity: 0.667

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
tcattattccattccaaaataagttttgat	Protospacer
....  **** **************** . 

273. spacer 3.4|755737|30|NC_017469|CRISPRCasFinder,CRT matches to KR052480 (Sinorhizobium phage phiM7, complete genome) position: , mismatch: 10, identity: 0.667

ctgcacttcctttccaaaataagtttttga	CRISPR spacer
tcattattccattccaaaataagttttgat	Protospacer
....  **** **************** . 

274. spacer 3.25|756462|31|NC_017469|PILER-CR matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 10, identity: 0.677

cttttaacgacttgcccaggtcgattcccgg	CRISPR spacer
gcgagaacgacttgaccaggtcgaatccgcc	Protospacer
 .   ********* ********* ***   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 229357 : 246760 16 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_2 1029872 : 1137106 75 Streptococcus_phage(19.23%) protease,transposase,integrase,tRNA attL 1057166:1057181|attR 1081969:1082604
DBSCAN-SWA_3 1290177 : 1298749 8 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 1696614 : 1701572 6 Streptomyces_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage