Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017381 Helicobacter pylori 2018, complete sequence 2 crisprs DEDDh 0 4 2 0

Results visualization

1. NC_017381
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017381_1 532911-532990 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017381_2 920911-921108 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017381_2 2.3|921054|28|NC_017381|PILER-CR 921054-921081 28 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 1090167-1090194 5 0.821
NC_017381_2 2.6|921055|27|NC_017381|CRISPRCasFinder 921055-921081 27 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 1090168-1090194 5 0.815
NC_017381_2 2.2|920997|31|NC_017381|PILER-CR 920997-921027 31 MK448589 Streptococcus satellite phage Javan632, complete genome 4592-4622 6 0.806
NC_017381_2 2.5|920998|30|NC_017381|CRISPRCasFinder 920998-921027 30 MK448589 Streptococcus satellite phage Javan632, complete genome 4593-4622 6 0.8
NC_017381_2 2.2|920997|31|NC_017381|PILER-CR 920997-921027 31 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 752261-752291 7 0.774
NC_017381_2 2.5|920998|30|NC_017381|CRISPRCasFinder 920998-921027 30 U88974 Streptococcus thermophilus temperate bacteriophage O1205, complete genome 23169-23198 7 0.767
NC_017381_2 2.5|920998|30|NC_017381|CRISPRCasFinder 920998-921027 30 NC_004303 Streptococcus phage O1205, complete genome 23169-23198 7 0.767
NC_017381_2 2.2|920997|31|NC_017381|PILER-CR 920997-921027 31 U88974 Streptococcus thermophilus temperate bacteriophage O1205, complete genome 23169-23199 8 0.742
NC_017381_2 2.2|920997|31|NC_017381|PILER-CR 920997-921027 31 NC_004303 Streptococcus phage O1205, complete genome 23169-23199 8 0.742
NC_017381_2 2.5|920998|30|NC_017381|CRISPRCasFinder 920998-921027 30 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 752261-752290 9 0.7

1. spacer 2.3|921054|28|NC_017381|PILER-CR matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 5, identity: 0.821

tgacaatactagctttaataacgacacc	CRISPR spacer
taagaatattagctttagtaacgacacg	Protospacer
*.* ****.********.********* 

2. spacer 2.6|921055|27|NC_017381|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 5, identity: 0.815

gacaatactagctttaataacgacacc	CRISPR spacer
aagaatattagctttagtaacgacacg	Protospacer
.* ****.********.********* 

3. spacer 2.2|920997|31|NC_017381|PILER-CR matches to MK448589 (Streptococcus satellite phage Javan632, complete genome) position: , mismatch: 6, identity: 0.806

cagcgc-ccaatccacttttgaaaacagcaat	CRISPR spacer
-accgtaccaatcgccttttgaaaacagcaag	Protospacer
 * **. ******  **************** 

4. spacer 2.5|920998|30|NC_017381|CRISPRCasFinder matches to MK448589 (Streptococcus satellite phage Javan632, complete genome) position: , mismatch: 6, identity: 0.8

agcgc-ccaatccacttttgaaaacagcaat	CRISPR spacer
-ccgtaccaatcgccttttgaaaacagcaag	Protospacer
  **. ******  **************** 

5. spacer 2.2|920997|31|NC_017381|PILER-CR matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 7, identity: 0.774

--cagcgcccaatccacttttgaaaacagcaat	CRISPR spacer
atcaagg--caatctccttttgaaaacagcaac	Protospacer
  **. *  *****. ****************.

6. spacer 2.5|920998|30|NC_017381|CRISPRCasFinder matches to U88974 (Streptococcus thermophilus temperate bacteriophage O1205, complete genome) position: , mismatch: 7, identity: 0.767

agcgcccaatccacttttgaaaacagcaat	CRISPR spacer
agcgcccaaaacacttttgaaaactgatcc	Protospacer
*********  ************* *   .

7. spacer 2.5|920998|30|NC_017381|CRISPRCasFinder matches to NC_004303 (Streptococcus phage O1205, complete genome) position: , mismatch: 7, identity: 0.767

agcgcccaatccacttttgaaaacagcaat	CRISPR spacer
agcgcccaaaacacttttgaaaactgatcc	Protospacer
*********  ************* *   .

8. spacer 2.2|920997|31|NC_017381|PILER-CR matches to U88974 (Streptococcus thermophilus temperate bacteriophage O1205, complete genome) position: , mismatch: 8, identity: 0.742

cagcgcccaatccacttttgaaaacagcaat	CRISPR spacer
tagcgcccaaaacacttttgaaaactgatcc	Protospacer
.*********  ************* *   .

9. spacer 2.2|920997|31|NC_017381|PILER-CR matches to NC_004303 (Streptococcus phage O1205, complete genome) position: , mismatch: 8, identity: 0.742

cagcgcccaatccacttttgaaaacagcaat	CRISPR spacer
tagcgcccaaaacacttttgaaaactgatcc	Protospacer
.*********  ************* *   .

10. spacer 2.5|920998|30|NC_017381|CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 9, identity: 0.7

agcgcccaatccacttttgaaaacagcaat	CRISPR spacer
tcaaggcaatctccttttgaaaacagcaac	Protospacer
   .  *****. ****************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 454308 : 462867 8 Escherichia_phage(16.67%) tRNA NA
DBSCAN-SWA_2 605496 : 613696 8 Synechococcus_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage