Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015277 Sphingobacterium sp. 21, complete genome 8 crisprs csa3,WYL,DEDDh,PrimPol,DinG,cas3,PD-DExK 4 0 1 0

Results visualization

1. NC_015277
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015277_1 1057699-1057880 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015277_2 2683415-2683531 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015277_3 3711925-3712030 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015277_4 4172508-4172612 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015277_5 4947899-4947987 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015277_6 5863068-5863249 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015277_7 6169475-6169607 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015277_8 6218422-6218510 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_015277_1 1.2|1057788|22|NC_015277|CRISPRCasFinder 1057788-1057809 22 NC_015277.1 4947988-4948009 0 1.0
NC_015277_1 1.3|1057834|23|NC_015277|CRISPRCasFinder 1057834-1057856 23 NC_015277.1 4948034-4948056 0 1.0
NC_015277_6 6.2|5863157|22|NC_015277|CRISPRCasFinder 5863157-5863178 22 NC_015277.1 4947988-4948009 0 1.0
NC_015277_6 6.3|5863203|23|NC_015277|CRISPRCasFinder 5863203-5863225 23 NC_015277.1 4948034-4948056 0 1.0

1. spacer 1.2|1057788|22|NC_015277|CRISPRCasFinder matches to position: 4947988-4948009, mismatch: 0, identity: 1.0

ggcaatggtcaatatcaatctg	CRISPR spacer
ggcaatggtcaatatcaatctg	Protospacer
**********************

2. spacer 1.3|1057834|23|NC_015277|CRISPRCasFinder matches to position: 4948034-4948056, mismatch: 0, identity: 1.0

taccggcactatcggaccgaatt	CRISPR spacer
taccggcactatcggaccgaatt	Protospacer
***********************

3. spacer 6.2|5863157|22|NC_015277|CRISPRCasFinder matches to position: 4947988-4948009, mismatch: 0, identity: 1.0

ggcaatggtcaatatcaatctg	CRISPR spacer
ggcaatggtcaatatcaatctg	Protospacer
**********************

4. spacer 6.3|5863203|23|NC_015277|CRISPRCasFinder matches to position: 4948034-4948056, mismatch: 0, identity: 1.0

taccggcactatcggaccgaatt	CRISPR spacer
taccggcactatcggaccgaatt	Protospacer
***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5852574 : 5909395 46 Acidithiobacillus_phage(22.22%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage