Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012090 Mycobacterium tuberculosis W-148 chromosome, complete genome 14 crisprs csa3,cas3,DinG,WYL,cas4,DEDDh,c2c9_V-U4,csm3gr7,csm2gr11,cas10,cas6 8 36 1 0

Results visualization

1. NZ_CP012090
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_1 331810-332625 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_2 364789-365487 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_3 629593-629730 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_4 690331-690407 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_5 1352876-1353948 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_6 1638001-1638176 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_7 1852649-1852903 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_8 1935862-1936081 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_9 2893858-2895005 TypeIII II-B,III-A
15 spacers
csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_10 3576452-3576609 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_11 3743270-3743846 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_12 3852723-3852812 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_13 3954667-3956280 Orphan NA
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012090_14 4117233-4117321 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP012090.1 3953127-3953162 0 1.0
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP012090.1 3953439-3953474 0 1.0
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP012090.1 3953790-3953825 0 1.0
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP012090.1 3954148-3954183 0 1.0
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP012090.1 3954306-3954341 0 1.0
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP012090.1 3954658-3954693 0 1.0
NZ_CP012090_3 3.1|629611|18|NZ_CP012090|CRT 629611-629628 18 NZ_CP012090.1 23824-23841 1 0.944
NZ_CP012090_3 3.1|629611|18|NZ_CP012090|CRT 629611-629628 18 NZ_CP012090.1 1191174-1191191 1 0.944
NZ_CP012090_3 3.3|629695|18|NZ_CP012090|CRT 629695-629712 18 NZ_CP012090.1 3440820-3440837 1 0.944
NZ_CP012090_7 7.2|1852730|18|NZ_CP012090|CRT 1852730-1852747 18 NZ_CP012090.1 399372-399389 1 0.944
NZ_CP012090_7 7.2|1852730|18|NZ_CP012090|CRT 1852730-1852747 18 NZ_CP012090.1 605648-605665 1 0.944
NZ_CP012090_7 7.4|1852820|18|NZ_CP012090|CRT 1852820-1852837 18 NZ_CP012090.1 969559-969576 1 0.944
NZ_CP012090_2 2.5|365077|42|NZ_CP012090|CRISPRCasFinder 365077-365118 42 NZ_CP012090.1 373093-373134 2 0.952
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP012090.1 371908-371940 2 0.939
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP012090.1 3201836-3201857 2 0.909
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP012090.1 3938682-3938717 2 0.944

1. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to position: 3953127-3953162, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

2. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to position: 3953439-3953474, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

3. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to position: 3953790-3953825, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

4. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to position: 3954148-3954183, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

5. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to position: 3954306-3954341, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

6. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to position: 3954658-3954693, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

7. spacer 3.1|629611|18|NZ_CP012090|CRT matches to position: 23824-23841, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acgacgtcggcgacgacg	Protospacer
** ***************

8. spacer 3.1|629611|18|NZ_CP012090|CRT matches to position: 1191174-1191191, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acctcgtcggcgacgacg	Protospacer
*** **************

9. spacer 3.3|629695|18|NZ_CP012090|CRT matches to position: 3440820-3440837, mismatch: 1, identity: 0.944

accacgccgccaacgacg	CRISPR spacer
accacgccgcccacgacg	Protospacer
*********** ******

10. spacer 7.2|1852730|18|NZ_CP012090|CRT matches to position: 399372-399389, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

11. spacer 7.2|1852730|18|NZ_CP012090|CRT matches to position: 605648-605665, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

12. spacer 7.4|1852820|18|NZ_CP012090|CRT matches to position: 969559-969576, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

13. spacer 2.5|365077|42|NZ_CP012090|CRISPRCasFinder matches to position: 373093-373134, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

14. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to position: 371908-371940, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

15. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to position: 3201836-3201857, mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gttgccgatcagcccggcggca	Protospacer
**.********* *********

16. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to position: 3938682-3938717, mismatch: 2, identity: 0.944

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctctggtgg	Protospacer
******************************.**.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1975819-1975840 1 0.955
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1109892-1109913 1 0.955
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 87869-87890 1 0.955
NZ_CP012090_5 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder 1353895-1353916 22 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 362668-362689 1 0.955
NZ_CP012090_5 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder 1353895-1353916 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2289382-2289403 1 0.955
NZ_CP012090_5 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder 1353895-1353916 22 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 81656-81677 1 0.955
NZ_CP012090_5 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder 1353895-1353916 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 56160-56181 1 0.955
NZ_CP012090_5 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder 1352968-1352989 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 881140-881161 2 0.909
NZ_CP012090_5 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder 1352968-1352989 22 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 225972-225993 2 0.909
NZ_CP012090_5 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder 1352968-1352989 22 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 451168-451189 2 0.909
NZ_CP012090_5 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder 1352968-1352989 22 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 234992-235013 2 0.909
NZ_CP012090_5 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder 1352968-1352989 22 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 597449-597470 2 0.909
NZ_CP012090_5 5.3|1353022|22|NZ_CP012090|CRISPRCasFinder 1353022-1353043 22 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 117076-117097 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 448838-448859 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 160471-160492 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 175264-175285 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 457593-457614 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 166709-166730 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 166709-166730 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 166709-166730 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 166709-166730 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 164465-164486 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 97458-97479 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP012698 Microbacterium sp. No. 7 plasmid A, complete sequence 53118-53139 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100830-100851 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 307854-307875 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 23841-23862 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 279961-279982 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 359201-359222 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 606826-606847 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 411558-411579 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 300111-300132 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 483830-483851 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 68146-68167 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 175112-175133 2 0.909
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 314082-314103 2 0.909
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 402883-402907 2 0.92
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 416172-416196 2 0.92
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 472935-472959 2 0.92
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 622336-622360 2 0.92
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1218692-1218716 2 0.92
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 172932-172956 2 0.92
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1830573-1830597 2 0.92
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 275362-275386 2 0.92
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 213084-213108 2 0.92
NZ_CP012090_1 1.12|332401|27|NZ_CP012090|CRT 332401-332427 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5507414-5507440 3 0.889
NZ_CP012090_1 1.12|332401|27|NZ_CP012090|CRT 332401-332427 27 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 756232-756258 3 0.889
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 9264-9285 3 0.864
NZ_CP012090_5 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder 1353076-1353097 22 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 13233-13254 3 0.864
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 937294-937318 3 0.88
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1470762-1470786 3 0.88
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 MN586053 Arthrobacter phage BeatusComedenti, complete genome 26689-26713 3 0.88
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NC_031254 Arthrobacter phage Kitkat, complete genome 26809-26833 3 0.88
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NC_031231 Arthrobacter phage KellEzio, complete genome 26691-26715 3 0.88
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 633177-633201 3 0.88
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 74124-74148 3 0.88
NZ_CP012090_5 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder 1353895-1353916 22 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 380879-380900 3 0.864
NZ_CP012090_7 7.5|1852859|24|NZ_CP012090|CRT 1852859-1852882 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NZ_CP012090_7 7.5|1852859|24|NZ_CP012090|CRT 1852859-1852882 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 196683-196707 3 0.88
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 538429-538453 3 0.88
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 216008-216032 3 0.88
NZ_CP012090_1 1.2|331876|27|NZ_CP012090|CRT 331876-331902 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1403798-1403824 4 0.852
NZ_CP012090_2 2.1|364822|27|NZ_CP012090|CRISPRCasFinder 364822-364848 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NZ_CP012090_2 2.1|364822|27|NZ_CP012090|CRISPRCasFinder 364822-364848 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NZ_CP012090_2 2.7|365218|27|NZ_CP012090|CRISPRCasFinder 365218-365244 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 603744-603773 4 0.867
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 818773-818800 4 0.857
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 420542-420569 4 0.857
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 77799-77826 4 0.857
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 176640-176664 4 0.84
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 29428-29452 4 0.84
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 38191-38215 4 0.84
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 MT553342 Microbacterium phage Kelcole, complete genome 51573-51597 4 0.84
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NC_048068 Microbacterium phage OneinaGillian, complete genome 50894-50918 4 0.84
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 MT310894 Microbacterium phage Tempo, complete genome 51697-51721 4 0.84
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 42080-42104 4 0.84
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 67777-67801 4 0.84
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 MN034284 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence 624-648 4 0.84
NZ_CP012090_5 5.14|1353838|25|NZ_CP012090|CRISPRCasFinder 1353838-1353862 25 MN582064 Podoviridae sp. ctka020, complete genome 29274-29298 4 0.84
NZ_CP012090_7 7.5|1852859|24|NZ_CP012090|CRT 1852859-1852882 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NZ_CP012090_7 7.5|1852859|24|NZ_CP012090|CRT 1852859-1852882 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NZ_CP012090_7 7.5|1852859|24|NZ_CP012090|CRT 1852859-1852882 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 126145-126169 4 0.84
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 491307-491331 4 0.84
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 791148-791172 4 0.84
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 MH338239 Mycobacterium phage Mryolo, complete genome 49970-49994 4 0.84
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 MK305893 Mycobacterium phage Beatrix, complete genome 51771-51795 4 0.84
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 MN617845 Mycobacterium phage BaconJack, complete genome 53260-53284 4 0.84
NZ_CP012090_10 10.1|3576475|25|NZ_CP012090|CRT 3576475-3576499 25 MK359312 Mycobacterium phage Fushigi, complete genome 49866-49890 4 0.84
NZ_CP012090_1 1.3|331921|27|NZ_CP012090|CRT 331921-331947 27 MN103533 Mycobacterium phage Weirdo19, complete genome 26901-26927 5 0.815
NZ_CP012090_1 1.12|332401|27|NZ_CP012090|CRT 332401-332427 27 MK415400 Phage apr34_1784, complete genome 5470-5496 5 0.815
NZ_CP012090_1 1.12|332401|27|NZ_CP012090|CRT 332401-332427 27 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 161455-161481 5 0.815
NZ_CP012090_1 1.12|332401|27|NZ_CP012090|CRT 332401-332427 27 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 35634-35660 5 0.815
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 201261-201290 5 0.833
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 KM389325 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence 195-224 5 0.833
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 519541-519570 5 0.833
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 734-763 5 0.833
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 295647-295676 5 0.833
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 416946-416975 5 0.833
NZ_CP012090_2 2.1|364822|27|NZ_CP012090|CRISPRCasFinder 364822-364848 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NZ_CP012090_2 2.1|364822|27|NZ_CP012090|CRISPRCasFinder 364822-364848 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NZ_CP012090_2 2.7|365218|27|NZ_CP012090|CRISPRCasFinder 365218-365244 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NZ_CP012090_2 2.7|365218|27|NZ_CP012090|CRISPRCasFinder 365218-365244 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 94483-94510 5 0.821
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 KU728633 Mycobacterium phage Bipper, complete genome 41992-42019 5 0.821
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 MK977701 Mycobacterium phage Cracklewink, complete genome 41985-42012 5 0.821
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 100320-100347 5 0.821
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 614111-614135 5 0.8
NZ_CP012090_5 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder 1353130-1353154 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 92705-92729 5 0.8
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 45440-45470 5 0.839
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 123562-123592 5 0.839
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 72551-72581 5 0.839
NZ_CP012090_5 5.13|1353772|34|NZ_CP012090|CRISPRCasFinder 1353772-1353805 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 89410-89443 5 0.853
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 331149-331178 6 0.8
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 712798-712827 6 0.8
NZ_CP012090_1 1.2|331876|27|NZ_CP012090|CRT 331876-331902 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1931010-1931036 6 0.778
NZ_CP012090_1 1.2|331876|27|NZ_CP012090|CRT 331876-331902 27 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 253003-253029 6 0.778
NZ_CP012090_1 1.2|331876|27|NZ_CP012090|CRT 331876-331902 27 NZ_CP012183 Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence 75082-75108 6 0.778
NZ_CP012090_1 1.4|331966|30|NZ_CP012090|CRT 331966-331995 30 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 57659-57688 6 0.8
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 586980-587009 6 0.8
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 453093-453122 6 0.8
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 236156-236185 6 0.8
NZ_CP012090_2 2.1|364822|27|NZ_CP012090|CRISPRCasFinder 364822-364848 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NZ_CP012090_2 2.7|365218|27|NZ_CP012090|CRISPRCasFinder 365218-365244 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NZ_CP012090_2 2.9|365368|27|NZ_CP012090|CRISPRCasFinder 365368-365394 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NZ_CP012090_2 2.10|365428|27|NZ_CP012090|CRISPRCasFinder 365428-365454 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1565268-1565297 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 KX620751 Propionibacterium phage Doucette, complete genome 8876-8905 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NC_041891 Propionibacterium phage B22, complete genome 8817-8846 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NC_041894 Propionibacterium phage E6, complete genome 8927-8956 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 KX620754 Propionibacterium phage G4, complete genome 8865-8894 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 575683-575712 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1829167-1829196 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 MT818419 Mycobacterium phage Lolalove, complete genome 27446-27475 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 MN428050 Mycobacterium phage Apex, complete genome 27615-27644 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 MN234171 Mycobacterium phage Magpie, complete genome 27275-27304 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 KX589269 Mycobacterium phage Fortunato, complete genome 27431-27460 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NC_042035 Mycobacterium phage Zemanar, complete sequence 27435-27464 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NC_022331 Mycobacterium phage Bane1, complete genome 27108-27137 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 KF279413 Mycobacterium phage Bane2, complete genome 27087-27116 6 0.8
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 MT310870 Mycobacterium phage RawrgerThat, complete genome 27434-27463 6 0.8
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 39276-39303 6 0.786
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 76834-76861 6 0.786
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NZ_LR594663 Variovorax sp. RA8 plasmid 2 131793-131820 6 0.786
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 27764-27794 6 0.806
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 438646-438676 6 0.806
NZ_CP012090_5 5.13|1353772|34|NZ_CP012090|CRISPRCasFinder 1353772-1353805 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 28989-29022 6 0.824
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 56814-56846 6 0.818
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP054842 Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence 107094-107129 6 0.833
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 56814-56846 6 0.818
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 97870-97899 7 0.767
NZ_CP012090_1 1.4|331966|30|NZ_CP012090|CRT 331966-331995 30 MK460246 Mycobacterium phage Nibb, complete genome 5349-5378 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 401811-401840 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 191003-191032 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_AP022334 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence 130127-130156 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 282765-282794 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1675975-1676004 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 988804-988833 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 1096-1125 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 98302-98331 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 258318-258347 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 52934-52963 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 944807-944836 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1187570-1187599 7 0.767
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NC_021279 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence 36879-36908 7 0.767
NZ_CP012090_2 2.4|365017|27|NZ_CP012090|CRISPRCasFinder 365017-365043 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2600082-2600111 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2593965-2593994 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 110413-110442 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 444400-444429 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 741115-741144 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP012478 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence 144936-144965 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 444383-444412 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 66483-66512 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 320484-320513 7 0.767
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 26400-26429 7 0.767
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NZ_CP012090_5 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder 1352908-1352935 28 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 259627-259654 7 0.75
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 281800-281830 7 0.774
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 68407-68437 7 0.774
NZ_CP012090_7 7.3|1852769|30|NZ_CP012090|CRT 1852769-1852798 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NZ_CP012090_7 7.3|1852769|30|NZ_CP012090|CRT 1852769-1852798 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NZ_CP012090_7 7.3|1852769|30|NZ_CP012090|CRT 1852769-1852798 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922291-922322 7 0.781
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 68176-68207 7 0.781
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261173-261208 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306649-306684 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085515-1085550 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151737-1151772 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373507-373542 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085520-1085555 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634105-634140 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302033-1302068 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895529-895564 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422896-1422931 7 0.806
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794837-794872 7 0.806
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 CP006582 Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence 64257-64289 7 0.788
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 CP006582 Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence 64257-64289 7 0.788
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP030273 Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence 95733-95762 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP030273 Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence 123788-123817 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 CP047033 Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence 89427-89456 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 CP047033 Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence 117485-117514 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NC_009040 Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence 47843-47872 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NC_009040 Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence 76308-76337 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP047039 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence 89378-89407 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP047039 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence 117431-117460 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP015213 Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence 8885-8914 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP015213 Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence 36940-36969 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 MN586011 Mycobacterium phage LilMoolah, complete genome 12935-12964 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP051470 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence 87227-87256 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP051470 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence 115282-115311 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NC_011960 Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence 44273-44302 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP015290 Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence 71595-71624 8 0.733
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP015290 Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence 99650-99679 8 0.733
NZ_CP012090_1 1.4|331966|30|NZ_CP012090|CRT 331966-331995 30 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 475069-475098 8 0.733
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NC_019847 Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence 101111-101140 8 0.733
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 730591-730620 8 0.733
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 480868-480897 8 0.733
NZ_CP012090_1 1.13|332446|30|NZ_CP012090|CRT 332446-332475 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 61392-61421 8 0.733
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 437642-437671 8 0.733
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 9052-9081 8 0.733
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 349053-349083 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 336247-336277 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 262996-263026 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 336247-336277 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 264529-264559 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 458177-458207 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 311056-311086 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 88587-88617 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 284157-284187 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 300067-300097 8 0.742
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1510497-1510527 8 0.742
NZ_CP012090_7 7.3|1852769|30|NZ_CP012090|CRT 1852769-1852798 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NZ_CP012090_7 7.3|1852769|30|NZ_CP012090|CRT 1852769-1852798 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470080-470111 8 0.75
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 MG812496 Gordonia phage SallySpecial, complete genome 7676-7707 8 0.75
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 39373-39405 8 0.758
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP053714 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence 10206-10238 8 0.758
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP033508 Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence 6416-6448 8 0.758
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP033369 Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence 6416-6448 8 0.758
NZ_CP012090_13 13.8|3955267|36|NZ_CP012090|CRT 3955267-3955302 36 NZ_CP026546 Cupriavidus metallidurans strain Ni-2 plasmid unnamed2 51548-51583 8 0.778
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 39373-39405 8 0.758
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP053714 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence 10206-10238 8 0.758
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP033508 Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence 6416-6448 8 0.758
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP033369 Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence 6416-6448 8 0.758
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 133398-133430 8 0.758
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 150479-150511 8 0.758
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2366234-2366266 8 0.758
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 180927-180959 8 0.758
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NC_015057 Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence 170323-170355 8 0.758
NZ_CP012090_1 1.1|331828|30|NZ_CP012090|CRT 331828-331857 30 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 407654-407683 9 0.7
NZ_CP012090_1 1.14|332494|39|NZ_CP012090|CRT 332494-332532 39 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 24079-24117 9 0.769
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NZ_CP012090_3 3.2|629647|30|NZ_CP012090|CRT 629647-629676 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1695112-1695141 9 0.7
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NZ_CP012090_4 4.1|690354|31|NZ_CP012090|CRISPRCasFinder 690354-690384 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 345043-345073 9 0.71
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 245050-245080 9 0.71
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 194387-194417 9 0.71
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 MN234199 Mycobacterium phage Ekdilam, complete genome 24235-24265 9 0.71
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145162-1145192 9 0.71
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 453136-453166 9 0.71
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP013740 Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence 2806-2836 9 0.71
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1908459-1908489 9 0.71
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172271-172302 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172271-172302 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326579-326610 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68775-68806 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 1614-1645 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 7035-7066 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 113326-113357 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 124358-124389 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 67698-67729 9 0.719
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 MH271296 Gordonia phage Emperor, complete genome 8733-8764 9 0.719
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP046906 Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence 61960-61995 9 0.75
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 288011-288043 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 232975-233007 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 580620-580652 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 569016-569048 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 466175-466207 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 535556-535588 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 466175-466207 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 472219-472251 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 472209-472241 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 466187-466219 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 466207-466239 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 466161-466193 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 15179-15211 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 580663-580695 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 580663-580695 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 1232-1264 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 207743-207775 9 0.727
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 580654-580686 9 0.727
NZ_CP012090_13 13.11|3955495|36|NZ_CP012090|CRT 3955495-3955530 36 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2357906-2357941 9 0.75
NZ_CP012090_13 13.11|3955495|36|NZ_CP012090|CRT 3955495-3955530 36 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1269394-1269429 9 0.75
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 288011-288043 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 232975-233007 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 580620-580652 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 569016-569048 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 466175-466207 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 535556-535588 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 466175-466207 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 472219-472251 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 472209-472241 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 466187-466219 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 466207-466239 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 466161-466193 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 15179-15211 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 580663-580695 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 580663-580695 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 1232-1264 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 207743-207775 9 0.727
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 580654-580686 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 505963-505995 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NZ_CP041197 Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence 53275-53307 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 MK524502 Microbacterium phage TimoTea, complete genome 10774-10806 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NZ_CP042515 Serratia marcescens strain E28 plasmid pE28_003 32891-32923 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 KT281796 Mycobacterium phage Zakhe101, complete genome 31095-31127 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 AY129335 Mycobacterium virus Corndog, complete genome 32040-32072 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 MN428058 Mycobacterium phage Krili, complete genome 30507-30539 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NC_004685 Mycobacterium phage Corndog, complete genome 32040-32072 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 JN698993 Mycobacterium phage Firecracker, complete genome 31193-31225 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 MN585964 Mycobacterium phage Blessica, complete genome 31310-31342 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NC_022057 Mycobacterium phage Catdawg, complete genome 30999-31031 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 MT818425 Mycobacterium phage NiebruSaylor, complete genome 30379-30411 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 NC_022325 Mycobacterium phage Dylan, complete genome 31091-31123 9 0.727
NZ_CP012090_13 13.16|3955876|33|NZ_CP012090|CRT 3955876-3955908 33 MN428052 Mycobacterium phage Smooch, complete genome 32711-32743 9 0.727
NZ_CP012090_13 13.19|3956101|36|NZ_CP012090|CRT 3956101-3956136 36 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2357906-2357941 9 0.75
NZ_CP012090_13 13.19|3956101|36|NZ_CP012090|CRT 3956101-3956136 36 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1269394-1269429 9 0.75
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NZ_CP012090_2 2.6|365152|33|NZ_CP012090|CRISPRCasFinder 365152-365184 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 425898-425928 10 0.677
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 344090-344120 10 0.677
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 68383-68413 10 0.677
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 16322-16352 10 0.677
NZ_CP012090_5 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder 1353523-1353553 31 NZ_AP014581 Burkholderia sp. RPE67 plasmid p3, complete sequence 131907-131937 10 0.677
NZ_CP012090_5 5.13|1353772|34|NZ_CP012090|CRISPRCasFinder 1353772-1353805 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081518-1081551 10 0.706
NZ_CP012090_9 9.9|2894486|35|NZ_CP012090|PILER-CR,CRISPRCasFinder,CRT 2894486-2894520 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 1025-1056 10 0.688
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 89525-89556 10 0.688
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 684081-684112 10 0.688
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 399128-399159 10 0.688
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 182018-182053 10 0.722
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 37758-37790 10 0.697
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 315511-315543 10 0.697
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 37758-37790 10 0.697
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 315511-315543 10 0.697
NZ_CP012090_11 11.6|3743706|32|NZ_CP012090|CRT 3743706-3743737 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 301548-301579 11 0.656
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 MT498048 Mycobacterium phage Raymond7, complete genome 21146-21181 11 0.694
NZ_CP012090_13 13.3|3954877|36|NZ_CP012090|CRT 3954877-3954912 36 KF986246 Mycobacterium phage MichelleMyBell, complete genome 20760-20795 11 0.694
NZ_CP012090_13 13.5|3955030|33|NZ_CP012090|CRT 3955030-3955062 33 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 197504-197536 11 0.667
NZ_CP012090_13 13.13|3955639|33|NZ_CP012090|CRT 3955639-3955671 33 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 197504-197536 11 0.667

1. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

2. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

3. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcgggccggcggca	Protospacer
**********.***********

4. spacer 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

5. spacer 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

6. spacer 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

7. spacer 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

8. spacer 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

9. spacer 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

10. spacer 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

11. spacer 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

12. spacer 5.2|1352968|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

13. spacer 5.3|1353022|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909

ggtaccgtcctcgccggcggtg	CRISPR spacer
ggcaccgtcctcgccggcggtt	Protospacer
**.****************** 

14. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

15. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

16. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

17. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

18. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

19. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

20. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

21. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

22. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

23. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgggg	Protospacer
******************** .

24. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
accgccgatcaggccggcggca	Protospacer
..********************

25. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ctcggcgatcaggccggcggca	Protospacer
 *** *****************

26. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

27. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

28. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

29. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

30. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcg	Protospacer
***************** ***.

31. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ggcgccgatcaggccggcggcc	Protospacer
* ******************* 

32. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggcctgcggcg	Protospacer
*************** *****.

33. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

34. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgccg	Protospacer
******************* *.

35. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgagcaggccggcggcc	Protospacer
******** ************ 

36. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

37. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

38. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

39. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

40. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

41. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

42. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

43. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

44. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgcccgccgccgagctg	Protospacer
************  ***********

45. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

46. spacer 1.12|332401|27|NZ_CP012090|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
tcgccgttggcgatcagtccgccgtcg	Protospacer
.************ ***********.*

47. spacer 1.12|332401|27|NZ_CP012090|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
tcgccgttggcgatcagtccgccgtcg	Protospacer
.************ ***********.*

48. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgcgg	Protospacer
*******************  .

49. spacer 5.4|1353076|22|NZ_CP012090|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
ttcgccgatcaggccggcggtg	Protospacer
 *******************..

50. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
ctcgccgaacacgcggaagccgtct	Protospacer
**.*********** ********* 

51. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
attgtcgaacacgcggaagccgtcg	Protospacer
 ***.********* **********

52. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

53. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

54. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

55. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
catgcggaacacgccgaatccgtcg	Protospacer
* *** ************ ******

56. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgatcacgccgtagccgttg	Protospacer
******** ******* ******.*

57. spacer 5.15|1353895|22|NZ_CP012090|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864

caatccggcggcgccgccggca	CRISPR spacer
gaatccggcggcgccgccgggc	Protospacer
 *******************  

58. spacer 7.5|1852859|24|NZ_CP012090|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

59. spacer 7.5|1852859|24|NZ_CP012090|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

60. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.88

ggccccgccgccacccgccgagctg	CRISPR spacer
agccccgccgccacccgccgaccgg	Protospacer
.******************** * *

61. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgagggg	Protospacer
************.*********  *

62. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccaccagccgcgccg	Protospacer
*************** **** **.*

63. spacer 1.2|331876|27|NZ_CP012090|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.852

ccgaacaccccggcgtggccaccgtca	CRISPR spacer
ccgaacaccccggcgttgccgccgttg	Protospacer
**************** ***.****..

64. spacer 2.1|364822|27|NZ_CP012090|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

65. spacer 2.1|364822|27|NZ_CP012090|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

66. spacer 2.7|365218|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

67. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

68. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

69. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867

accacgccggtgaccacgccg-ccaacgacg	CRISPR spacer
accacgccggtggccacgccgaccagcggc-	Protospacer
************.******** ***.**.* 

70. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

71. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

72. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

73. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
tccgccgaacgcgccgaagccgtcg	Protospacer
...*******.**************

74. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

75. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

76. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

77. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

78. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

79. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacacgccgatgccctgc	Protospacer
***************** *** *  

80. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
aatgccgaattcgccgaagccgtcg	Protospacer
  *******. **************

81. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cccgtagaacacgccgaagccgtcg	Protospacer
*..*. *******************

82. spacer 5.14|1353838|25|NZ_CP012090|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgccaccgacccccccttgc	CRISPR spacer
ttttccgacaccgacccccccttga	Protospacer
.** *** **************** 

83. spacer 7.5|1852859|24|NZ_CP012090|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

84. spacer 7.5|1852859|24|NZ_CP012090|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

85. spacer 7.5|1852859|24|NZ_CP012090|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

86. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
acgcccgccgccacccgccgagcgg	Protospacer
.  ******************** *

87. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
ctccccgccgccaccggccgcgctg	Protospacer
  ************* **** ****

88. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
accaccgccgccccccgccgagctg	Protospacer
. * ******** ************

89. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to MH338239 (Mycobacterium phage Mryolo, complete genome) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
atccccgccgccatccgccgcgctg	Protospacer
. ***********.****** ****

90. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to MK305893 (Mycobacterium phage Beatrix, complete genome) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
atccccgccgccatccgccgcgctg	Protospacer
. ***********.****** ****

91. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to MN617845 (Mycobacterium phage BaconJack, complete genome) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
tcccccgccgccatccgccgcgctg	Protospacer
  ***********.****** ****

92. spacer 10.1|3576475|25|NZ_CP012090|CRT matches to MK359312 (Mycobacterium phage Fushigi, complete genome) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
atccccgccgccatccgccgcgctg	Protospacer
. ***********.****** ****

93. spacer 1.3|331921|27|NZ_CP012090|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815

ccggcgcctagagcgttggcaccgctg	CRISPR spacer
ctcgggcctagagcgttggcaccgtgg	Protospacer
*. * *******************. *

94. spacer 1.12|332401|27|NZ_CP012090|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
ccgccgttggcgaccagtccgcaatca	Protospacer
************* ******** .*..

95. spacer 1.12|332401|27|NZ_CP012090|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
gggtcgtcggagaacagtccgccgttg	Protospacer
  *.***.** ****************

96. spacer 1.12|332401|27|NZ_CP012090|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
gtggcgttgtcgaacagaccgccgttg	Protospacer
 .* ***** ******* *********

97. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccgggtcaccgccagcggggccagga	Protospacer
********* ************ ***. *.

98. spacer 1.13|332446|30|NZ_CP012090|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccgatccagacaccgccagcggcgccgagg	Protospacer
***..* .******************* **

99. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcg-ccgtgg	CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg-	Protospacer
*****************  *****  **.* 

100. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

101. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

102. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

103. spacer 2.1|364822|27|NZ_CP012090|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

104. spacer 2.1|364822|27|NZ_CP012090|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

105. spacer 2.7|365218|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

106. spacer 2.7|365218|27|NZ_CP012090|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

107. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

108. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

109. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

110. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

111. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

112. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

113. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

114. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

115. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

116. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

117. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

118. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

119. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

120. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

121. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

122. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

123. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

124. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

125. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

126. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

127. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

128. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

129. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

130. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

131. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

132. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

133. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

134. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

135. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

136. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

137. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gctgccgtgggtgccatcgttgccgagt	Protospacer
*.***** *****************. .

138. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

139. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

140. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gttgccgcgggtgccctcgttgcggacg	Protospacer
******* ******* ******* *.* 

141. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gccgccgaacacgccgaagccgttt	Protospacer
 ..********************. 

142. spacer 5.5|1353130|25|NZ_CP012090|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaacacgccgacgccgcgc	Protospacer
 **************** ****.  

143. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

144. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

145. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

146. spacer 5.13|1353772|34|NZ_CP012090|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853

gtcgccgtgcagccagccaccaccgcca-ccggcg	CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc-	Protospacer
 *************.********* *** ** ** 

147. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 6, identity: 0.8

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
gtggtggtggccccggccgtgccggcgttg	Protospacer
 .**  ***********. ***********

148. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 6, identity: 0.8

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
gtggtggtggccccggccgtgccggcgttg	Protospacer
 .**  ***********. ***********

149. spacer 1.2|331876|27|NZ_CP012090|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

ccgaacaccccggcgtggccaccgtca	CRISPR spacer
aacaacaccccggcgcggtcaccgtcg	Protospacer
   ************.**.*******.

150. spacer 1.2|331876|27|NZ_CP012090|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.778

ccgaacaccccggcgtggccaccgtca	CRISPR spacer
tggaacaccccggcgtggccgccgcgg	Protospacer
. ******************.***. .

151. spacer 1.2|331876|27|NZ_CP012090|CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 6, identity: 0.778

ccgaacaccccggcgtggccaccgtca	CRISPR spacer
tcgaacaccccggcgtggccgacgcgg	Protospacer
.*******************. **. .

152. spacer 1.4|331966|30|NZ_CP012090|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
tcagcggagccgaagatcacgccgccgagc	Protospacer
.*.************* ** *******  *

153. spacer 1.13|332446|30|NZ_CP012090|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg	Protospacer
*************** ** *****  *  *

154. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

ccggccgggacaccgccagcggcgccgtgg----	CRISPR spacer
ccagccgggagaccgccagcggc----tggctct	Protospacer
**.******* ************    ***    

155. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc	Protospacer
   .****  ******.************** 

156. spacer 2.1|364822|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

157. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

158. spacer 2.7|365218|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

159. spacer 2.9|365368|27|NZ_CP012090|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

160. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

161. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

162. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

163. spacer 2.10|365428|27|NZ_CP012090|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

164. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gcgccgccggtgactacgccgccagcgaca	Protospacer
.*  **********.*********.****.

165. spacer 3.2|629647|30|NZ_CP012090|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

166. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

167. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

168. spacer 3.2|629647|30|NZ_CP012090|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

169. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tccacgccggtgaccacgccgaccaccttg	Protospacer
 ******************** * **  .*

170. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
aagaggccggcgagcacgccgccaacgaag	Protospacer
*  * *****.** ************** *

171. spacer 3.2|629647|30|NZ_CP012090|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

172. spacer 3.2|629647|30|NZ_CP012090|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

173. spacer 3.2|629647|30|NZ_CP012090|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

174. spacer 3.2|629647|30|NZ_CP012090|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

175. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

176. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

177. spacer 3.2|629647|30|NZ_CP012090|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

178. spacer 3.2|629647|30|NZ_CP012090|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

179. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

180. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

181. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

182. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccggcggtgccatcggtgccgagg	Protospacer
* ****** ********** *****.  

183. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

184. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

185. spacer 5.13|1353772|34|NZ_CP012090|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824

--gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca	Protospacer
  ****.*  *****  ******************.

186. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc	Protospacer
 *. .*** *****************.******

187. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.833

tagcagcggtgccggcggcaccaacggctccggcgg-	CRISPR spacer
ccgcatcggtgccggcggcaccatcggc-acggcggc	Protospacer
. *** ***************** ****  ****** 

188. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc	Protospacer
 *. .*** *****************.******

189. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 7, identity: 0.767

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
gtggtggtggccccggccgtgccggcgttc	Protospacer
 .**  ***********. ********** 

190. spacer 1.4|331966|30|NZ_CP012090|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc	Protospacer
******.******** ********  .. *

191. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca	Protospacer
******.******** ********* .  .

192. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca	Protospacer
..**** ** *****************. .

193. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc	Protospacer
* ******.***************. . * 

194. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc	Protospacer
.** *.. *** ***************** 

195. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacaccga	Protospacer
******.*************.**.*  .*.

196. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

197. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

198. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

199. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg	Protospacer
 ******** **.***********   .**

200. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
accgcatcgaccccgccagcggcgccgtga	Protospacer
 * **   *** *****************.

201. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

202. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

203. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

204. spacer 2.4|365017|27|NZ_CP012090|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

205. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
taggcgccggtgaccccgccgccgacgatg	Protospacer
   .*********** *******.****.*

206. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg	Protospacer
  *..* ******************.*.**

207. spacer 3.2|629647|30|NZ_CP012090|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atagcgccggtcaccgcgccgccaacgata	Protospacer
*. .******* ***.************..

208. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

209. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

210. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

211. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

212. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag	Protospacer
 * .***********.********* *  *

213. spacer 3.2|629647|30|NZ_CP012090|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggcccgccgatggccacgccgccaacggca	Protospacer
. * *****.**.**************.*.

214. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg	Protospacer
..*. * ****************. *****

215. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

216. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

217. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

218. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

219. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

220. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

221. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

222. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

223. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

224. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

225. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

226. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

227. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

228. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

229. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

230. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

231. spacer 5.1|1352908|28|NZ_CP012090|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
agcacccggggtgccgtcgttgccggcg	Protospacer
. ..** ********.*********** 

232. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc	Protospacer
. *  **** *********.********** 

233. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg	Protospacer
**. ***.************ ******. *.

234. spacer 7.3|1852769|30|NZ_CP012090|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

235. spacer 7.3|1852769|30|NZ_CP012090|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

236. spacer 7.3|1852769|30|NZ_CP012090|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

237. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc	Protospacer
**    .********.**** ***********

238. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc	Protospacer
**..* *  ********* ***.*********

239. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc	Protospacer
**.************************ ** ..* .

240. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt	Protospacer
*********** ******.******** *    ***

241. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

242. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

243. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

244. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

245. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

246. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

247. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

248. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

249. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

250. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc	Protospacer
*****.****.************* . **.* *

251. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc	Protospacer
*****.****.************* . **.* *

252. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

253. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

254. spacer 1.1|331828|30|NZ_CP012090|CRT matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

255. spacer 1.1|331828|30|NZ_CP012090|CRT matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

256. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

257. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

258. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

259. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

260. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

261. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

262. spacer 1.1|331828|30|NZ_CP012090|CRT matches to MN586011 (Mycobacterium phage LilMoolah, complete genome) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
gcgggtgcggccccggctttgccgaacctt	Protospacer
 ****.*.****************.  .* 

263. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

264. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

265. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

266. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

267. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.733

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac	Protospacer
*.*******.******* *******. .  

268. spacer 1.4|331966|30|NZ_CP012090|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
agcacgaagccgaagagaaagccgccgatg	Protospacer
   .**.********** ********* * 

269. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcaccctggacaccgcctgcggcgccggac	Protospacer
.*. ** ********** ********* . 

270. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccggcagcggcacgaaca	Protospacer
******.******** *******.* .  .

271. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga	Protospacer
.**     **************** ****.

272. spacer 1.13|332446|30|NZ_CP012090|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcg----gcgccgtgg	CRISPR spacer
agggccgggacaccgcccgcggccagcgct----	Protospacer
  *************** ***    ****.    

273. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

274. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

275. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

276. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

277. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

278. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cagacctcggtgaccacgccggcaacgatc	Protospacer
   ** .************** ******. 

279. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggttggccggtgaccactccgccagcgatg	Protospacer
. .  ************ ******.***.*

280. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc	Protospacer
.   ********.******.*********  

281. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

282. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

283. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

284. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

285. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

286. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

287. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc	Protospacer
.   **************** *.***** * 

288. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

289. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgc--gccttgcccgccgttgccgccggca	CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg	Protospacer
  ..**  **********  *********** .

290. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
attgccgccctggccgccgttgccgccgatc	Protospacer
* *  ****.** ***************.. 

291. spacer 7.3|1852769|30|NZ_CP012090|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

292. spacer 7.3|1852769|30|NZ_CP012090|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

293. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc	Protospacer
  . *  ***** **************** **

294. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc	Protospacer
. . *. *****.***** *************

295. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga	Protospacer
*.******** ******* ********.. *  

296. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac	Protospacer
*.. ******.***************.**.  *

297. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcaccac	Protospacer
*****.****.************* . *. * *

298. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcaccac	Protospacer
*****.****.************* . *. * *

299. spacer 13.8|3955267|36|NZ_CP012090|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.778

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
gcgctgatgcgccggcgacaccaaaggctccggcgg	Protospacer
  ** *  *.*******.****** ***********

300. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga	Protospacer
*.******** ******* ********.. *  

301. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac	Protospacer
*.. ******.***************.**.  *

302. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcaccac	Protospacer
*****.****.************* . *. * *

303. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcaccac	Protospacer
*****.****.************* . *. * *

304. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
gatcgccggcaccggcggcaccaccggccagcc	Protospacer
 * ******************** ****.    

305. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
gatcgccggcaccggcggcaccaccggccagcc	Protospacer
 * ******************** ****.    

306. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
acccgccggcaccggcggcgccaacggatcgaa	Protospacer
   ****************.******* ** ..

307. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.758

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
aggcggcggcaccggcggcaccaccggctggcg	Protospacer
 ..** ***************** *****   *

308. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 8, identity: 0.758

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cgaagcctgcaccggcggcacccacggcacaaa	Protospacer
*.* *** ************** ***** * ..

309. spacer 1.1|331828|30|NZ_CP012090|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 9, identity: 0.7

ccgggcgtggccccggctttgccggcgttg	CRISPR spacer
agaaagatggcgccggctttgccggctttg	Protospacer
  ... .**** ************** ***

310. spacer 1.14|332494|39|NZ_CP012090|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769

--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc	CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag	Protospacer
  ***. *.  **************** *** *******  

311. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

312. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

313. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

314. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

315. spacer 3.2|629647|30|NZ_CP012090|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cccacgccggtcaccacgccgctgcccggc	Protospacer
 ********** **********.. * .  

316. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

317. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

318. spacer 4.1|690354|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

319. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg	Protospacer
.... ****.***************** .*.

320. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
tggcccgccttgccctccattgccgccggac	Protospacer
 . . ********** **.**********  

321. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
atccttgccttgaccgccgttgccgccgctg	Protospacer
* .. .****** *************** ..

322. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accccagccctgcccgccgttgccgccgctc	Protospacer
* ..  ***.****************** . 

323. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc	Protospacer
. ******** ********* ****   .* 

324. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accggcaccttgcccgccattgccgccatgt	Protospacer
* . **.***********.********.   

325. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc	Protospacer
 .   *******.******* *******.* 

326. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
agcgtggccttggccgccgttgccggcggtc	Protospacer
*..   ****** ************ ***. 

327. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

328. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

329. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc	Protospacer
 ...*.  **.********.************

330. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

331. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc	Protospacer
... *. * ******* ** ************

332. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc	Protospacer
... *. * ******* ** ************

333. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc	Protospacer
 *  *  . ***.************** ****

334. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc	Protospacer
* .  .*  **********.*********.**

335. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc	Protospacer
.  . *.* *********** ****** ****

336. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc	Protospacer
. . *  * ***.***** *************

337. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg	Protospacer
*********** ******.******* *    .** 

338. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc	Protospacer
... *.************ *******.***. *

339. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca	Protospacer
*..  ****************** ** ***.. 

340. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

341. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

342. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

343. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

344. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

345. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg	Protospacer
*.**************** * *****. . *  

346. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg	Protospacer
*.**************** * *****. . *  

347. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

348. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

349. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

350. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt	Protospacer
 . *  ******** **.************ *.

351. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

352. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

353. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
catgaccggcaccggcagggctggcgacgagca	Protospacer
** .. **********.****.******** . 

354. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
catgaccggcaccggcagggctggcgacgagca	Protospacer
** .. **********.****.******** . 

355. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

356. spacer 13.11|3955495|36|NZ_CP012090|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75

ggccggcggtagcggcggggccaacttcaacggcgg	CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct	Protospacer
*********** ******* ******    **.*  

357. spacer 13.11|3955495|36|NZ_CP012090|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75

ggccggcggtagcggcggggccaacttcaacggcgg	CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct	Protospacer
*********** ******* ******    **.*  

358. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc	Protospacer
... *.************ *******.***. *

359. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca	Protospacer
*..  ****************** ** ***.. 

360. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

361. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

362. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

363. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

364. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

365. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg	Protospacer
*.**************** * *****. . *  

366. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg	Protospacer
*.**************** * *****. . *  

367. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

368. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

369. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

370. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt	Protospacer
 . *  ******** **.************ *.

371. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

372. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

373. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
catgaccggcaccggcagggctggcgacgagca	Protospacer
** .. **********.****.******** . 

374. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
catgaccggcaccggcagggctggcgacgagca	Protospacer
** .. **********.****.******** . 

375. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

376. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
gagcgccgccaccgacggcaccaacggcctgca	Protospacer
 *.***** *****.*************..  .

377. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NZ_CP041197 (Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
agccccctgcaccggcggaaccaacggctaagc	Protospacer
 . * ** ********** **********  * 

378. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to MK524502 (Microbacterium phage TimoTea, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
tgacaacggccccggcggcaccaccggctcata	Protospacer
..**. **** ************ ******  .

379. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NZ_CP042515 (Serratia marcescens strain E28 plasmid pE28_003) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
ctccttcggcttcggcggcaccaacggctcgct	Protospacer
*  * .**** .******************   

380. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to KT281796 (Mycobacterium phage Zakhe101, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

381. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

382. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to MN428058 (Mycobacterium phage Krili, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

383. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

384. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

385. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

386. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

387. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to MT818425 (Mycobacterium phage NiebruSaylor, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

388. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to NC_022325 (Mycobacterium phage Dylan, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

389. spacer 13.16|3955876|33|NZ_CP012090|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 9, identity: 0.727

caacgccggcaccggcggcaccaacggctccgg	CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg	Protospacer
*   *    ********* ****.*********

390. spacer 13.19|3956101|36|NZ_CP012090|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75

ggccggcggtagcggcggggccaacttcaacggcgg	CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct	Protospacer
*********** ******* ******    **.*  

391. spacer 13.19|3956101|36|NZ_CP012090|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75

ggccggcggtagcggcggggccaacttcaacggcgg	CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct	Protospacer
*********** ******* ******    **.*  

392. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

393. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

394. spacer 2.6|365152|33|NZ_CP012090|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

395. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

396. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg	Protospacer
  .. ****** *******.********  .

397. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggccagaacttccccgctgttgccgccggca	Protospacer
..... . *** *****.*************

398. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

399. spacer 5.10|1353523|31|NZ_CP012090|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc	Protospacer
...   ****** ************ ***. 

400. spacer 5.13|1353772|34|NZ_CP012090|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca	Protospacer
 . .. .*******.***************.**.

401. spacer 9.9|2894486|35|NZ_CP012090|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

402. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta	Protospacer
    *  *****.****** **********  

403. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat	Protospacer
.* ..  ***********  **********..

404. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga	Protospacer
*. .   .** **.***************** 

405. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc	Protospacer
 .     * *********** *** *******

406. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg	Protospacer
 . *************** * **********..   

407. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg	Protospacer
 * . *********** ** *********  . 

408. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca	Protospacer
 . *******.******.********* *. . 

409. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg	Protospacer
 * . *********** ** *********  . 

410. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca	Protospacer
 . *******.******.********* *. . 

411. spacer 11.6|3743706|32|NZ_CP012090|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt	Protospacer
. .  .  **********  ***********.

412. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
*. .********************.** **    ..

413. spacer 13.3|3954877|36|NZ_CP012090|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
*. .********************.** **    ..

414. spacer 13.5|3955030|33|NZ_CP012090|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg	Protospacer
    *** ********** ********* .   

415. spacer 13.13|3955639|33|NZ_CP012090|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg	Protospacer
    *** ********** ********* .   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2715611 : 2753883 46 Mycobacterium_phage(33.33%) head,tRNA,integrase,capsid,terminase,protease attL 2744412:2744439|attR 2754036:2754063
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage