Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015379 Pseudomonas brassicacearum subsp. brassicacearum NFM421, complete sequence 7 crisprs DEDDh,WYL,DinG,csa3,cas3 1 0 6 0

Results visualization

1. NC_015379
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015379_1 646703-646798 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015379_2 1380565-1380659 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015379_3 3632773-3632868 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015379_4 3965292-3965386 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015379_5 4386763-4386859 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015379_6 6380058-6380194 TypeI-A NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015379_7 6493352-6493450 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_015379_5 5.1|4386787|49|NC_015379|CRISPRCasFinder 4386787-4386835 49 NC_015379.1 5481597-5481645 2 0.959
NC_015379_5 5.1|4386787|49|NC_015379|CRISPRCasFinder 4386787-4386835 49 NC_015379.1 5481743-5481791 2 0.959
NC_015379_5 5.1|4386787|49|NC_015379|CRISPRCasFinder 4386787-4386835 49 NC_015379.1 5615117-5615165 2 0.959

1. spacer 5.1|4386787|49|NC_015379|CRISPRCasFinder matches to position: 5481597-5481645, mismatch: 2, identity: 0.959

gagcaagctttgctcccacagatctgacaggtgtatgaccaggagaacc	CRISPR spacer
gagcaagctttgctcccacagatctgacaggtgtacgaccaggagagcc	Protospacer
***********************************.**********.**

2. spacer 5.1|4386787|49|NC_015379|CRISPRCasFinder matches to position: 5481743-5481791, mismatch: 2, identity: 0.959

gagcaagctttgctcccacagatctgacaggtgtatgaccaggagaacc	CRISPR spacer
gagcaagctttgctcccacagatctgacaggtgtacgaccaggagagcc	Protospacer
***********************************.**********.**

3. spacer 5.1|4386787|49|NC_015379|CRISPRCasFinder matches to position: 5615117-5615165, mismatch: 2, identity: 0.959

gagcaagctttgctcccacagatctgacaggtgtatgaccaggagaacc	CRISPR spacer
gagcaagctttgctcccacagatctgacaggtgtacgaccaggagagcc	Protospacer
***********************************.**********.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1326671 : 1404521 77 Pseudomonas_phage(65.22%) plate,lysis,tail,bacteriocin,tRNA,protease,holin NA
DBSCAN-SWA_2 4044079 : 4106623 54 uncultured_Caudovirales_phage(10.0%) plate,tRNA,transposase,protease NA
DBSCAN-SWA_3 4364831 : 4371097 8 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_4 4654180 : 4692831 55 uncultured_Caudovirales_phage(50.0%) lysis,tail,capsid NA
DBSCAN-SWA_5 6304361 : 6360199 47 Burkholderia_phage(28.57%) protease,holin NA
DBSCAN-SWA_6 6705903 : 6786724 57 uncultured_Caudovirales_phage(22.22%) plate,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage