Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017450 Francisella cf. novicida Fx1, complete genome 2 crisprs RT,cas3,csa3,cas9,DEDDh,cas2,cas1,cas4,cas12a 0 2 4 0

Results visualization

1. NC_017450
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017450_1 787360-787745 TypeII NA
5 spacers
cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017450_2 1468174-1468596 TypeV-A,TypeI-A V-A
6 spacers
csa3,cas2,cas1,cas4,cas12a

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017450_2 2.6|1468533|28|NC_017450|CRISPRCasFinder,CRT,PILER-CR 1468533-1468560 28 MG945522 UNVERIFIED: Microviridae sp. isolate 2039-1602, complete genome 4801-4828 6 0.786
NC_017450_2 2.5|1468469|28|NC_017450|CRISPRCasFinder,CRT,PILER-CR 1468469-1468496 28 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 867162-867189 8 0.714

1. spacer 2.6|1468533|28|NC_017450|CRISPRCasFinder,CRT,PILER-CR matches to MG945522 (UNVERIFIED: Microviridae sp. isolate 2039-1602, complete genome) position: , mismatch: 6, identity: 0.786

tttggagtggttattatgaagagatggc	CRISPR spacer
ttgaaggtggttattatgaagagatgat	Protospacer
** ...********************..

2. spacer 2.5|1468469|28|NC_017450|CRISPRCasFinder,CRT,PILER-CR matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 8, identity: 0.714

ttggaagaatatgccagtccatatgtta	CRISPR spacer
actgaagaatttgccagtccatatcaag	Protospacer
 . ******* *************   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 95863 : 105322 9 Staphylococcus_phage(42.86%) tRNA NA
DBSCAN-SWA_2 385947 : 395446 9 Enterococcus_phage(16.67%) NA NA
DBSCAN-SWA_3 1031627 : 1039947 8 Alteromonas_phage(16.67%) NA NA
DBSCAN-SWA_4 1051054 : 1114628 60 Tupanvirus(18.18%) protease,tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage