Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017449 Francisella hispaniensis, complete sequence 2 crisprs cas3,csa3,DEDDh,cas4,cas2,cas9 0 4 4 0

Results visualization

1. NC_017449
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017449_1 1125563-1125754 TypeII NA
2 spacers
cas4,cas2,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017449_2 1125862-1127188 TypeII NA
18 spacers
cas4,cas2,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017449_2 2.6|1126257|34|NC_017449|CRISPRCasFinder,CRT 1126257-1126290 34 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 2111623-2111656 7 0.794
NC_017449_2 2.6|1126257|34|NC_017449|CRISPRCasFinder,CRT 1126257-1126290 34 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1040479-1040512 7 0.794
NC_017449_2 2.4|1126113|35|NC_017449|CRISPRCasFinder,CRT 1126113-1126147 35 MN694533 Marine virus AFVG_250M233, complete genome 18803-18837 8 0.771
NC_017449_2 2.18|1127116|36|NC_017449|CRISPRCasFinder,CRT 1127116-1127151 36 KT588073 Acinetobacter phage Ab105-3phi, partial genome 49791-49826 9 0.75
NC_017449_2 2.14|1126832|34|NC_017449|CRISPRCasFinder,CRT 1126832-1126865 34 CP048748 Buchnera aphidicola (Microlophium carnosum) isolate MCAR-56B plasmid pLeu, complete sequence 3194-3227 10 0.706
NC_017449_2 2.14|1126832|34|NC_017449|CRISPRCasFinder,CRT 1126832-1126865 34 KC954775 UNVERIFIED: Cronobacter phage S13, complete genome 170176-170209 11 0.676
NC_017449_2 2.14|1126832|34|NC_017449|CRISPRCasFinder,CRT 1126832-1126865 34 NC_028773 Cronobacter phage S13, complete genome 170176-170209 11 0.676

1. spacer 2.6|1126257|34|NC_017449|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.794

ctggtggaggcggtcaaactggcg-gcgagggtga	CRISPR spacer
ctggtcgaggcggtcaacctggcgctcgcgcatg-	Protospacer
***** *********** ******  ** * .** 

2. spacer 2.6|1126257|34|NC_017449|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ctggtggaggcggtcaaactggcg-gcgagggtga	CRISPR spacer
ctggtcgaggcggtcaacctggcgctcgcgcatg-	Protospacer
***** *********** ******  ** * .** 

3. spacer 2.4|1126113|35|NC_017449|CRISPRCasFinder,CRT matches to MN694533 (Marine virus AFVG_250M233, complete genome) position: , mismatch: 8, identity: 0.771

aataagcatttcaagatattttatttaatttttat	CRISPR spacer
cattacattatcaagatcttttattttatttttat	Protospacer
 ** *   * ******* ******** ********

4. spacer 2.18|1127116|36|NC_017449|CRISPRCasFinder,CRT matches to KT588073 (Acinetobacter phage Ab105-3phi, partial genome) position: , mismatch: 9, identity: 0.75

tgttactggttttgctgaaggtggttatactggcaa	CRISPR spacer
agatcaaggttttgctgaaggtggttatacaggtcg	Protospacer
 * *   *********************** **. .

5. spacer 2.14|1126832|34|NC_017449|CRISPRCasFinder,CRT matches to CP048748 (Buchnera aphidicola (Microlophium carnosum) isolate MCAR-56B plasmid pLeu, complete sequence) position: , mismatch: 10, identity: 0.706

tgccatacgatacagcatatatttcttttttaat	CRISPR spacer
ttgtatacgattcagtatatatttctttaccaca	Protospacer
*  .******* ***.************ ..*  

6. spacer 2.14|1126832|34|NC_017449|CRISPRCasFinder,CRT matches to KC954775 (UNVERIFIED: Cronobacter phage S13, complete genome) position: , mismatch: 11, identity: 0.676

tgccatacgatacagcatatatttcttttttaat	CRISPR spacer
aatcatacgattcaacatatatttctttgcagga	Protospacer
 ..******** **.************* . .. 

7. spacer 2.14|1126832|34|NC_017449|CRISPRCasFinder,CRT matches to NC_028773 (Cronobacter phage S13, complete genome) position: , mismatch: 11, identity: 0.676

tgccatacgatacagcatatatttcttttttaat	CRISPR spacer
aatcatacgattcaacatatatttctttgcagga	Protospacer
 ..******** **.************* . .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 91039 : 100972 10 Staphylococcus_phage(42.86%) tRNA NA
DBSCAN-SWA_2 366747 : 375816 8 Enterococcus_phage(16.67%) NA NA
DBSCAN-SWA_3 1007379 : 1045870 55 Escherichia_phage(15.79%) plate,tail,terminase,tRNA,capsid,integrase,portal attL 1024450:1024465|attR 1048331:1048346
DBSCAN-SWA_4 1095348 : 1104423 8 Alteromonas_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage