Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_002927 Bordetella bronchiseptica RB50, complete genome 8 crisprs csa3,DEDDh,DinG,cas3 1 0 5 0

Results visualization

1. NC_002927
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002927_1 1022323-1022407 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002927_2 3185377-3185535 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002927_3 3424460-3424556 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002927_4 3565033-3565162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002927_5 4234585-4234688 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002927_6 4536519-4536612 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002927_7 4815181-4815264 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002927_8 4898284-4898364 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_002927_4 4.1|3565079|38|NC_002927|CRISPRCasFinder 3565079-3565116 38 NC_002927.3 1460873-1460910 0 1.0

1. spacer 4.1|3565079|38|NC_002927|CRISPRCasFinder matches to position: 1460873-1460910, mismatch: 0, identity: 1.0

ggtcgcgcccccacgctgcgcccgctgtgcgggcttgc	CRISPR spacer
ggtcgcgcccccacgctgcgcccgctgtgcgggcttgc	Protospacer
**************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1757721 : 1803804 56 Burkholderia_phage(19.23%) protease,integrase,portal,terminase,head,capsid,tail attL 1765713:1765732|attR 1805399:1805418
DBSCAN-SWA_2 2336591 : 2371113 49 Pseudomonas_phage(16.13%) terminase,integrase,tail attL 2335700:2335715|attR 2345581:2345596
DBSCAN-SWA_3 3222452 : 3230512 9 uncultured_Mediterranean_phage(28.57%) tRNA NA
DBSCAN-SWA_4 3728652 : 3750883 29 Pseudomonas_phage(18.18%) terminase,tail NA
DBSCAN-SWA_5 3829666 : 3869378 50 Pseudomonas_phage(29.41%) tRNA,transposase,integrase,plate,capsid,tail attL 3820223:3820241|attR 3875237:3875255
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage