Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_005296 Rhodopseudomonas palustris CGA009, complete genome 2 crisprs csa3,WYL 0 1 2 0
NC_005297 Rhodopseudomonas palustris CGA009 plasmid pRPA, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_005296
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_005296_1 2487767-2487845 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_005296_2 4073755-4073853 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_005296_1 1.1|2487791|31|NC_005296|CRISPRCasFinder 2487791-2487821 31 NZ_CP045855 Agrobacterium sp. MA01 plasmid punnamed1, complete sequence 50267-50297 8 0.742

1. spacer 1.1|2487791|31|NC_005296|CRISPRCasFinder matches to NZ_CP045855 (Agrobacterium sp. MA01 plasmid punnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tcttgcacgcaaagccggatcgtgggattaa	CRISPR spacer
gaccacaagcaaagccggatcgagggattac	Protospacer
  ...** ************** ******* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2118612 : 2131987 14 Geobacillus_phage(25.0%) tail,capsid,head,portal,protease NA
DBSCAN-SWA_2 3219530 : 3226156 8 uncultured_Mediterranean_phage(83.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage