Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_003210 Listeria monocytogenes EGD-e chromosome, complete genome 5 crisprs DinG,cas3,WYL,casR,csa3,DEDDh 0 2 5 0

Results visualization

1. NC_003210
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003210_1 210313-210464 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003210_2 498828-499412 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003210_3 544375-544663 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003210_4 1136613-1136692 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003210_5 2779697-2779807 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_003210_3 3.3|544534|35|NC_003210|PILER-CR,CRISPRCasFinder,CRT 544534-544568 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NC_003210_3 3.3|544534|35|NC_003210|PILER-CR,CRISPRCasFinder,CRT 544534-544568 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
NC_003210_4 4.1|1136638|30|NC_003210|CRISPRCasFinder 1136638-1136667 30 LC492751 Staphylococcus phage KSAP7 genomic DNA, compelete genome 2378-2407 7 0.767
NC_003210_4 4.1|1136638|30|NC_003210|CRISPRCasFinder 1136638-1136667 30 LC492752 Staphylococcus phage KSAP11 genomic DNA, compelete genome 2378-2407 7 0.767

1. spacer 3.3|544534|35|NC_003210|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 3.3|544534|35|NC_003210|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

3. spacer 4.1|1136638|30|NC_003210|CRISPRCasFinder matches to LC492751 (Staphylococcus phage KSAP7 genomic DNA, compelete genome) position: , mismatch: 7, identity: 0.767

tttacaaatacataatatcagattatataa	CRISPR spacer
cttacaaatacattatatcatattcttttt	Protospacer
.************ ****** *** * *  

4. spacer 4.1|1136638|30|NC_003210|CRISPRCasFinder matches to LC492752 (Staphylococcus phage KSAP11 genomic DNA, compelete genome) position: , mismatch: 7, identity: 0.767

tttacaaatacataatatcagattatataa	CRISPR spacer
cttacaaatacattatatcatattcttttt	Protospacer
.************ ****** *** * *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120653 : 127178 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1124078 : 1149720 27 Streptococcus_phage(66.67%) integrase attL 1129850:1129865|attR 1153642:1153657
DBSCAN-SWA_3 1838050 : 1846336 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 2360907 : 2403235 66 Listeria_phage(96.61%) coat,integrase,terminase,holin,tail,portal attL 2357501:2357516|attR 2411019:2411034
DBSCAN-SWA_5 2546529 : 2554373 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage