Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_006958 Corynebacterium glutamicum ATCC 13032, complete genome 3 crisprs DEDDh,csa3,cas3,cas9,WYL,PrimPol,DinG 0 2 0 0

Results visualization

1. NC_006958
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006958_1 311659-311754 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006958_2 2066245-2066454 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006958_3 2897014-2897112 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_006958_2 2.3|2066401|27|NC_006958|CRISPRCasFinder 2066401-2066427 27 MF668280 Mycobacterium phage Phabba, complete genome 18926-18952 5 0.815
NC_006958_2 2.1|2066272|33|NC_006958|CRISPRCasFinder 2066272-2066304 33 MT330372 Cronobacter phage JC01, complete genome 60750-60782 7 0.788

1. spacer 2.3|2066401|27|NC_006958|CRISPRCasFinder matches to MF668280 (Mycobacterium phage Phabba, complete genome) position: , mismatch: 5, identity: 0.815

cggctgctgcaggctttgcctgaacgc	CRISPR spacer
ctcgtactgcaggctttgcatgaacgc	Protospacer
*   *.************* *******

2. spacer 2.1|2066272|33|NC_006958|CRISPRCasFinder matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 7, identity: 0.788

tagctgcatcgcctggagttgggccagaaaatg	CRISPR spacer
cgcccgcatcgcctggagccgggccagaaaatc	Protospacer
.. *.*************..************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage