Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007614 Nitrosospira multiformis ATCC 25196, complete sequence 2 crisprs RT,DinG,DEDDh,csa3 0 0 3 0
NC_007617 Nitrosospira multiformis ATCC 25196 plasmid 3, complete sequence 0 crisprs NA 0 0 0 0
NC_007615 Nitrosospira multiformis ATCC 25196 plasmid 1, complete sequence 1 crisprs NA 0 2 0 0
NC_007616 Nitrosospira multiformis ATCC 25196 plasmid 2, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NC_007615
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007615_1 121-270 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007615_1 1.1|144|52|NC_007615|PILER-CR 144-195 52 NC_007615 Nitrosospira multiformis ATCC 25196 plasmid 1, complete sequence 144-195 0 1.0
NC_007615_1 1.2|219|29|NC_007615|PILER-CR 219-247 29 NC_007615 Nitrosospira multiformis ATCC 25196 plasmid 1, complete sequence 219-247 0 1.0

1. spacer 1.1|144|52|NC_007615|PILER-CR matches to NC_007615 (Nitrosospira multiformis ATCC 25196 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

catgtccgaggtttggctcccaattcactttttaatgtggataaaacaggtt	CRISPR spacer
catgtccgaggtttggctcccaattcactttttaatgtggataaaacaggtt	Protospacer
****************************************************

2. spacer 1.2|219|29|NC_007615|PILER-CR matches to NC_007615 (Nitrosospira multiformis ATCC 25196 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

attcaactcttcacaggtagtttttacct	CRISPR spacer
attcaactcttcacaggtagtttttacct	Protospacer
*****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_007614
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007614_1 730127-730236 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007614_2 1576924-1577023 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50135 : 62150 9 Dickeya_phage(16.67%) transposase NA
DBSCAN-SWA_2 1873694 : 1933195 52 Paenibacillus_phage(50.0%) protease,transposase NA
DBSCAN-SWA_3 2310762 : 2324595 15 Paenibacillus_phage(33.33%) transposase,integrase attL 2322277:2322298|attR 2332855:2332876
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_007616
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 10275 10 Escherichia_phage(40.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage