Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014251 Streptococcus pneumoniae TCH8431/19A, complete sequence 3 crisprs DEDDh,cas3,DinG 0 1 14 0

Results visualization

1. NC_014251
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014251_1 1279965-1280068 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014251_2 1632601-1632733 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014251_3 1858578-1858662 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014251_1 1.1|1279998|38|NC_014251|CRISPRCasFinder 1279998-1280035 38 KY065475 Streptococcus phage IPP35, complete genome 23044-23081 4 0.895
NC_014251_1 1.1|1279998|38|NC_014251|CRISPRCasFinder 1279998-1280035 38 MK448453 Streptococcus satellite phage Javan360, complete genome 13985-14022 5 0.868

1. spacer 1.1|1279998|38|NC_014251|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 4, identity: 0.895

agatattatggagcctattttattgtagaaaaaaaggg	CRISPR spacer
agatattatggagcctatttttgtgtagaaaaaaagtc	Protospacer
*********************  *************  

2. spacer 1.1|1279998|38|NC_014251|CRISPRCasFinder matches to MK448453 (Streptococcus satellite phage Javan360, complete genome) position: , mismatch: 5, identity: 0.868

agatattatggagcctattttattgtagaaaaaaaggg	CRISPR spacer
gaatattatggagcctattttgttgtagaaaaaaagtc	Protospacer
..*******************.**************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 224105 : 232859 9 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 258772 : 267373 10 Streptococcus_phage(57.14%) integrase attL 259003:259017|attR 273845:273859
DBSCAN-SWA_3 304488 : 315799 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 357160 : 398595 42 Streptococcus_phage(40.0%) bacteriocin,transposase,tRNA NA
DBSCAN-SWA_5 443233 : 451059 13 Streptococcus_phage(75.0%) NA NA
DBSCAN-SWA_6 574254 : 628873 47 Streptococcus_phage(23.08%) transposase,integrase,holin,protease attL 577102:577115|attR 630255:630268
DBSCAN-SWA_7 700432 : 763326 55 Klosneuvirus(18.18%) bacteriocin,transposase,tRNA,protease NA
DBSCAN-SWA_8 993637 : 1000643 10 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_9 1114336 : 1177410 57 Indivirus(15.79%) transposase,holin,protease NA
DBSCAN-SWA_10 1422020 : 1475335 45 Streptococcus_phage(44.44%) holin,protease,tRNA,bacteriocin,transposase,integrase attL 1473824:1473883|attR 1476229:1476771
DBSCAN-SWA_11 1537658 : 1601740 59 Streptococcus_phage(20.0%) transposase,tRNA,protease NA
DBSCAN-SWA_12 1656627 : 1663386 9 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_13 1916453 : 1923868 10 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_14 2005333 : 2034754 33 Streptococcus_phage(89.29%) bacteriocin,transposase,integrase attL 1997034:1997049|attR 2037298:2037313
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage