Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014659 Rhodococcus hoagii 103S, complete genome 2 crisprs csa3,cas3,WYL,DinG,cas4,DEDDh 0 1 1 0

Results visualization

1. NC_014659
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014659_1 4288373-4288454 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014659_2 4376554-4376741 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014659_1 1.1|4288398|32|NC_014659|CRISPRCasFinder 4288398-4288429 32 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 27805-27836 8 0.75
NC_014659_1 1.1|4288398|32|NC_014659|CRISPRCasFinder 4288398-4288429 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 188621-188652 8 0.75
NC_014659_1 1.1|4288398|32|NC_014659|CRISPRCasFinder 4288398-4288429 32 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 38504-38535 8 0.75

1. spacer 1.1|4288398|32|NC_014659|CRISPRCasFinder matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 8, identity: 0.75

ctcgccaaggctcccggcgcgaaggcaccggg	CRISPR spacer
gccgccaaggcacccggcgcgaaggctgcacc	Protospacer
 .********* **************  *.  

2. spacer 1.1|4288398|32|NC_014659|CRISPRCasFinder matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccaaggctcccggcgcgaaggcaccggg	CRISPR spacer
gtcgccaagactcccggtgcgaaggtgatcgg	Protospacer
 ********.*******.*******.. . **

3. spacer 1.1|4288398|32|NC_014659|CRISPRCasFinder matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccaaggctcccggcgcgaagg--caccggg	CRISPR spacer
aacgccaaggctcttggcgcgaagggtggccg--	Protospacer
  ***********..**********   .***  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5031655 : 5039056 8 Planktothrix_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage