Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014810 Helicobacter felis ATCC 49179, complete genome 2 crisprs c2c9_V-U4,cas14j,cas3 1 0 5 1

Results visualization

1. NC_014810
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014810_1 21958-22044 TypeV NA
1 spacers
c2c9_V-U4,cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014810_2 1593567-1593837 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_014810_2 2.1|1593626|52|NC_014810|PILER-CR 1593626-1593677 52 NC_014810.2 1569109-1569160 0 1.0
NC_014810_2 2.1|1593626|52|NC_014810|PILER-CR 1593626-1593677 52 NC_014810.2 1569217-1569268 1 0.981

1. spacer 2.1|1593626|52|NC_014810|PILER-CR matches to position: 1569109-1569160, mismatch: 0, identity: 1.0

ggcacaccttggccatttttgtacatgaaagccaagctattatatgcccgca	CRISPR spacer
ggcacaccttggccatttttgtacatgaaagccaagctattatatgcccgca	Protospacer
****************************************************

2. spacer 2.1|1593626|52|NC_014810|PILER-CR matches to position: 1569217-1569268, mismatch: 1, identity: 0.981

ggcacaccttggccatttttgtacatgaaagccaagctattatatgcccgca	CRISPR spacer
ggcacaccttgcccatttttgtacatgaaagccaagctattatatgcccgca	Protospacer
*********** ****************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3815 : 33757 39 Helicobacter_phage(50.0%) terminase,head,holin,integrase,transposase attL 3712:3771|attR 35385:35487
DBSCAN-SWA_2 159692 : 165620 6 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_3 627062 : 633990 7 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_4 1020487 : 1036233 15 Helicobacter_phage(72.73%) transposase,holin NA
DBSCAN-SWA_5 1562010 : 1571777 9 Helicobacter_phage(66.67%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_014810.2|WP_013470042.1|1569077_1569695_-|sel1-repeat-family-protein 1569077_1569695_- 205 aa aa NA NA NA 1562010-1571777 yes