Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018588 Listeria monocytogenes SLCC2372, complete genome 4 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 0 1 6 0
NC_018889 Listeria monocytogenes SLCC2372 plasmid pLM1-2cUG1, complete sequence 0 crisprs csa3,cas5 0 0 1 0

Results visualization

1. NC_018588
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018588_1 210264-210415 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018588_2 497544-498128 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018588_3 543092-543380 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018588_4 2807979-2808089 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018588_3 3.3|543251|35|NC_018588|PILER-CR,CRISPRCasFinder,CRT 543251-543285 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NC_018588_3 3.3|543251|35|NC_018588|PILER-CR,CRISPRCasFinder,CRT 543251-543285 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943

1. spacer 3.3|543251|35|NC_018588|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 3.3|543251|35|NC_018588|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120653 : 127178 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1122798 : 1130221 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_3 1244271 : 1324817 102 Listeria_phage(76.67%) portal,holin,protease,tRNA,integrase,terminase,tail,capsid attL 1244155:1244171|attR 1287114:1287130
DBSCAN-SWA_4 1858442 : 1866728 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2381576 : 2419895 57 Listeria_phage(89.58%) tail,terminase,holin NA
DBSCAN-SWA_6 2564055 : 2571899 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_018889
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 23685 : 32530 10 Streptococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage