Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017375 Helicobacter pylori 83, complete genome 2 crisprs cas14j,cas2,DEDDh 0 1 0 0

Results visualization

1. NC_017375
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017375_1 900340-900436 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017375_2 970769-970971 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017375_2 2.2|970855|31|NC_017375|CRT 970855-970885 31 NZ_CP045274 Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence 87744-87774 8 0.742
NC_017375_2 2.2|970855|31|NC_017375|CRT 970855-970885 31 NZ_CP032533 Bacillus megaterium NCT-2 plasmid pNCT2_5, complete sequence 27066-27096 8 0.742
NC_017375_2 2.2|970855|31|NC_017375|CRT 970855-970885 31 NZ_CP009921 Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid pBMV_2, complete sequence 185365-185395 8 0.742
NC_017375_2 2.2|970855|31|NC_017375|CRT 970855-970885 31 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 752262-752292 8 0.742
NC_017375_2 2.2|970855|31|NC_017375|CRT 970855-970885 31 NZ_CP035095 Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid unnamed1, complete sequence 291581-291611 8 0.742
NC_017375_2 2.2|970855|31|NC_017375|CRT 970855-970885 31 NC_028671 Enterococcus phage vB_EfaS_IME197, complete genome 17497-17527 9 0.71

1. spacer 2.2|970855|31|NC_017375|CRT matches to NZ_CP045274 (Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence) position: , mismatch: 8, identity: 0.742

atagcgctcaatctgtttttgaaaacagcaa	CRISPR spacer
cttttgaccaatctgtttttgaaaactgtaa	Protospacer
 *  .* .****************** *.**

2. spacer 2.2|970855|31|NC_017375|CRT matches to NZ_CP032533 (Bacillus megaterium NCT-2 plasmid pNCT2_5, complete sequence) position: , mismatch: 8, identity: 0.742

atagcgctcaatctgtttttgaaaacagcaa	CRISPR spacer
cttttgaccaatctgtttttgaaaactgtaa	Protospacer
 *  .* .****************** *.**

3. spacer 2.2|970855|31|NC_017375|CRT matches to NZ_CP009921 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid pBMV_2, complete sequence) position: , mismatch: 8, identity: 0.742

atagcgctcaatctgtttttgaaaacagcaa	CRISPR spacer
cttttgaccaatctgtttttgaaaactgtaa	Protospacer
 *  .* .****************** *.**

4. spacer 2.2|970855|31|NC_017375|CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 8, identity: 0.742

----atagcgctcaatctgtttttgaaaacagcaa	CRISPR spacer
gatcaagg----caatctccttttgaaaacagcaa	Protospacer
    * .*    ****** .***************

5. spacer 2.2|970855|31|NC_017375|CRT matches to NZ_CP035095 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

atagcgctcaatctgtttttgaaaacagcaa	CRISPR spacer
cttttgaccaatctgtttttgaaaactgtaa	Protospacer
 *  .* .****************** *.**

6. spacer 2.2|970855|31|NC_017375|CRT matches to NC_028671 (Enterococcus phage vB_EfaS_IME197, complete genome) position: , mismatch: 9, identity: 0.71

atagcgctcaatctgtttttgaaaacagcaa	CRISPR spacer
ttgatgctcaatctgttttagaaaaaagtgg	Protospacer
 *...************** ***** **...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage