Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015558 Streptococcus parauberis KCTC 11537, complete genome 1 crisprs cas3,DinG,csm6,csa3,DEDDh 0 1 8 0

Results visualization

1. NC_015558
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015558_1 1826608-1826693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015558_1 1.1|1826631|40|NC_015558|CRISPRCasFinder 1826631-1826670 40 MK448925 Streptococcus phage Javan386, complete genome 8408-8447 0 1.0
NC_015558_1 1.1|1826631|40|NC_015558|CRISPRCasFinder 1826631-1826670 40 MK448927 Streptococcus phage Javan394, complete genome 9549-9588 0 1.0

1. spacer 1.1|1826631|40|NC_015558|CRISPRCasFinder matches to MK448925 (Streptococcus phage Javan386, complete genome) position: , mismatch: 0, identity: 1.0

ttgataattattttgaggttgttggttattattctgaggc	CRISPR spacer
ttgataattattttgaggttgttggttattattctgaggc	Protospacer
****************************************

2. spacer 1.1|1826631|40|NC_015558|CRISPRCasFinder matches to MK448927 (Streptococcus phage Javan394, complete genome) position: , mismatch: 0, identity: 1.0

ttgataattattttgaggttgttggttattattctgaggc	CRISPR spacer
ttgataattattttgaggttgttggttattattctgaggc	Protospacer
****************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 582942 : 590391 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 594813 : 603706 11 uncultured_Caudovirales_phage(16.67%) protease NA
DBSCAN-SWA_3 882545 : 927900 52 Streptococcus_phage(81.4%) head,integrase,tail,capsid,portal,terminase,protease attL 885119:885139|attR 927942:927962
DBSCAN-SWA_4 956566 : 964464 8 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 1368014 : 1452779 114 Streptococcus_phage(48.28%) integrase,tail,holin,portal,terminase attL 1362849:1362866|attR 1455848:1455865
DBSCAN-SWA_6 1455916 : 1466855 14 Streptococcus_phage(81.82%) NA NA
DBSCAN-SWA_7 1482066 : 1494482 16 Streptococcus_phage(50.0%) integrase attL 1482374:1482388|attR 1498967:1498981
DBSCAN-SWA_8 1745094 : 1832573 88 Streptococcus_phage(72.09%) tRNA,tail,holin,capsid,portal,terminase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage