1. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.923
gtctacctggtggccggcggcaccgg CRISPR spacer
gtctacctggtggtcggcggcgccgg Protospacer
*************.*******.****
2. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
3. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
4. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
5. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
6. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
7. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
8. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
9. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
10. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
11. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
12. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
13. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
14. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
15. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
16. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
17. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
18. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
19. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
20. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
21. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
22. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
23. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
24. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
25. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
26. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
27. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
28. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
29. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
30. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
31. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
32. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
33. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
34. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
35. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
36. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
37. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
38. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
39. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
40. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
41. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
42. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
43. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
44. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
45. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
46. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
47. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
48. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
49. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
50. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
51. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
52. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
53. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
54. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
55. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
56. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctggcggccggcggcagcgg Protospacer
*.********.*********** ***
57. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
58. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.885
gtctacctggtggccggcggcaccgg CRISPR spacer
gcctacctgcaggccggcggcaccgg Protospacer
*.******* ***************
59. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gtctacctggtgaccggcggccttgg Protospacer
************.******** ..**
60. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
61. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
acctacctggtcaccggcggcaccgg Protospacer
..********* .*************
62. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
63. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gtctatctggtgggcggcggcaccca Protospacer
*****.******* ********** .
64. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gtctatctggtgggcggcggcaccca Protospacer
*****.******* ********** .
65. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
66. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gtctatctggtgggcggcggcaccca Protospacer
*****.******* ********** .
67. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
acctacctggtcaccggcggcaccgg Protospacer
..********* .*************
68. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gtctatctggtgggcggcggcaccca Protospacer
*****.******* ********** .
69. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
70. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
71. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gtctacctggtgaccggcggccttgg Protospacer
************.******** ..**
72. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
73. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
74. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
75. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gtctatctggtgggcggcggcaccca Protospacer
*****.******* ********** .
76. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
77. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
78. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
79. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
80. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
81. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcttacctgcaggccggcggcaccgg Protospacer
*..****** ***************
82. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
gcgttcctggtggcgggcggcaccgg Protospacer
*. * ********* ***********
83. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP039426 (Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
ggctacctggtggtccgcggcaccgc Protospacer
* ***********.* *********
84. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP039431 (Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
gtctacctggtggccggcggcaccgg CRISPR spacer
ggctacctggtggtccgcggcaccgc Protospacer
* ***********.* *********
85. spacer 1.68|3703902|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 5, identity: 0.857
atcaccggctcgggcagcgcgcccgcaagctcggt- CRISPR spacer
gtcaccggctcgggccgcgcgcccg-aaacccggtt Protospacer
.************** ********* **.*.****
86. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 5, identity: 0.808
gtctacctggtggccggcggcaccgg CRISPR spacer
ccctacctgctgcccggcggcaccgc Protospacer
.******* ** ************
87. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 5, identity: 0.808
gtctacctggtggccggcggcaccgg CRISPR spacer
accgccctggtgaccggcggcaccgg Protospacer
..* *******.*************
88. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.808
gtctacctggtggccggcggcaccgg CRISPR spacer
tcctacctggaggccggcggcatcgc Protospacer
.******** ***********.**
89. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 5, identity: 0.808
gtctacctggtggccggcggcaccgg CRISPR spacer
ccgtaccgggcggccggcggcaccgg Protospacer
. **** **.***************
90. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
gtctacctggtggccggcggcaccgg CRISPR spacer
accgtcctggtgaccggcggcaccgg Protospacer
..* *******.*************
91. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
gtctacctggtggccggcggcaccgg CRISPR spacer
accgtcctggtgaccggcggcaccgg Protospacer
..* *******.*************
92. spacer 1.6|3699754|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 6, identity: 0.818
ttgtaccccccgggcaccagcacgccgatcggg CRISPR spacer
ttcctccccccgggcagcaacacgccgatcgtg Protospacer
** . *********** **.*********** *
93. spacer 1.6|3699754|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 6, identity: 0.818
ttgtaccccccgggcaccagcacgccgatcggg CRISPR spacer
ttcctccccccgggcagcaacacgccgatcgtg Protospacer
** . *********** **.*********** *
94. spacer 1.45|3702364|36|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.833
accggcaacgtgcgcgtgccggacgtcacgcctggc- CRISPR spacer
acgggcagcgtgcgcgtgccggacgt-gcgcctgtgg Protospacer
** ****.****************** .******
95. spacer 1.45|3702364|36|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.833
accggcaacgtgcgcgtgccggacgtcacgcctggc- CRISPR spacer
acgggcaccgtgcgcgtgccggacgt-gcgcctgtgg Protospacer
** **** ****************** .******
96. spacer 1.54|3702962|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.829
acgctgcgct--atccggccgaccgcgccgcgatggc CRISPR spacer
--catgggctggatccggccgaccgcgccgccatggc Protospacer
** *** ******************* *****
97. spacer 1.71|3704102|26|NC_015677|PILER-CR matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 6, identity: 0.769
gtctacctggtggccggcggcaccgg CRISPR spacer
gctctgctggtggccggcggcaccgt Protospacer
*... *******************
98. spacer 1.14|3700284|36|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 7, identity: 0.806
tccagctcgtcgcggacgtcgtcagccaggcccccg CRISPR spacer
tccgcccggccgcggacgtcgtcggccaggccctcg Protospacer
***. *. *.*************.*********.**
99. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_023498 (Mycobacterium phage Validus, complete genome) position: , mismatch: 7, identity: 0.794
--cgccggctgcgccctggccagctgcgcggcctgc CRISPR spacer
atgatcggc--cgccccggcgagctgcgcggcctgc Protospacer
..**** *****.*** ***************
100. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_009939 (Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence) position: , mismatch: 7, identity: 0.794
cgccggctgc-gccctggccagctgcgcggcctgc CRISPR spacer
-atcgtctccggccccggcgagctgcgcggcctgc Protospacer
..** ** * ****.*** ***************
101. spacer 1.51|3702765|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
cctgcgggggcgtcaggaacatggaac-cggtgag CRISPR spacer
cctgcggggccgtcaggcacatggcgctcggcgt- Protospacer
********* ******* ****** .* ***.*
102. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
cgttccggtccggcgcaagcccggc-cacctggt CRISPR spacer
cgttccgcgccggcgcaagcccggcgcggccag- Protospacer
******* **************** *. *..*
103. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788
cgttccggtccggcgcaagcccggc-cacctggt CRISPR spacer
cgttccgcgccggcgcaagcccggcgcggccag- Protospacer
******* **************** *. *..*
104. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 7, identity: 0.788
cgttccggtccggcgcaagcccggc-cacctggt CRISPR spacer
cgttccgcgccggcgcaagcccggcgcggccag- Protospacer
******* **************** *. *..*
105. spacer 1.54|3702962|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.8
acgctgcgct-atccggccgaccgcgccgcgatggc CRISPR spacer
-cacggcatcgatccggccgaccgtgccgcgatggc Protospacer
*.* **... *************.***********
106. spacer 1.16|3700419|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.771
aagcggtggcccgctgcccggcgtgtcgcgctctc CRISPR spacer
gagcggtggcccgctgcccgtcgggtcgaggccct Protospacer
.******************* ** **** * .*..
107. spacer 1.16|3700419|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.771
aagcggtggcccgctgcccggcgtgtcgcgctctc CRISPR spacer
gagcggtggcccgctgcccgtcgggtcgaggccct Protospacer
.******************* ** **** * .*..
108. spacer 1.16|3700419|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.771
aagcggtggcccgctgcccggcgtgtcgcgctctc CRISPR spacer
gagcggtggcccgctgcccgtcgggtcgaggccct Protospacer
.******************* ** **** * .*..
109. spacer 1.18|3700553|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 8, identity: 0.758
cacagct-ccgaaaggcgcgagctcgaaccgctt CRISPR spacer
-gcggatgccgaacggcgcgagctcgagccgcag Protospacer
.*.* * ***** *************.****
110. spacer 1.32|3701497|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to MT639646 (Microbacterium phage Rasputia, complete genome) position: , mismatch: 8, identity: 0.771
gacgtagccgctgtcgtcccaacggccgctgaaga CRISPR spacer
ccagtagccgctgtcgtcccgacggtcgccggcga Protospacer
*****************.****.***.*. **
111. spacer 1.41|3702096|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 8, identity: 0.765
ttgacgcccactccccgcagcaccaccggcttgc- CRISPR spacer
aatccgcccaatccccgcaccaccacc-gctagcc Protospacer
****** ******** ******* *** **
112. spacer 1.50|3702699|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017721 (Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 plasmid pCFSAN017963_01, complete sequence) position: , mismatch: 8, identity: 0.765
gacaccggcgagctggccatgctgtgggacgtgc CRISPR spacer
ctgaccggccagctggccatgctgtggcaggcgg Protospacer
****** ***************** * *.*
113. spacer 1.51|3702765|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to MN369748 (Mycobacterium phage Miko, complete genome) position: , mismatch: 8, identity: 0.765
cctgcggggg-----cgtcaggaacatggaaccggtgag CRISPR spacer
-----gggagtggttcgtcaggaacatggaacccgcgag Protospacer
***.* ****************** *.***
114. spacer 1.51|3702765|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to MF185727 (Mycobacterium phage BobSwaget, complete genome) position: , mismatch: 8, identity: 0.765
cctgcggggg-----cgtcaggaacatggaaccggtgag CRISPR spacer
-----gggagtggttcgtcaggaacatggaacccgcgag Protospacer
***.* ****************** *.***
115. spacer 1.51|3702765|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to MK801735 (Mycobacterium Phage Rachaly, complete genome) position: , mismatch: 8, identity: 0.765
cctgcggggg-----cgtcaggaacatggaaccggtgag CRISPR spacer
-----gggagtggttcgtcaggaacatggaacccgcgag Protospacer
***.* ****************** *.***
116. spacer 1.51|3702765|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to MF324899 (Mycobacterium phage Lokk, complete genome) position: , mismatch: 8, identity: 0.765
cctgcggggg-----cgtcaggaacatggaaccggtgag CRISPR spacer
-----gggagtggttcgtcaggaacatggaacccgcgag Protospacer
***.* ****************** *.***
117. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049031 (Fluviibacterium aquatile strain SC52 plasmid pSC52_3, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
cggccatgtccggatcaagcccggccacctgcg Protospacer
** .* ****** ****************
118. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
119. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
120. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
121. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
122. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
123. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
124. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
125. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
126. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
127. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
128. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
129. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
130. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
131. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
132. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
133. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
134. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
135. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
136. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
137. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
138. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
139. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
140. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgttgcggtccggcgcaagcgcggcggctttgg Protospacer
.*** *************** **** .*.* *
141. spacer 1.54|3702962|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.771
acgctgcgctatccggccgaccgcgccgcgatggc CRISPR spacer
ccgctgcgctttccggccgaccgcgcgacgcggct Protospacer
********* *************** .** * .
142. spacer 1.54|3702962|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.771
acgctgcgctatccggccgaccgcgccgcgatggc CRISPR spacer
ccgctgcgctttccggccgaccgcgcgacgcggct Protospacer
********* *************** .** * .
143. spacer 1.55|3703029|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.771
ccgtacgtacgggagcgggagccgggacgggggtg CRISPR spacer
gagccgggacgggggcgggagccgggacgggggcg Protospacer
*. * *****.*******************.*
144. spacer 1.55|3703029|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.771
ccgtacgtacgggagcgggagccgggacgggggtg CRISPR spacer
gagtcggcacgggggcgggagccggcacgggggcg Protospacer
** *.*****.*********** *******.*
145. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
-acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
taca-gcgcttgcagcacaaggatcttgaacatcg Protospacer
**. ***.******.************** . *
146. spacer 1.70|3704035|35|NC_015677|PILER-CR,CRT matches to NZ_CP031086 (Paracoccus yeei strain CCUG 32053 plasmid pYEE8, complete sequence) position: , mismatch: 8, identity: 0.771
gataacgcgccgatgcagcgcggcctgctggacgt- CRISPR spacer
ggcgacgcgccgatgctgcccggcctgct-gtcgca Protospacer
*...************ ** ********* * **.
147. spacer 1.73|3704228|35|NC_015677|PILER-CR matches to NC_015729 (Roseobacter litoralis Och 149 plasmid pRLO149_63, complete sequence) position: , mismatch: 8, identity: 0.771
atgccgtgcagcaccacgctgcgcgggctcttgag CRISPR spacer
cggtcgtgctgcaccacgctgcgcaggctccagaa Protospacer
*.***** **************.*****. **.
148. spacer 1.76|3704220|35|NC_015677|CRT matches to NC_015729 (Roseobacter litoralis Och 149 plasmid pRLO149_63, complete sequence) position: , mismatch: 8, identity: 0.771
tgccgtgcagcaccacgctgcgcgggctcttgagg CRISPR spacer
ggtcgtgctgcaccacgctgcgcaggctccagaat Protospacer
*.***** **************.*****. **.
149. spacer 1.81|3704219|35|NC_015677|CRISPRCasFinder matches to NC_015729 (Roseobacter litoralis Och 149 plasmid pRLO149_63, complete sequence) position: , mismatch: 8, identity: 0.771
atgccgtgcagcaccacgctgcgcgggctcttgag CRISPR spacer
cggtcgtgctgcaccacgctgcgcaggctccagaa Protospacer
*.***** **************.*****. **.
150. spacer 1.6|3699754|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.727
ttgtacc----ccccgggcaccagcacgccgatcggg CRISPR spacer
----gccgtggcctcgggcaccagcacgtcgatcgca Protospacer
.** **.**************.****** .
151. spacer 1.6|3699754|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.727
ttgtaccccccgggcaccagcacgccgatcggg CRISPR spacer
gggtacccgccgggcagcagcacgccccccacg Protospacer
****** ******* ********* .*. *
152. spacer 1.6|3699754|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.727
ttgtacc----ccccgggcaccagcacgccgatcggg CRISPR spacer
----gccgtggcctcgggcaccagcacgtcgatcgca Protospacer
.** **.**************.****** .
153. spacer 1.7|3699819|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020540 (Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence) position: , mismatch: 9, identity: 0.735
gtggatgggaacgcccacaggctgcaggcctggc CRISPR spacer
tatgatgggaacgcccacagcgtgcaggcgtctg Protospacer
***************** ******* *
154. spacer 1.34|3701630|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 9, identity: 0.735
tgcgcggcgaacgaatcgggcgccatgcactcga CRISPR spacer
gctgcggcgaacgaatcaggcgccttgaggtcgt Protospacer
.**************.****** ** . ***
155. spacer 1.34|3701630|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
tgcgcggcgaacgaatcgggcgccatgcactcga CRISPR spacer
gctgcggcgaacgaatcaggcgccttgaggtcgt Protospacer
.**************.****** ** . ***
156. spacer 1.34|3701630|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
tgcgcggcgaacgaatcgggcgccatgcactcga CRISPR spacer
gctgcggcgaacgaatcaggcgccttgaggtcgt Protospacer
.**************.****** ** . ***
157. spacer 1.37|3701829|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcaggcgctgctcggcctcgcggcgagcctcgg CRISPR spacer
gcgctggcgctgctcggccccgcggctttcgccaa Protospacer
**** **************.****** * .*..
158. spacer 1.37|3701829|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcaggcgctgctcggcctcgcggcgagcctcgg CRISPR spacer
gggcaagcgctgctgggcctcgcggcggagctgac Protospacer
* ***.******** ************.. ** .
159. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.735
cgccggctgcgccctggccagctgcgcggcctgc CRISPR spacer
gcccggcagcgccttggccagctgcgccagttga Protospacer
***** *****.************* . .**
160. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_048112 (Escherichia phage Skarpretter, complete genome) position: , mismatch: 9, identity: 0.735
cgccggctgcgccctggccagctgcgcggcctgc CRISPR spacer
tcgctgcgaggcgctggcctgctgcgcggcctgc Protospacer
. * ** . ** ****** **************
161. spacer 1.49|3702633|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ggcggcggtgccttcggcgcgaaagcgctgttgc CRISPR spacer
gaggaaggtcccttcgccgcgaaagcgctggcga Protospacer
*. *. *** ****** ************* .*
162. spacer 1.50|3702699|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045204 (Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence) position: , mismatch: 9, identity: 0.735
gacaccggcgagctggccatgctgtgggacgtgc CRISPR spacer
ctgaccggccagctggccctgctgtggcaggcgg Protospacer
****** ******** ******** * *.*
163. spacer 1.50|3702699|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.735
gacaccggcgagctggccatgctgtgggacgtgc CRISPR spacer
cgcgccttggagctggcgatgctgtcggacgtga Protospacer
.*.** ******** ******* *******
164. spacer 1.50|3702699|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.735
gacaccggcgagctggccatgctgtgggacgtgc CRISPR spacer
cgcgccatggagctggcgatgctgtcggacgtga Protospacer
.*.**. ******** ******* *******
165. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.727
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
gtgtccggtccggcgcaaacgcggccatcggcg Protospacer
***************.* ******.* *
166. spacer 1.55|3703029|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.743
ccgtacgtacgggagcgggagccgggacgggggtg CRISPR spacer
gagccggcacgggggcgggagccggcacgggggcg Protospacer
*. *.*****.*********** *******.*
167. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 9, identity: 0.735
-acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
taca-gcgcctgcagcaccaggatcttgaacatca Protospacer
**. **********.* ************ . .
168. spacer 1.70|3704035|35|NC_015677|PILER-CR,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
gataacgcgccgatgcagcgcggcctgctggacgt CRISPR spacer
gaggccgcgccgatgctgcgcggcgtgctgacccg Protospacer
** . *********** ******* *****. *
169. spacer 1.16|3700419|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 10, identity: 0.714
aagcggtggcccgctgcccggcgtgtcgcgctctc CRISPR spacer
gagcggtggcccgctgcccgtcgggttcgaggccc Protospacer
.******************* ** **. . *.*
170. spacer 1.18|3700553|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 10, identity: 0.697
cacagctccgaaaggcgcgagctcgaaccgctt CRISPR spacer
gttcgggccgaaaggcgcgagcccgaacggcac Protospacer
. * ***************.***** ** .
171. spacer 1.18|3700553|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.697
cacagctccgaaaggcgcgagctcgaaccgctt CRISPR spacer
gttcgggccgaaaggcgcgagcccgaacggcac Protospacer
. * ***************.***** ** .
172. spacer 1.31|3701431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.706
gcttgcgccttgctagcagccgctagcggcttgc CRISPR spacer
cgaggcgccttggtcgcagccgctagcgccatca Protospacer
******** * ************* * *
173. spacer 1.39|3701964|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.706
tcgacgaggacgtgctcgttgccgctcacagcga CRISPR spacer
gcgacgaggacgtgcacgtcgccgccgatcttgg Protospacer
************** ***.*****. *. .*.
174. spacer 1.40|3702030|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031448 (Austwickia chelonae strain LK16-18 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcctgagcgacgtgcgccgctgggggccgtggg CRISPR spacer
gggtgtggcggcgtacgccgctgggggccgtgga Protospacer
. .***.***.******************.
175. spacer 1.40|3702030|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_006912 (Streptomyces sp. FQ1 plasmid pFP1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcctgagcgacgtgcgccgctgggggccgtggg CRISPR spacer
gcgatcagcgacgtgagccgctgggtgccgacgt Protospacer
. * ********* ********* **** *
176. spacer 1.40|3702030|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcctgagcgacgtgcgccgctgggggccgtggg CRISPR spacer
gcgatcagcgacgtgagccgctgggtgccgacgt Protospacer
. * ********* ********* **** *
177. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.706
cgccggctgcgccctggccagctgcgcggcctgc CRISPR spacer
gtcgagctgcgccctggcgagctgcacggaggcc Protospacer
* .************* ******.*** *
178. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033082 (Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
cgccggctgcgccctggccagctgcgcggcctgc CRISPR spacer
agggaggaatgccctggccaggtgagcggcctgc Protospacer
* .* ..*********** ** *********
179. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 10, identity: 0.706
cgccggctgcgccctggccagctgcgcggcctgc CRISPR spacer
aaccgactgcgccgtggccagctgcgtacgcaac Protospacer
.***.******* ************.. * .*
180. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 10, identity: 0.706
cgccggctgcgccctggccagctgcgcggcctgc CRISPR spacer
cactccttgcgcccgggccagctgagcggccgca Protospacer
*.*. .******* ********* ******
181. spacer 1.47|3702499|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 10, identity: 0.706
cgccggctgcgccctggccagctgcgcggcctgc CRISPR spacer
cactccttgcgcccgggccagctgagcggccgca Protospacer
*.*. .******* ********* ******
182. spacer 1.50|3702699|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.706
gacaccggcgagctggccatgctgtgggacgtgc CRISPR spacer
ccgatcggcgagctggcgacgctgtgggacagat Protospacer
*.************ *.**********. ..
183. spacer 1.51|3702765|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
cctgcgggggcgtcaggaacatggaaccggtgag CRISPR spacer
gcccggacggcgtgaggaacatggaaccgctgcc Protospacer
*. *. ***** *************** **
184. spacer 1.53|3702897|33|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 10, identity: 0.697
cgttccggtccggcgcaagcccggccacctggt CRISPR spacer
tgaatatctccgccgcaagccaggccacctggc Protospacer
.* . **** ******** **********.
185. spacer 1.54|3702962|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 10, identity: 0.714
acgctgcgctatccggccgaccgcgccgcgatggc CRISPR spacer
gtcataggctgcccggccgaccgcgccgcgatcga Protospacer
.. *. ***..******************** *
186. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
ccgtccgcctgcagcgcaacgatctgagcagcat Protospacer
****************** ***** .. *.
187. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 10, identity: 0.706
acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
tagagcgcctgcagcaccaggatcttgaacatca Protospacer
* **********.* ************ . .
188. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 10, identity: 0.706
acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
tagagcgcctgcagcaccaggatcttgaacatca Protospacer
* **********.* ************ . .
189. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NC_010865 (Sinorhizobium meliloti plasmid pSmeSM11b, complete sequence) position: , mismatch: 10, identity: 0.706
-acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
taca-atgcctgcagcaccaggatcttgaacatca Protospacer
**. .*********.* ************ . .
190. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021216 (Sinorhizobium meliloti RU11/001 plasmid pSmeRU11d, complete sequence) position: , mismatch: 10, identity: 0.706
-acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
taca-atgcctgcagcaccaggatcttgaacatca Protospacer
**. .*********.* ************ . .
191. spacer 1.78|3704353|34|NC_015677|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.706
gtagtgggcgcggaggcgcagcggatcctggggg CRISPR spacer
tcgttcgccgccgaggcccagcggatcctgggct Protospacer
.. * * *** ***** **************
192. spacer 1.78|3704353|34|NC_015677|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.706
gtagtgggcgcggaggcgcagcggatcctggggg CRISPR spacer
tcgttcgccgccgaggcccagcggatcctgggct Protospacer
.. * * *** ***** **************
193. spacer 1.78|3704353|34|NC_015677|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.706
gtagtgggcgcggaggcgcagcggatcctggggg CRISPR spacer
acccatggcgcggatgcgcagcgggtcctgccgg Protospacer
.. ******** *********.***** **
194. spacer 1.78|3704353|34|NC_015677|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.706
gtagtgggcgcggaggcgcagcggatcctggggg CRISPR spacer
acccatggcgcggatgcgcagcgggtcctgccgg Protospacer
.. ******** *********.***** **
195. spacer 1.43|3702230|35|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to CP054330 (Escherichia coli strain SCU-121 plasmid pSCU-121-2, complete sequence) position: , mismatch: 11, identity: 0.686
aagcgtgaattcgcgttgcagttgctggcggacgc CRISPR spacer
gtcagcgaattcgtgtttcagttgctggcgggtca Protospacer
. *.*******.*** *************..
196. spacer 1.50|3702699|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 11, identity: 0.676
gacaccggcgagctggccatgctgtgggacgtgc CRISPR spacer
ctgggccgcgagctggcgatgctgtggggcggta Protospacer
. * ********** **********.**
197. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.676
acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
tatagcgcctgcagcaccaggatcttgaacatca Protospacer
**********.* ************ . .
198. spacer 1.61|3703431|34|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 11, identity: 0.676
acgtccgcctgcagcgcaaggatcttgaactcgg CRISPR spacer
tagagagcctgcagcaccaggatcttgaacatca Protospacer
* *********.* ************ . .
199. spacer 1.38|3701896|36|NC_015677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031448 (Austwickia chelonae strain LK16-18 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.667
ctcctgagcgacgtgcgccgctgggggccgtgggac CRISPR spacer
gggtgtggcggcgtacgccgctgggggccgtggagt Protospacer
. .***.***.******************...
