Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015663 Klebsiella aerogenes KCTC 2190, complete sequence 4 crisprs csa3,cas3,RT,WYL,cas14j,DEDDh,DinG 0 2 5 0

Results visualization

1. NC_015663
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015663_1 602336-602450 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015663_2 1381876-1381957 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015663_3 1858193-1858314 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015663_4 3152654-3152727 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015663_2 2.1|1381903|28|NC_015663|CRISPRCasFinder 1381903-1381930 28 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 133968-133995 0 1.0
NC_015663_4 4.1|3152678|26|NC_015663|CRISPRCasFinder 3152678-3152703 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324018-324043 0 1.0
NC_015663_4 4.1|3152678|26|NC_015663|CRISPRCasFinder 3152678-3152703 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447528-447553 2 0.923
NC_015663_4 4.1|3152678|26|NC_015663|CRISPRCasFinder 3152678-3152703 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323588-323613 5 0.808
NC_015663_4 4.1|3152678|26|NC_015663|CRISPRCasFinder 3152678-3152703 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447689-447714 6 0.769

1. spacer 2.1|1381903|28|NC_015663|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 0, identity: 1.0

cctacggtctgatagctcgagcaagccc	CRISPR spacer
cctacggtctgatagctcgagcaagccc	Protospacer
****************************

2. spacer 4.1|3152678|26|NC_015663|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

ggctacccgcggtgccgtttttttgt	CRISPR spacer
ggctacccgcggtgccgtttttttgt	Protospacer
**************************

3. spacer 4.1|3152678|26|NC_015663|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 2, identity: 0.923

ggctacccgcggtgccgtttttttgt	CRISPR spacer
cgctactcgcggtgccgtttttttgt	Protospacer
 *****.*******************

4. spacer 4.1|3152678|26|NC_015663|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.808

ggctacccgcggtgccgtttttttgt	CRISPR spacer
atctacccgcggtgccgttttttgtc	Protospacer
. *********************  .

5. spacer 4.1|3152678|26|NC_015663|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 6, identity: 0.769

ggctacccgcggtgccgtttttttgt	CRISPR spacer
cactactcgcggtgccgttttttgtc	Protospacer
 .****.****************  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2607257 : 2614864 8 Erwinia_phage(33.33%) NA NA
DBSCAN-SWA_2 4507026 : 4549853 47 Escherichia_phage(20.51%) tail,integrase,holin,terminase attL 4497578:4497592|attR 4554624:4554638
DBSCAN-SWA_3 4749559 : 4776514 36 Cronobacter_phage(48.39%) holin,head,terminase NA
DBSCAN-SWA_4 4779816 : 4793082 22 Escherichia_phage(27.78%) tail NA
DBSCAN-SWA_5 4976697 : 4986018 9 Enterobacteria_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage