Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 0 crisprs RT,WYL,DEDDh 0 0 6 0
NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 0 crisprs csa3,RT 0 0 1 0
NC_017325 Sinorhizobium meliloti SM11, complete sequence 4 crisprs csa3,WYL,cas3,RT,DEDDh 0 2 9 0

Results visualization

1. NC_017327
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88614 : 160408 52 uncultured_virus(22.22%) transposase NA
DBSCAN-SWA_2 167135 : 173686 8 Sinorhizobium_phage(33.33%) NA NA
DBSCAN-SWA_3 896131 : 924362 23 Acidithiobacillus_phage(25.0%) transposase NA
DBSCAN-SWA_4 1037616 : 1101213 47 Bacillus_virus(18.18%) transposase NA
DBSCAN-SWA_5 1114882 : 1149670 26 Stx2-converting_phage(33.33%) transposase,integrase attL 1108046:1108105|attR 1127441:1129006
DBSCAN-SWA_6 1161270 : 1169597 7 uncultured_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_017326
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 269712 : 278547 9 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_017325
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017325_1 734795-734908 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017325_2 1555925-1556037 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017325_3 2845539-2845623 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017325_4 3684183-3684329 Orphan NA
2 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017325_1 1.1|734833|38|NC_017325|CRISPRCasFinder 734833-734870 38 NZ_CP015741 Shinella sp. HZN7 plasmid pShin-05, complete sequence 7231-7268 4 0.895
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 97030-97058 4 0.862
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1132537-1132565 4 0.862
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 437980-438008 4 0.862
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 673583-673611 4 0.862
NC_017325_1 1.1|734833|38|NC_017325|CRISPRCasFinder 734833-734870 38 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 250765-250802 5 0.868
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 29583-29611 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 233908-233936 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 293861-293889 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 933932-933960 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 480867-480895 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 155418-155446 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 472426-472454 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 269088-269116 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 506803-506831 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 313158-313186 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1304182-1304210 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 38576-38604 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 775930-775958 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 35045-35073 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 4927-4955 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1508268-1508296 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 35681-35709 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 591831-591859 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1248621-1248649 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 2287-2315 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1081431-1081459 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1302519-1302547 5 0.828
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 35474-35502 5 0.828
NC_017325_1 1.1|734833|38|NC_017325|CRISPRCasFinder 734833-734870 38 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1691497-1691534 6 0.842
NC_017325_1 1.1|734833|38|NC_017325|CRISPRCasFinder 734833-734870 38 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 126743-126780 6 0.842
NC_017325_1 1.1|734833|38|NC_017325|CRISPRCasFinder 734833-734870 38 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 188971-189008 6 0.842
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 630096-630124 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1273441-1273469 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 143417-143445 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1488498-1488526 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 580595-580623 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 1323600-1323628 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1240000-1240028 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1331029-1331057 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1417421-1417449 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 769758-769786 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 172401-172429 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 136287-136315 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 143082-143110 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 430636-430664 6 0.793
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 788311-788339 6 0.793
NC_017325_1 1.1|734833|38|NC_017325|CRISPRCasFinder 734833-734870 38 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 99915-99952 8 0.789
NC_017325_1 1.1|734833|38|NC_017325|CRISPRCasFinder 734833-734870 38 NZ_CP013632 Rhizobium sp. N324 plasmid pRspN324b, complete sequence 155054-155091 9 0.763
NC_017325_3 3.1|2845567|29|NC_017325|CRISPRCasFinder 2845567-2845595 29 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 159083-159111 9 0.69

1. spacer 1.1|734833|38|NC_017325|CRISPRCasFinder matches to NZ_CP015741 (Shinella sp. HZN7 plasmid pShin-05, complete sequence) position: , mismatch: 4, identity: 0.895

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaaggcccggtctatccgaacatgtgaatttt	Protospacer
** ******** *********************** *.

2. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 4, identity: 0.862

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccggacggaaaa	Protospacer
 .* **.**********************

3. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.862

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccggacggaaaa	Protospacer
 .* **.**********************

4. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.862

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccggacggaaaa	Protospacer
 .* **.**********************

5. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.862

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccggacggaaaa	Protospacer
 .* **.**********************

6. spacer 1.1|734833|38|NC_017325|CRISPRCasFinder matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 5, identity: 0.868

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaagggccggtctatccgaatatgtgatcatc	Protospacer
** ***********************.****** ..**

7. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggacggaaaa	Protospacer
 .. **.**********************

8. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

9. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggacggaaaa	Protospacer
 .. **.**********************

10. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggacggaaaa	Protospacer
 .. **.**********************

11. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggacggaaaa	Protospacer
 .. **.**********************

12. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggacggaaaa	Protospacer
 .. **.**********************

13. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggacggaaaa	Protospacer
 .. **.**********************

14. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

15. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggacggaaaa	Protospacer
 .. **.**********************

16. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

17. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

18. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

19. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

20. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

21. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

22. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

23. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

24. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

25. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

26. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

27. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

28. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

29. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.828

acccttctgccgcaactccggacggaaaa	CRISPR spacer
ttcattttgccgcaactccgcacggaaaa	Protospacer
 .* **.************* ********

30. spacer 1.1|734833|38|NC_017325|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.842

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaaggcccggtctatccgaacatgtgacgtcc	Protospacer
** ******** *********************   .*

31. spacer 1.1|734833|38|NC_017325|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.842

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaaggcccggtctatccgaacatgtgagttcg	Protospacer
** ******** *********************.* . 

32. spacer 1.1|734833|38|NC_017325|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 6, identity: 0.842

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaagggccggtctatccgaatatgtaaccgac	Protospacer
** ***********************.****.* .* *

33. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

34. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggacgggaaa	Protospacer
 .. **.******************.***

35. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

36. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

37. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

38. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

39. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

40. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

41. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

42. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

43. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

44. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

45. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

46. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaactccggatggaaaa	Protospacer
 .. **.***************.******

47. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.793

acccttctgccgcaactccggacggaaaa	CRISPR spacer
tttgttttgccgcaattccggacggaaaa	Protospacer
 .. **.********.*************

48. spacer 1.1|734833|38|NC_017325|CRISPRCasFinder matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 8, identity: 0.789

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
gggggcgaaggcccggtctatccgaacatgtagcccga	Protospacer
*********** *******************.. .   

49. spacer 1.1|734833|38|NC_017325|CRISPRCasFinder matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 9, identity: 0.763

gggggcgaagggccggtctatccgaacatgtgaatgtc	CRISPR spacer
ggcggcgaggggccggtctatccgaacatgtagggcag	Protospacer
** *****.**********************...    

50. spacer 3.1|2845567|29|NC_017325|CRISPRCasFinder matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 9, identity: 0.69

acccttctgccgcaactccggacggaaaa	CRISPR spacer
gagtttctgccgcaactccgaacgggccg	Protospacer
.  .****************.****.  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 880662 : 937256 59 Vibrio_phage(10.0%) transposase,tRNA,tail,head,portal NA
DBSCAN-SWA_2 1066887 : 1124668 65 Paracoccus_phage(29.41%) integrase,terminase,transposase,capsid,protease,tail,head,portal attL 1069971:1069985|attR 1086311:1086325
DBSCAN-SWA_3 1453812 : 1501326 57 Sinorhizobium_phage(86.11%) capsid,tail,integrase,portal attL 1453058:1453080|attR 1501482:1501504
DBSCAN-SWA_4 1799048 : 1825764 46 Sinorhizobium_phage(41.67%) terminase,head NA
DBSCAN-SWA_5 1831968 : 1900116 83 Sinorhizobium_phage(83.67%) terminase,tRNA,transposase,capsid,tail,head,portal NA
DBSCAN-SWA_6 2010399 : 2021648 12 uncultured_Mediterranean_phage(80.0%) tRNA NA
DBSCAN-SWA_7 2238986 : 2299154 60 Bacillus_phage(16.67%) integrase,terminase,tRNA,capsid,tail,head,portal attL 2282324:2282343|attR 2295955:2295974
DBSCAN-SWA_8 2356218 : 2399399 63 Sinorhizobium_phage(57.14%) terminase,tail,head NA
DBSCAN-SWA_9 3186826 : 3195180 8 Acidithiobacillus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage