Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015726 Cupriavidus necator N-1 chromosome 1, complete sequence 2 crisprs c2c9_V-U4,DinG,csa3,DEDDh,WYL,cas3,RT 0 0 6 0
NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 0 crisprs cas14j,PD-DExK,DEDDh,csa3 0 0 4 0
NC_015723 Cupriavidus necator N-1 chromosome 2, complete sequence 3 crisprs DEDDh,c2c9_V-U4,csa3,DinG,RT,cas14j 0 1 0 0
NC_015724 Cupriavidus necator N-1 plasmid pBB2, complete sequence 0 crisprs RT,c2c9_V-U4 0 0 0 0

Results visualization

1. NC_015726
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015726_1 1432689-1432783 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015726_2 3301504-3301612 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 233860 : 281815 47 Salmonella_phage(15.38%) tRNA,holin,transposase NA
DBSCAN-SWA_2 838353 : 847156 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_3 1180918 : 1273211 102 Burkholderia_phage(16.13%) tRNA,terminase,tail,integrase,protease,transposase,head,plate,holin,portal attL 1189288:1189304|attR 1199081:1199097
DBSCAN-SWA_4 1361981 : 1371346 12 Burkholderia_virus(42.86%) integrase attL 1354936:1354950|attR 1368973:1368987
DBSCAN-SWA_5 3127944 : 3137259 9 Methanothermobacter_phage(16.67%) protease NA
DBSCAN-SWA_6 3665661 : 3671722 8 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_015727
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 291536 : 342405 38 uncultured_virus(22.22%) integrase,transposase attL 305513:305540|attR 325204:325231
DBSCAN-SWA_2 641603 : 733417 60 uncultured_virus(21.43%) integrase,transposase attL 641365:641381|attR 660178:660194
DBSCAN-SWA_3 740618 : 786470 37 Acidithiobacillus_phage(25.0%) transposase NA
DBSCAN-SWA_4 1413924 : 1438841 23 Wolbachia_phage(40.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_015723
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015723_1 2683665-2683810 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015723_2 2683921-2684101 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015723_3 2684259-2684415 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015723_1 1.1|2683688|23|NC_015723|CRISPRCasFinder 2683688-2683710 23 KC170285 Uncultured bacterium plasmid pMBUI2, complete sequence 27480-27502 2 0.913

1. spacer 1.1|2683688|23|NC_015723|CRISPRCasFinder matches to KC170285 (Uncultured bacterium plasmid pMBUI2, complete sequence) position: , mismatch: 2, identity: 0.913

gagcagggcacaacgtcatggca	CRISPR spacer
gagcagggcacagcgccatggca	Protospacer
************.**.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage