Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015759 Weissella koreensis KACC 15510, complete sequence 3 crisprs cas3,DEDDh,WYL,csa3,DinG 2 1 2 0
NC_015756 Weissella koreensis KACC 15510 plasmid WKp2903, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NC_015759
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015759_1 35840-36050 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015759_2 468788-468993 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015759_3 1144622-1144718 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_015759_1 1.1|35903|15|NC_015759|PILER-CR 35903-35917 15 NC_015759.1 35817-35831 0 1.0
NC_015759_1 1.1|35903|15|NC_015759|PILER-CR 35903-35917 15 NC_015759.1 36051-36065 0 1.0
NC_015759_1 1.2|35981|27|NC_015759|PILER-CR 35981-36007 27 NC_015759.1 35805-35831 0 1.0
NC_015759_1 1.2|35981|27|NC_015759|PILER-CR 35981-36007 27 NC_015759.1 36039-36065 0 1.0

1. spacer 1.1|35903|15|NC_015759|PILER-CR matches to position: 35817-35831, mismatch: 0, identity: 1.0

ctgaaatattatctg	CRISPR spacer
ctgaaatattatctg	Protospacer
***************

2. spacer 1.1|35903|15|NC_015759|PILER-CR matches to position: 36051-36065, mismatch: 0, identity: 1.0

ctgaaatattatctg	CRISPR spacer
ctgaaatattatctg	Protospacer
***************

3. spacer 1.2|35981|27|NC_015759|PILER-CR matches to position: 35805-35831, mismatch: 0, identity: 1.0

ttgattcgctatctgaaatattatctg	CRISPR spacer
ttgattcgctatctgaaatattatctg	Protospacer
***************************

4. spacer 1.2|35981|27|NC_015759|PILER-CR matches to position: 36039-36065, mismatch: 0, identity: 1.0

ttgattcgctatctgaaatattatctg	CRISPR spacer
ttgattcgctatctgaaatattatctg	Protospacer
***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015759_1 1.2|35981|27|NC_015759|PILER-CR 35981-36007 27 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 489608-489634 6 0.778
NC_015759_1 1.2|35981|27|NC_015759|PILER-CR 35981-36007 27 MK448581 Streptococcus satellite phage Javan620, complete genome 10075-10101 6 0.778
NC_015759_1 1.2|35981|27|NC_015759|PILER-CR 35981-36007 27 NZ_LR215005 Mycoplasma conjunctivae strain NCTC10147 plasmid 9 49098-49124 6 0.778
NC_015759_1 1.2|35981|27|NC_015759|PILER-CR 35981-36007 27 MN693374 Marine virus AFVG_25M38, complete genome 8945-8971 6 0.778

1. spacer 1.2|35981|27|NC_015759|PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 6, identity: 0.778

ttgattcgctatctgaaatattatctg	CRISPR spacer
atgattcactatgtgaaatattattat	Protospacer
 ******.**** ***********.  

2. spacer 1.2|35981|27|NC_015759|PILER-CR matches to MK448581 (Streptococcus satellite phage Javan620, complete genome) position: , mismatch: 6, identity: 0.778

ttgattcgctatctgaaatattatctg	CRISPR spacer
ttaattcactatctgaaatattagagc	Protospacer
**.****.***************    

3. spacer 1.2|35981|27|NC_015759|PILER-CR matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 6, identity: 0.778

ttgattcgctatctgaaatattatctg	CRISPR spacer
ctaattcgctatctgaaataatattaa	Protospacer
.*.***************** ***. .

4. spacer 1.2|35981|27|NC_015759|PILER-CR matches to MN693374 (Marine virus AFVG_25M38, complete genome) position: , mismatch: 6, identity: 0.778

ttgattcgctatctgaaatattatctg	CRISPR spacer
taataccgctatctgaaatatgatctg	Protospacer
* .  .*************** *****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 496102 : 504656 9 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_2 1199999 : 1209274 7 Catovirus(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage