Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017186 Amycolatopsis mediterranei S699, complete sequence 27 crisprs csa3,WYL,DEDDh,casR,cas4,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,DinG 7 45 4 0

Results visualization

1. NC_017186
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_1 70618-70717 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_2 301018-301110 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_3 763122-763205 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_4 1339607-1339682 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_5 1356881-1357109 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_6 1632660-1632783 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_7 1931492-1931584 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_8 2088131-2088553 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_9 2551218-2551314 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_10 2899104-2899190 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_11 3229412-3229519 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_13 3580882-3580967 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_12 3575110-3575207 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_14 3595321-3595412 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_16 5356387-5356467 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_17 5356741-5356829 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_15 5355889-5356032 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_18 5780710-5780792 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_19 6436780-6437778 TypeI-E NA
16 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_23 6444434-6444702 TypeI-E NA
4 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_22 6441951-6442222 TypeI-E NA
4 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_20 6438603-6438875 TypeI-E NA
4 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_21 6441416-6441811 TypeI-E NA
6 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_24 6444797-6444943 TypeI-E NA
2 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_25 6960989-6961083 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_26 8279767-8280303 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017186_27 10142210-10142316 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 2183107-2183135 0 1.0
NC_017186_26 26.8|8280214|18|NC_017186|CRT 8280214-8280231 18 NC_017186.1 8280289-8280306 0 1.0
NC_017186_26 26.8|8280214|18|NC_017186|CRT 8280214-8280231 18 NC_017186.1 8280294-8280311 0 1.0
NC_017186_26 26.8|8280214|18|NC_017186|CRT 8280214-8280231 18 NC_017186.1 8280299-8280316 0 1.0
NC_017186_26 26.9|8280259|18|NC_017186|CRT 8280259-8280276 18 NC_017186.1 8280289-8280306 0 1.0
NC_017186_26 26.9|8280259|18|NC_017186|CRT 8280259-8280276 18 NC_017186.1 8280294-8280311 0 1.0
NC_017186_26 26.9|8280259|18|NC_017186|CRT 8280259-8280276 18 NC_017186.1 8280299-8280316 0 1.0
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 557412-557440 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 2916209-2916237 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 5989687-5989715 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 6196696-6196724 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 8163985-8164013 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 71547-71575 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 247667-247695 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 247727-247755 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 247788-247816 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 1133584-1133612 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 3315693-3315721 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 3320040-3320068 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 3377297-3377325 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 7397398-7397426 1 0.966
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 9965535-9965563 1 0.966
NC_017186_26 26.7|8280169|18|NC_017186|CRT 8280169-8280186 18 NC_017186.1 5200267-5200284 1 0.944
NC_017186_26 26.8|8280214|18|NC_017186|CRT 8280214-8280231 18 NC_017186.1 8307405-8307422 1 0.944
NC_017186_26 26.9|8280259|18|NC_017186|CRT 8280259-8280276 18 NC_017186.1 8307405-8307422 1 0.944
NC_017186_1 1.1|70655|26|NC_017186|CRISPRCasFinder 70655-70680 26 NC_017186.1 1133588-1133613 2 0.923
NC_017186_1 1.1|70655|26|NC_017186|CRISPRCasFinder 70655-70680 26 NC_017186.1 7397402-7397427 2 0.923
NC_017186_1 1.1|70655|26|NC_017186|CRISPRCasFinder 70655-70680 26 NC_017186.1 2681721-2681746 2 0.923
NC_017186_1 1.1|70655|26|NC_017186|CRISPRCasFinder 70655-70680 26 NC_017186.1 8888544-8888569 2 0.923
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 557286-557314 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 557349-557377 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 580730-580758 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 824870-824898 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 1455611-1455639 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 7434897-7434925 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 7627943-7627971 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 8429222-8429250 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 8927885-8927913 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 10032795-10032823 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 1842484-1842512 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 2167284-2167312 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 2497833-2497861 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 2613929-2613957 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 2817060-2817088 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 3537721-3537749 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 5078196-5078224 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 5780701-5780729 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 7298534-7298562 2 0.931
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_017186.1 8652672-8652700 2 0.931
NC_017186_26 26.4|8280011|19|NC_017186|CRT 8280011-8280029 19 NC_017186.1 2047133-2047151 2 0.895
NC_017186_26 26.4|8280011|19|NC_017186|CRT 8280011-8280029 19 NC_017186.1 4313863-4313881 2 0.895
NC_017186_26 26.4|8280011|19|NC_017186|CRT 8280011-8280029 19 NC_017186.1 5071229-5071247 2 0.895
NC_017186_26 26.4|8280011|19|NC_017186|CRT 8280011-8280029 19 NC_017186.1 7612726-7612744 2 0.895
NC_017186_26 26.6|8280108|34|NC_017186|CRT 8280108-8280141 34 NC_017186.1 8280273-8280306 2 0.941
NC_017186_26 26.6|8280108|34|NC_017186|CRT 8280108-8280141 34 NC_017186.1 8280278-8280311 2 0.941
NC_017186_26 26.6|8280108|34|NC_017186|CRT 8280108-8280141 34 NC_017186.1 8280283-8280316 2 0.941

1. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 2183107-2183135, mismatch: 0, identity: 1.0

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgagccggggg	Protospacer
*****************************

2. spacer 26.8|8280214|18|NC_017186|CRT matches to position: 8280289-8280306, mismatch: 0, identity: 1.0

tcggctcggctcggctcg	CRISPR spacer
tcggctcggctcggctcg	Protospacer
******************

3. spacer 26.8|8280214|18|NC_017186|CRT matches to position: 8280294-8280311, mismatch: 0, identity: 1.0

tcggctcggctcggctcg	CRISPR spacer
tcggctcggctcggctcg	Protospacer
******************

4. spacer 26.8|8280214|18|NC_017186|CRT matches to position: 8280299-8280316, mismatch: 0, identity: 1.0

tcggctcggctcggctcg	CRISPR spacer
tcggctcggctcggctcg	Protospacer
******************

5. spacer 26.9|8280259|18|NC_017186|CRT matches to position: 8280289-8280306, mismatch: 0, identity: 1.0

tcggctcggctcggctcg	CRISPR spacer
tcggctcggctcggctcg	Protospacer
******************

6. spacer 26.9|8280259|18|NC_017186|CRT matches to position: 8280294-8280311, mismatch: 0, identity: 1.0

tcggctcggctcggctcg	CRISPR spacer
tcggctcggctcggctcg	Protospacer
******************

7. spacer 26.9|8280259|18|NC_017186|CRT matches to position: 8280299-8280316, mismatch: 0, identity: 1.0

tcggctcggctcggctcg	CRISPR spacer
tcggctcggctcggctcg	Protospacer
******************

8. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 557412-557440, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

9. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 2916209-2916237, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

10. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 5989687-5989715, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

11. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 6196696-6196724, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

12. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 8163985-8164013, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaatcggggcttcgccccgagccggggg	Protospacer
****.************************

13. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 71547-71575, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

14. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 247667-247695, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

15. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 247727-247755, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

16. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 247788-247816, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

17. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 1133584-1133612, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggcttcgccccgagccggggg	Protospacer
*** *************************

18. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 3315693-3315721, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

19. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 3320040-3320068, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

20. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 3377297-3377325, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

21. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 7397398-7397426, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggcttcgccccgagccggggg	Protospacer
*** *************************

22. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 9965535-9965563, mismatch: 1, identity: 0.966

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccgggccggggg	Protospacer
********************.********

23. spacer 26.7|8280169|18|NC_017186|CRT matches to position: 5200267-5200284, mismatch: 1, identity: 0.944

ccagctcggcccagctcg	CRISPR spacer
ccagctcggcccagcgcg	Protospacer
*************** **

24. spacer 26.8|8280214|18|NC_017186|CRT matches to position: 8307405-8307422, mismatch: 1, identity: 0.944

tcggctcggctcggctcg	CRISPR spacer
tcggctcagctcggctcg	Protospacer
*******.**********

25. spacer 26.9|8280259|18|NC_017186|CRT matches to position: 8307405-8307422, mismatch: 1, identity: 0.944

tcggctcggctcggctcg	CRISPR spacer
tcggctcagctcggctcg	Protospacer
*******.**********

26. spacer 1.1|70655|26|NC_017186|CRISPRCasFinder matches to position: 1133588-1133613, mismatch: 2, identity: 0.923

cggctcggggcgaagccctggaggtc	CRISPR spacer
cggctcggggcgaagccccggatgtc	Protospacer
******************.*** ***

27. spacer 1.1|70655|26|NC_017186|CRISPRCasFinder matches to position: 7397402-7397427, mismatch: 2, identity: 0.923

cggctcggggcgaagccctggaggtc	CRISPR spacer
cggctcggggcgaagccccggatgtc	Protospacer
******************.*** ***

28. spacer 1.1|70655|26|NC_017186|CRISPRCasFinder matches to position: 2681721-2681746, mismatch: 2, identity: 0.923

cggctcggggcgaagccctggaggtc	CRISPR spacer
cggcccggggcgaagccccggaggtc	Protospacer
****.*************.*******

29. spacer 1.1|70655|26|NC_017186|CRISPRCasFinder matches to position: 8888544-8888569, mismatch: 2, identity: 0.923

cggctcggggcgaagccctggaggtc	CRISPR spacer
cggctcggggcgaagccccggatgtc	Protospacer
******************.*** ***

30. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 557286-557314, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcgtcgccccgggccggggg	Protospacer
*********** ********.********

31. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 557349-557377, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggctttgccccgggccggggg	Protospacer
*************.******.********

32. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 580730-580758, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggctccgccccgggccggggg	Protospacer
************.*******.********

33. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 824870-824898, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggctccgccccgggccggggg	Protospacer
************.*******.********

34. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 1455611-1455639, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggcttcgccccgggccggggg	Protospacer
*** ****************.********

35. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 7434897-7434925, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggcttcgccccgacccggggg	Protospacer
*** ***************** *******

36. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 7627943-7627971, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acattcggggcttcgccccgagccggggg	Protospacer
*** .************************

37. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 8429222-8429250, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggcttcgccccgggccggggg	Protospacer
*** ****************.********

38. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 8927885-8927913, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggcttcgccccgggccggggg	Protospacer
*** ****************.********

39. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 10032795-10032823, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggctccgccccgagccggggg	Protospacer
*** ********.****************

40. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 1842484-1842512, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccctgggccggggg	Protospacer
******************.*.********

41. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 2167284-2167312, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggcttcgccccgggccggggg	Protospacer
*** ****************.********

42. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 2497833-2497861, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccgaggcttcgccccgggccggggg	Protospacer
*******.************.********

43. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 2613929-2613957, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
accaccggggcttcgccccgggccggggg	Protospacer
** *****************.********

44. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 2817060-2817088, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggctccgccccgggccggggg	Protospacer
************.*******.********

45. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 3537721-3537749, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggcttcgccccaggccggggg	Protospacer
*******************..********

46. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 5078196-5078224, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggctccgccccgggccggggg	Protospacer
************.*******.********

47. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 5780701-5780729, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggggctccgccccgggccggggg	Protospacer
************.*******.********

48. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 7298534-7298562, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acatccggggcttcgccccgggccggggg	Protospacer
*** ****************.********

49. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to position: 8652672-8652700, mismatch: 2, identity: 0.931

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccggagcttcgccccgggccggggg	Protospacer
********.***********.********

50. spacer 26.4|8280011|19|NC_017186|CRT matches to position: 2047133-2047151, mismatch: 2, identity: 0.895

ccggctcgccctgggctgg	CRISPR spacer
ccggctcgccctcggcggg	Protospacer
************ *** **

51. spacer 26.4|8280011|19|NC_017186|CRT matches to position: 4313863-4313881, mismatch: 2, identity: 0.895

ccggctcgccctgggctgg	CRISPR spacer
ccggctcgccatcggctgg	Protospacer
********** * ******

52. spacer 26.4|8280011|19|NC_017186|CRT matches to position: 5071229-5071247, mismatch: 2, identity: 0.895

ccggctcgccctgggctgg	CRISPR spacer
ccggctcgacctgggcggg	Protospacer
******** ******* **

53. spacer 26.4|8280011|19|NC_017186|CRT matches to position: 7612726-7612744, mismatch: 2, identity: 0.895

ccggctcgccctgggctgg	CRISPR spacer
ccggctcgcctcgggctgg	Protospacer
**********..*******

54. spacer 26.6|8280108|34|NC_017186|CRT matches to position: 8280273-8280306, mismatch: 2, identity: 0.941

ctgggttcggctcggctcggctcggctcggctcg	CRISPR spacer
ctcggctcggctcggctcggctcggctcggctcg	Protospacer
** **.****************************

55. spacer 26.6|8280108|34|NC_017186|CRT matches to position: 8280278-8280311, mismatch: 2, identity: 0.941

ctgggttcggctcggctcggctcggctcggctcg	CRISPR spacer
ctcggctcggctcggctcggctcggctcggctcg	Protospacer
** **.****************************

56. spacer 26.6|8280108|34|NC_017186|CRT matches to position: 8280283-8280316, mismatch: 2, identity: 0.941

ctgggttcggctcggctcggctcggctcggctcg	CRISPR spacer
ctcggctcggctcggctcggctcggctcggctcg	Protospacer
** **.****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017186_1 1.1|70655|26|NC_017186|CRISPRCasFinder 70655-70680 26 MN693271 Marine virus AFVG_25M119, complete genome 12142-12167 3 0.885
NC_017186_5 5.2|1356941|25|NC_017186|CRT 1356941-1356965 25 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 101129-101153 3 0.88
NC_017186_5 5.3|1356984|24|NC_017186|CRT 1356984-1357007 24 MH825706 Streptomyces phage Microdon, complete genome 33975-33998 3 0.875
NC_017186_5 5.3|1356984|24|NC_017186|CRT 1356984-1357007 24 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 514325-514348 3 0.875
NC_017186_5 5.2|1356941|25|NC_017186|CRT 1356941-1356965 25 MN035621 Leviviridae sp. isolate H1_Bulk_29_scaffold_509 RNA-dependent RNA polymerase (H1Bulk29509_000001) gene, partial cds; hypothetical protein (H1Bulk29509_000002) and hypothetical protein (H1Bulk29509_000003) genes, complete cds; and hypothetical protein (H1Bulk29509_000004) gene, partial cds 892-916 4 0.84
NC_017186_5 5.2|1356941|25|NC_017186|CRT 1356941-1356965 25 MN034612 Leviviridae sp. isolate H4_Bulk_48_scaffold_2658 sequence 563-587 4 0.84
NC_017186_5 5.2|1356941|25|NC_017186|CRT 1356941-1356965 25 MN034028 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_1266 hypothetical protein (H2RhizoLitter491266_000001) gene, partial cds; hypothetical protein (H2RhizoLitter491266_000002) and hypothetical protein (H2RhizoLitter491266_000003) genes, complete cds; and RNA-dependent RNA polymerase (H2RhizoLitter491266_000004) gene, partial cds 2708-2732 4 0.84
NC_017186_8 8.13|2088351|27|NC_017186|PILER-CR 2088351-2088377 27 NZ_KY362371 Pseudomonas syringae pv. syringae strain UMAF1029 plasmid pPs1029, complete sequence 13399-13425 4 0.852
NC_017186_8 8.13|2088351|27|NC_017186|PILER-CR 2088351-2088377 27 NZ_KY362370 Pseudomonas syringae pv. syringae strain UMAF0158 plasmid pPs0158, complete sequence 13392-13418 4 0.852
NC_017186_8 8.13|2088351|27|NC_017186|PILER-CR 2088351-2088377 27 NZ_CP005971 Pseudomonas syringae UMAF0158 plasmid unnamed, complete sequence 40588-40614 4 0.852
NC_017186_8 8.14|2088417|26|NC_017186|PILER-CR 2088417-2088442 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1912353-1912378 4 0.846
NC_017186_8 8.14|2088417|26|NC_017186|PILER-CR 2088417-2088442 26 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 702367-702392 4 0.846
NC_017186_8 8.14|2088417|26|NC_017186|PILER-CR 2088417-2088442 26 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 366054-366079 4 0.846
NC_017186_5 5.3|1356984|24|NC_017186|CRT 1356984-1357007 24 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 881770-881793 5 0.792
NC_017186_8 8.14|2088417|26|NC_017186|PILER-CR 2088417-2088442 26 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 466884-466909 5 0.808
NC_017186_8 8.14|2088417|26|NC_017186|PILER-CR 2088417-2088442 26 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 98292-98317 5 0.808
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP041018 Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence 125922-125950 5 0.828
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 655593-655621 5 0.828
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 467139-467167 5 0.828
NC_017186_20 20.4|6438632|32|NC_017186|CRISPRCasFinder 6438632-6438663 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 776199-776230 5 0.844
NC_017186_20 20.4|6438632|32|NC_017186|CRISPRCasFinder 6438632-6438663 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 377968-377999 5 0.844
NC_017186_20 20.4|6438632|32|NC_017186|CRISPRCasFinder 6438632-6438663 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 35225-35256 5 0.844
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 223493-223521 5 0.828
NC_017186_3 3.1|763149|30|NC_017186|CRISPRCasFinder 763149-763178 30 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 38222-38251 6 0.8
NC_017186_3 3.1|763149|30|NC_017186|CRISPRCasFinder 763149-763178 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1724128-1724157 6 0.8
NC_017186_8 8.14|2088417|26|NC_017186|PILER-CR 2088417-2088442 26 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 229992-230017 6 0.769
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP047174 Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence 14816-14844 6 0.793
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 374920-374949 6 0.8
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 366237-366266 6 0.8
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 NZ_CP045331 Labrenzia sp. THAF191b plasmid pTHAF191b_c, complete sequence 37880-37909 6 0.8
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 NZ_CP045347 Labrenzia sp. THAF187b plasmid pTHAF187b_c, complete sequence 15563-15592 6 0.8
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 NZ_CP045336 Labrenzia sp. THAF191a plasmid pTHAF191a_c, complete sequence 86755-86784 6 0.8
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 NZ_CP045382 Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence 16356-16385 6 0.8
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 828351-828379 6 0.793
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 817101-817129 6 0.793
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 803642-803670 6 0.793
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 795709-795737 6 0.793
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 816286-816314 6 0.793
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 810037-810065 6 0.793
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 828351-828379 6 0.793
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 795709-795737 6 0.793
NC_017186_19 19.6|6437107|30|NC_017186|CRISPRCasFinder 6437107-6437136 30 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 29558-29587 6 0.8
NC_017186_19 19.7|6437166|32|NC_017186|CRISPRCasFinder 6437166-6437197 32 MH834621 Arthrobacter phage Nandita, complete genome 39366-39397 6 0.812
NC_017186_19 19.7|6437166|32|NC_017186|CRISPRCasFinder 6437166-6437197 32 MH834627 Arthrobacter phage Ryan, complete genome 39919-39950 6 0.812
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 164897-164928 6 0.812
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 112956-112987 6 0.812
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 153754-153785 6 0.812
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 806477-806508 6 0.812
NC_017186_21 21.4|6441628|32|NC_017186|CRISPRCasFinder 6441628-6441659 32 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 228115-228146 6 0.812
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 MH576973 Mycobacterium phage Bromden, complete genome 33544-33575 6 0.812
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 42490-42518 6 0.793
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NZ_CP026653 Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence 36000-36028 6 0.793
NC_017186_2 2.1|301050|29|NC_017186|CRISPRCasFinder 301050-301078 29 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 79162-79190 7 0.759
NC_017186_3 3.1|763149|30|NC_017186|CRISPRCasFinder 763149-763178 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2568889-2568918 7 0.767
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP011600 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-215, complete sequence 23957-23985 7 0.759
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_AP018757 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_1, complete sequence 180725-180753 7 0.759
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1448785-1448813 7 0.759
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 543079-543107 7 0.759
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 168724-168752 7 0.759
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 979876-979904 7 0.759
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 MH632120 Mycobacterium phage Thonko, complete genome 40740-40768 7 0.759
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 AP018479 Mycobacterium phage GS4E DNA, complete sequence 31302-31331 7 0.767
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 MT310877 Mycobacterium phage VA6, complete genome 31169-31198 7 0.767
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 MT658804 Mycobacterium phage BengiVuitton, complete genome 31277-31306 7 0.767
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 NC_023597 Mycobacterium phage 20ES, complete genome 31315-31344 7 0.767
NC_017186_19 19.1|6436809|30|NC_017186|CRISPRCasFinder 6436809-6436838 30 MT310886 Mycobacterium phage AN3, complete genome 31695-31724 7 0.767
NC_017186_19 19.3|6436928|32|NC_017186|CRISPRCasFinder 6436928-6436959 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 305125-305156 7 0.781
NC_017186_19 19.4|6436989|29|NC_017186|CRISPRCasFinder 6436989-6437017 29 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 262957-262985 7 0.759
NC_017186_19 19.10|6437349|32|NC_017186|CRISPRCasFinder 6437349-6437380 32 KY555145 Caulobacter phage Ccr29, complete genome 183233-183264 7 0.781
NC_017186_19 19.10|6437349|32|NC_017186|CRISPRCasFinder 6437349-6437380 32 KY555143 Caulobacter phage Ccr2, complete genome 176380-176411 7 0.781
NC_017186_19 19.10|6437349|32|NC_017186|CRISPRCasFinder 6437349-6437380 32 KY555142 Caulobacter phage Ccr10, complete genome 175905-175936 7 0.781
NC_017186_20 20.3|6438753|33|NC_017186|PILER-CR,CRT 6438753-6438785 33 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 164897-164929 7 0.788
NC_017186_20 20.3|6438753|33|NC_017186|PILER-CR,CRT 6438753-6438785 33 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 112955-112987 7 0.788
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 120777-120808 7 0.781
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NZ_CP028350 Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence 384430-384461 7 0.781
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NC_014258 Pantoea vagans C9-1 plasmid pPag3, complete sequence 187504-187535 7 0.781
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 351464-351495 7 0.781
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 107286-107317 7 0.781
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 66006-66037 7 0.781
NC_017186_21 21.2|6441506|32|NC_017186|CRISPRCasFinder 6441506-6441537 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 155273-155304 7 0.781
NC_017186_21 21.2|6441506|32|NC_017186|CRISPRCasFinder 6441506-6441537 32 NC_008441 Streptomyces laurentii plasmid pSLS DNA, complete sequence 2186-2217 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MK919470 Gordonia phage Mellie, complete genome 14250-14281 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MN234179 Gordonia phage Pipp, complete genome 14483-14514 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MN010762 Gordonia phage MintFen, complete genome 14489-14520 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MT553336 Gordonia phage BlingBling, complete genome 14489-14520 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_031265 Gordonia phage Guacamole, complete genome 14493-14524 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MF919521 Gordonia phage Lysidious, complete genome 15013-15044 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MN369740 Gordonia phage Delian, complete genome 14513-14544 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MK801724 Gordonia phage PhrostedPhlake, complete genome 14865-14896 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MH576969 Gordonia phage Zarbodnamra, complete genome 14488-14519 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MK864263 Gordonia phage Melba, complete genome 14489-14520 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MN062704 Gordonia phage JuJu, complete genome 14417-14448 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MK878896 Gordonia phage Begonia, complete genome 15021-15052 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MK501729 Gordonia phage Walrus, complete genome 14712-14743 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MT723942 Gordonia phage Archis, complete genome 14700-14731 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MK967389 Gordonia phage JasperJr, complete genome 14493-14524 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MK501730 Gordonia phage Barco, complete genome 14489-14520 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 KU963251 Gordonia phage UmaThurman, complete genome 14617-14648 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 KX557274 Gordonia phage CaptainKirk2, complete genome 14513-14544 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MT723936 Gordonia phage Hitter, complete genome 14489-14520 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_031237 Gordonia phage Obliviate, complete genome 14279-14310 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_030921 Gordonia phage Utz, complete genome 14484-14515 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MN585963 Gordonia phage Wocket, complete genome 14730-14761 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1639653-1639684 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MK977705 Gordonia Phage Mollymur, complete genome 26365-26396 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP023450 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence 112681-112712 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 40657-40688 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_015595 Sphingobium chlorophenolicum L-1 plasmid pSPHCH01, complete sequence 94934-94965 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP018225 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence 133327-133358 7 0.781
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP013265 Sphingobium baderi strain DE-13 plasmid pDE1, complete sequence 147979-148010 7 0.781
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 89759-89790 7 0.781
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 118065-118096 7 0.781
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 68376-68407 7 0.781
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 217471-217502 7 0.781
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 153753-153785 7 0.788
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 806477-806509 7 0.788
NC_017186_21 21.8|6441505|33|NC_017186|CRT 6441505-6441537 33 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 155273-155305 7 0.788
NC_017186_21 21.8|6441505|33|NC_017186|CRT 6441505-6441537 33 NC_008441 Streptomyces laurentii plasmid pSLS DNA, complete sequence 2186-2218 7 0.788
NC_017186_21 21.10|6441627|33|NC_017186|CRT 6441627-6441659 33 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 228115-228147 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MK919470 Gordonia phage Mellie, complete genome 14249-14281 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MN234179 Gordonia phage Pipp, complete genome 14482-14514 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MN010762 Gordonia phage MintFen, complete genome 14488-14520 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MT553336 Gordonia phage BlingBling, complete genome 14488-14520 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 NC_031265 Gordonia phage Guacamole, complete genome 14492-14524 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MF919521 Gordonia phage Lysidious, complete genome 15012-15044 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MN369740 Gordonia phage Delian, complete genome 14512-14544 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MK801724 Gordonia phage PhrostedPhlake, complete genome 14864-14896 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MH576969 Gordonia phage Zarbodnamra, complete genome 14487-14519 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MK864263 Gordonia phage Melba, complete genome 14488-14520 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MN062704 Gordonia phage JuJu, complete genome 14416-14448 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MK878896 Gordonia phage Begonia, complete genome 15020-15052 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MK501729 Gordonia phage Walrus, complete genome 14711-14743 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MT723942 Gordonia phage Archis, complete genome 14699-14731 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MK967389 Gordonia phage JasperJr, complete genome 14492-14524 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MK501730 Gordonia phage Barco, complete genome 14488-14520 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 KU963251 Gordonia phage UmaThurman, complete genome 14616-14648 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 KX557274 Gordonia phage CaptainKirk2, complete genome 14512-14544 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MT723936 Gordonia phage Hitter, complete genome 14488-14520 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 NC_031237 Gordonia phage Obliviate, complete genome 14278-14310 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 NC_030921 Gordonia phage Utz, complete genome 14483-14515 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MN585963 Gordonia phage Wocket, complete genome 14729-14761 7 0.788
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MK977705 Gordonia Phage Mollymur, complete genome 26364-26396 7 0.788
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 118064-118096 7 0.788
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 68376-68408 7 0.788
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 760058-760089 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 945478-945509 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 745525-745556 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 341963-341994 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 753771-753802 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 743276-743307 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 547395-547426 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1411474-1411505 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1097748-1097779 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1005014-1005045 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 664273-664304 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 667148-667179 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 183730-183761 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1532250-1532281 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 264021-264052 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 904879-904910 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 766592-766623 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1116649-1116680 7 0.781
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 891013-891044 7 0.781
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 400767-400798 7 0.781
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 648115-648146 7 0.781
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 116395-116426 7 0.781
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 284959-284990 7 0.781
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 125872-125900 7 0.759
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NC_011962 Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence 80702-80730 7 0.759
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 48805-48833 7 0.759
NC_017186_25 25.1|6961022|29|NC_017186|CRISPRCasFinder 6961022-6961050 29 NZ_CP020041 Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence 185933-185961 7 0.759
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1548757-1548785 8 0.724
NC_017186_19 19.2|6436868|31|NC_017186|CRISPRCasFinder 6436868-6436898 31 NZ_CP012899 Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence 62996-63026 8 0.742
NC_017186_19 19.2|6436868|31|NC_017186|CRISPRCasFinder 6436868-6436898 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 99375-99405 8 0.742
NC_017186_19 19.5|6437047|31|NC_017186|CRISPRCasFinder 6437047-6437077 31 NZ_CP013071 Sphingobium indicum B90A plasmid pSRL1, complete sequence 67357-67387 8 0.742
NC_017186_19 19.5|6437047|31|NC_017186|CRISPRCasFinder 6437047-6437077 31 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1439111-1439141 8 0.742
NC_017186_19 19.10|6437349|32|NC_017186|CRISPRCasFinder 6437349-6437380 32 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 254232-254263 8 0.75
NC_017186_19 19.11|6437410|32|NC_017186|CRISPRCasFinder 6437410-6437441 32 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 19765-19796 8 0.75
NC_017186_19 19.11|6437410|32|NC_017186|CRISPRCasFinder 6437410-6437441 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 247073-247104 8 0.75
NC_017186_19 19.11|6437410|32|NC_017186|CRISPRCasFinder 6437410-6437441 32 NZ_CP045303 Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence 154456-154487 8 0.75
NC_017186_20 20.3|6438753|33|NC_017186|PILER-CR,CRT 6438753-6438785 33 AF069529 Bacteriophage HK97, complete genome 18138-18170 8 0.758
NC_017186_20 20.3|6438753|33|NC_017186|PILER-CR,CRT 6438753-6438785 33 NC_002167 Enterobacteria phage HK97, complete genome 18138-18170 8 0.758
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 AF069529 Bacteriophage HK97, complete genome 18138-18169 8 0.75
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NC_002167 Enterobacteria phage HK97, complete genome 18138-18169 8 0.75
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1930153-1930184 8 0.75
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1697151-1697182 8 0.75
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NZ_CP040824 Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence 79626-79657 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MK494119 Mycobacterium Phage Niklas, complete genome 30633-30664 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MK310138 Mycobacterium phage Shaobing, complete genome 30630-30661 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MF185722 Mycobacterium phage Peanam, complete genome 30630-30661 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1451013-1451044 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 150957-150988 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP048634 Rhizobium oryzihabitans strain M15 plasmid p2, complete sequence 12138-12169 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP048638 Rhizobium oryzihabitans strain M15 plasmid p6, complete sequence 48929-48960 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP048639 Rhizobium oryzihabitans strain M15 plasmid p7, complete sequence 12902-12933 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1473723-1473754 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MN096355 Mycobacterium phage Purky, complete genome 5817-5848 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MK016499 Mycobacterium phage Mangethe, complete genome 5845-5876 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MK919480 Mycobacterium phage Techage, complete genome 5848-5879 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MF919492 Mycobacterium phage Arib1, complete genome 5845-5876 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NC_041969 Mycobacterium phage Jebeks, complete genome 5845-5876 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NC_023552 Mycobacterium phage Donovan, complete genome 5845-5876 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MN693323 Marine virus AFVG_25M87, complete genome 11504-11535 8 0.75
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MF472894 Mycobacterium phage Majeke, complete genome 5845-5876 8 0.75
NC_017186_21 21.2|6441506|32|NC_017186|CRISPRCasFinder 6441506-6441537 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1606082-1606113 8 0.75
NC_017186_21 21.2|6441506|32|NC_017186|CRISPRCasFinder 6441506-6441537 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 207179-207210 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_031230 Gordonia phage Yvonnetastic, complete genome 28505-28536 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MH020241 Gordonia phage Fenry, complete genome 14259-14290 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 MH153808 Gordonia phage Petra, complete genome 14890-14921 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 KX557275 Gordonia phage CarolAnn, complete genome 14516-14547 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP022747 Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence 180946-180977 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_016165 Rhodobacter phage RcapMu, complete genome 3892-3923 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 58357-58388 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 52037-52068 8 0.75
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP048608 Pseudomonas fluorescens strain DR133 plasmid unnamed, complete sequence 17127-17158 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 81984-82015 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MN657146 Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence 27541-27572 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 148232-148263 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 14360-14391 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 585330-585361 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 KY087992 Mycobacterium phage Mitti, complete genome 54562-54593 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 7760-7791 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 7320-7351 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 94213-94244 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 9625-9656 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1163829-1163860 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1020971-1021002 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 970432-970463 8 0.75
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP021084 Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence 112455-112486 8 0.75
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 MK494119 Mycobacterium Phage Niklas, complete genome 30633-30665 8 0.758
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 MK310138 Mycobacterium phage Shaobing, complete genome 30630-30662 8 0.758
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 MF185722 Mycobacterium phage Peanam, complete genome 30630-30662 8 0.758
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 MN693323 Marine virus AFVG_25M87, complete genome 11504-11536 8 0.758
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1639653-1639685 8 0.758
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 NC_031230 Gordonia phage Yvonnetastic, complete genome 28504-28536 8 0.758
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MH020241 Gordonia phage Fenry, complete genome 14258-14290 8 0.758
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 MH153808 Gordonia phage Petra, complete genome 14889-14921 8 0.758
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 KX557275 Gordonia phage CarolAnn, complete genome 14515-14547 8 0.758
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 MN657146 Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence 27540-27572 8 0.758
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 89758-89790 8 0.758
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 585329-585361 8 0.758
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 7760-7792 8 0.758
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 7320-7352 8 0.758
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 94213-94245 8 0.758
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 9624-9656 8 0.758
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 217471-217503 8 0.758
NC_017186_22 22.1|6441980|32|NC_017186|CRISPRCasFinder 6441980-6442011 32 NZ_CP053712 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence 15514-15545 8 0.75
NC_017186_22 22.1|6441980|32|NC_017186|CRISPRCasFinder 6441980-6442011 32 NZ_CP014581 Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence 50178-50209 8 0.75
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 309152-309183 8 0.75
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 480167-480198 8 0.75
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 1019226-1019257 8 0.75
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP029363 Streptomyces globisporus strain TFH56 plasmid pTFSG2, complete sequence 21050-21081 8 0.75
NC_017186_26 26.6|8280108|34|NC_017186|CRT 8280108-8280141 34 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 300744-300777 8 0.765
NC_017186_26 26.6|8280108|34|NC_017186|CRT 8280108-8280141 34 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 707886-707919 8 0.765
NC_017186_16 16.1|5356410|34|NC_017186|CRISPRCasFinder 5356410-5356443 34 NZ_CP040823 Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence 72540-72573 9 0.735
NC_017186_19 19.2|6436868|31|NC_017186|CRISPRCasFinder 6436868-6436898 31 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 424273-424303 9 0.71
NC_017186_19 19.3|6436928|32|NC_017186|CRISPRCasFinder 6436928-6436959 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 304170-304201 9 0.719
NC_017186_19 19.3|6436928|32|NC_017186|CRISPRCasFinder 6436928-6436959 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 211010-211041 9 0.719
NC_017186_19 19.3|6436928|32|NC_017186|CRISPRCasFinder 6436928-6436959 32 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 321813-321844 9 0.719
NC_017186_19 19.6|6437107|30|NC_017186|CRISPRCasFinder 6437107-6437136 30 MN317029 Aeromonas phage vB_AhyS-A18P4, complete genome 52663-52692 9 0.7
NC_017186_19 19.7|6437166|32|NC_017186|CRISPRCasFinder 6437166-6437197 32 NZ_CP042825 Rhizobium sp. WL3 plasmid unnamed2, complete sequence 275530-275561 9 0.719
NC_017186_19 19.8|6437227|32|NC_017186|CRISPRCasFinder 6437227-6437258 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1419193-1419224 9 0.719
NC_017186_19 19.8|6437227|32|NC_017186|CRISPRCasFinder 6437227-6437258 32 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 12157-12188 9 0.719
NC_017186_19 19.10|6437349|32|NC_017186|CRISPRCasFinder 6437349-6437380 32 MT889391 Mycobacterium phage MiniMac, complete genome 41968-41999 9 0.719
NC_017186_19 19.11|6437410|32|NC_017186|CRISPRCasFinder 6437410-6437441 32 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 524746-524777 9 0.719
NC_017186_19 19.11|6437410|32|NC_017186|CRISPRCasFinder 6437410-6437441 32 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 33272-33303 9 0.719
NC_017186_19 19.11|6437410|32|NC_017186|CRISPRCasFinder 6437410-6437441 32 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 29244-29275 9 0.719
NC_017186_19 19.15|6437657|32|NC_017186|CRISPRCasFinder 6437657-6437688 32 NC_022877 Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence 50725-50756 9 0.719
NC_017186_19 19.15|6437657|32|NC_017186|CRISPRCasFinder 6437657-6437688 32 NC_022877 Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence 51663-51694 9 0.719
NC_017186_20 20.3|6438753|33|NC_017186|PILER-CR,CRT 6438753-6438785 33 MH067969 Arthrobacter sp. strain ANT_H2 plasmid pA2H2, complete sequence 22225-22257 9 0.727
NC_017186_20 20.5|6438693|32|NC_017186|CRISPRCasFinder 6438693-6438724 32 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 203996-204027 9 0.719
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 MH067969 Arthrobacter sp. strain ANT_H2 plasmid pA2H2, complete sequence 22225-22256 9 0.719
NC_017186_20 20.6|6438754|32|NC_017186|CRISPRCasFinder 6438754-6438785 32 NZ_CP013125 Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence 181278-181309 9 0.719
NC_017186_20 20.7|6438815|32|NC_017186|CRISPRCasFinder 6438815-6438846 32 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 33807-33838 9 0.719
NC_017186_20 20.7|6438815|32|NC_017186|CRISPRCasFinder 6438815-6438846 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1345895-1345926 9 0.719
NC_017186_20 20.7|6438815|32|NC_017186|CRISPRCasFinder 6438815-6438846 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1164628-1164659 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP028972 Aminobacter sp. MSH1 plasmid pUSP4, complete sequence 11689-11720 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1840739-1840770 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 751241-751272 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 801919-801950 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 873344-873375 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1463567-1463598 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1068132-1068163 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 629182-629213 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 790174-790205 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 235840-235871 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 877690-877721 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1200943-1200974 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 3407-3438 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1600056-1600087 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 805407-805438 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 704739-704770 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 804008-804039 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 991106-991137 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 278317-278348 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 801212-801243 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1184077-1184108 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 877679-877710 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 576821-576852 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 991073-991104 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 991074-991105 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 771812-771843 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 991087-991118 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 771835-771866 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 991087-991118 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1160220-1160251 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 991076-991107 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 771835-771866 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 806553-806584 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 787246-787277 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 841480-841511 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 878362-878393 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 991076-991107 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 771835-771866 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 926320-926351 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 991072-991103 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 771835-771866 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 771835-771866 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 991087-991118 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1187026-1187057 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 991098-991129 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 991076-991107 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1187026-1187057 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1225918-1225949 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1445929-1445960 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 716183-716214 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 892227-892258 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1537042-1537073 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1221090-1221121 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1822606-1822637 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 867194-867225 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 911920-911951 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 867194-867225 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 911920-911951 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 867194-867225 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 867198-867229 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 911920-911951 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 911920-911951 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 911920-911951 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1165602-1165633 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1273240-1273271 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 867194-867225 9 0.719
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 911922-911953 9 0.719
NC_017186_21 21.2|6441506|32|NC_017186|CRISPRCasFinder 6441506-6441537 32 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 421416-421447 9 0.719
NC_017186_21 21.2|6441506|32|NC_017186|CRISPRCasFinder 6441506-6441537 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 331074-331105 9 0.719
NC_017186_21 21.3|6441567|32|NC_017186|CRISPRCasFinder 6441567-6441598 32 MN855771 Siphoviridae sp. isolate 189, complete genome 24967-24998 9 0.719
NC_017186_21 21.3|6441567|32|NC_017186|CRISPRCasFinder 6441567-6441598 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 230890-230921 9 0.719
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_010721 Methylorubrum populi BJ001 plasmid pMPOP02, complete sequence 20571-20602 9 0.719
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 93158-93189 9 0.719
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 402258-402289 9 0.719
NC_017186_21 21.5|6441689|32|NC_017186|CRISPRCasFinder 6441689-6441720 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 844108-844139 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 574370-574401 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 24787-24818 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 474164-474195 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 198319-198350 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MK224497 Mycobacterium phage Henu3, complete genome 3365-3396 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 KJ944841 Mycobacterium phage Cheetobro, complete genome 53842-53873 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MN945904 Mycobacterium phage Eponine, complete genome 55268-55299 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 AP018469 Mycobacterium phage Y10 DNA, complete genome, note: sample1 54590-54621 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MF140402 Mycobacterium phage Chancellor, complete genome 54288-54319 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 AP018470 Mycobacterium phage Y2 DNA, complete genome 54590-54621 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 KT361920 Mycobacterium phage Slarp, complete genome 53845-53876 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MT310882 Mycobacterium phage JF1, complete genome 54590-54621 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 AP018471 Mycobacterium phage Y10 DNA, complete genome, note: sample2 54590-54621 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MH051258 Mycobacterium phage SamScheppers, complete genome 54942-54973 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MF140435 Mycobacterium phage Wintermute, complete genome 54646-54677 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_027365 Mycobacterium virus Fionnbarth, complete genome 54666-54697 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 197281-197312 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_047992 Microbacterium phage Zeta1847, complete genome 33287-33318 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 55093-55124 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 426291-426322 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 227938-227969 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP050090 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b4, complete sequence 111522-111553 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MK433264 Gordonia phage Tiamoceli, complete genome 53878-53909 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MT952843 Gordonia phage Twonlo, complete genome 54579-54610 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 MK977704 Gordonia Terrae phage RoadKill, complete genome 53988-54019 9 0.719
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 KR053200 Gordonia phage GTE6, complete genome 55232-55263 9 0.719
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1451013-1451045 9 0.727
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 NC_016165 Rhodobacter phage RcapMu, complete genome 3892-3924 9 0.727
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 58357-58389 9 0.727
NC_017186_21 21.11|6441688|33|NC_017186|CRT 6441688-6441720 33 NZ_CP022747 Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence 180945-180977 9 0.727
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 14360-14392 9 0.727
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1163828-1163860 9 0.727
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1020970-1021002 9 0.727
NC_017186_22 22.1|6441980|32|NC_017186|CRISPRCasFinder 6441980-6442011 32 NZ_CP014169 Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence 302055-302086 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 58941-58972 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 378844-378875 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 646255-646286 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 646255-646286 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5121083-5121114 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 659921-659952 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 210763-210794 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 382552-382583 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 451127-451158 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 514146-514177 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 431335-431366 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 688028-688059 9 0.719
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_LR594676 Variovorax sp. PBS-H4 plasmid 2 111008-111039 9 0.719
NC_017186_26 26.6|8280108|34|NC_017186|CRT 8280108-8280141 34 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 239822-239855 9 0.735
NC_017186_26 26.6|8280108|34|NC_017186|CRT 8280108-8280141 34 MN693688 Marine virus AFVG_250M167, complete genome 32043-32076 9 0.735
NC_017186_19 19.3|6436928|32|NC_017186|CRISPRCasFinder 6436928-6436959 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 415392-415423 10 0.688
NC_017186_19 19.8|6437227|32|NC_017186|CRISPRCasFinder 6437227-6437258 32 NZ_CP022370 Bosea sp. AS-1 plasmid unnamed1, complete sequence 5648-5679 10 0.688
NC_017186_19 19.20|6436988|34|NC_017186|CRT 6436988-6437021 34 NZ_CP020812 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed3, complete sequence 60762-60795 10 0.706
NC_017186_19 19.23|6437165|37|NC_017186|CRT 6437165-6437201 37 MH834621 Arthrobacter phage Nandita, complete genome 39362-39398 10 0.73
NC_017186_19 19.23|6437165|37|NC_017186|CRT 6437165-6437201 37 MH834627 Arthrobacter phage Ryan, complete genome 39915-39951 10 0.73
NC_017186_20 20.5|6438693|32|NC_017186|CRISPRCasFinder 6438693-6438724 32 NZ_CP017304 Rhodococcus sp. YL-1 plasmid pYLL2 sequence 28438-28469 10 0.688
NC_017186_20 20.5|6438693|32|NC_017186|CRISPRCasFinder 6438693-6438724 32 NC_005073 Rhodococcus erythropolis linear plasmid pBD2, complete sequence 28054-28085 10 0.688
NC_017186_20 20.8|6438814|33|NC_017186|CRT 6438814-6438846 33 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 33807-33839 10 0.697
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 KY945355 Mycobacterium phage Shandong1, complete genome 30384-30415 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP031117 Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed2, complete sequence 3531-3562 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 130591-130622 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1503231-1503262 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 315701-315732 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 859068-859099 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 213567-213598 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 192124-192155 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 442348-442379 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 CP016643 Mycobacterium sp. djl-10 plasmid djl-10_3, complete sequence 13154-13185 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 1096817-1096848 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 183068-183099 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 203845-203876 10 0.688
NC_017186_21 21.4|6441628|32|NC_017186|CRISPRCasFinder 6441628-6441659 32 CP000663 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 157233-157264 10 0.688
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 285326-285357 10 0.688
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 259683-259714 10 0.688
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 615987-616018 10 0.688
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 137646-137677 10 0.688
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 3407-3439 10 0.697
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1600056-1600088 10 0.697
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 576820-576852 10 0.697
NC_017186_21 21.7|6441444|33|NC_017186|CRT 6441444-6441476 33 KY945355 Mycobacterium phage Shandong1, complete genome 30384-30416 10 0.697
NC_017186_21 21.9|6441566|33|NC_017186|CRT 6441566-6441598 33 MN855771 Siphoviridae sp. isolate 189, complete genome 24966-24998 10 0.697
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 198318-198350 10 0.697
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 197281-197313 10 0.697
NC_017186_21 21.12|6441749|33|NC_017186|CRT 6441749-6441781 33 NC_047992 Microbacterium phage Zeta1847, complete genome 33287-33319 10 0.697
NC_017186_22 22.1|6441980|32|NC_017186|CRISPRCasFinder 6441980-6442011 32 MH992209 Apis mellifera associated microvirus 17 isolate INH_SP_257, complete genome 4144-4175 10 0.688
NC_017186_22 22.2|6442041|32|NC_017186|CRISPRCasFinder 6442041-6442072 32 NZ_CP032827 Sphingomonas sp. YZ-8 plasmid unnamed2, complete sequence 21342-21373 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 253282-253313 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 8076-8107 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 619909-619940 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 4076-4107 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 31316-31347 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 128521-128552 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 31316-31347 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 MN062714 Microbacterium Phage DirtyBubble, complete genome 24063-24094 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 MT024860 Microbacterium phage Stromboli, complete genome 24433-24464 10 0.688
NC_017186_22 22.4|6442162|32|NC_017186|CRISPRCasFinder 6442162-6442193 32 NC_016435 Gordonia phage GRU1, complete genome 37874-37905 10 0.688
NC_017186_21 21.1|6441445|32|NC_017186|CRISPRCasFinder 6441445-6441476 32 MK305889 Gordonia phage Mutzi, complete genome 38735-38766 11 0.656
NC_017186_21 21.2|6441506|32|NC_017186|CRISPRCasFinder 6441506-6441537 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 410572-410603 11 0.656
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 313454-313485 11 0.656
NC_017186_21 21.6|6441750|32|NC_017186|CRISPRCasFinder 6441750-6441781 32 KX815338 Streptomyces phage Joe, complete genome 37471-37502 11 0.656
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 301211-301239 12 0.586
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 172212-172240 12 0.586
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 69801-69829 12 0.586
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1292917-1292945 12 0.586
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 51523-51551 12 0.586
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 84433-84461 12 0.586
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 192563-192591 12 0.586
NC_017186_10 10.1|2899133|29|NC_017186|CRISPRCasFinder 2899133-2899161 29 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 156447-156475 12 0.586

1. spacer 1.1|70655|26|NC_017186|CRISPRCasFinder matches to MN693271 (Marine virus AFVG_25M119, complete genome) position: , mismatch: 3, identity: 0.885

cggctcggggcgaagccctggaggtc	CRISPR spacer
gcgctcggggcgaagccctggcggtc	Protospacer
  ******************* ****

2. spacer 5.2|1356941|25|NC_017186|CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cgcgatgggcgagcgatgctcgata	CRISPR spacer
cgcaatgggcgagcgatgcgcgatt	Protospacer
***.*************** **** 

3. spacer 5.3|1356984|24|NC_017186|CRT matches to MH825706 (Streptomyces phage Microdon, complete genome) position: , mismatch: 3, identity: 0.875

catcgcggcgcacaacgaccggcg	CRISPR spacer
gatcgcggcgcacaaggaccggct	Protospacer
 ************** ******* 

4. spacer 5.3|1356984|24|NC_017186|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 3, identity: 0.875

catcgcggcgcacaacgaccggcg	CRISPR spacer
catcgcggcgctcaacgacctgcc	Protospacer
*********** ******** ** 

5. spacer 5.2|1356941|25|NC_017186|CRT matches to MN035621 (Leviviridae sp. isolate H1_Bulk_29_scaffold_509 RNA-dependent RNA polymerase (H1Bulk29509_000001) gene, partial cds; hypothetical protein (H1Bulk29509_000002) and hypothetical protein (H1Bulk29509_000003) genes, complete cds; and hypothetical protein (H1Bulk29509_000004) gene, partial cds) position: , mismatch: 4, identity: 0.84

cgcgatgggcgagcgatgctcgata	CRISPR spacer
cgcgaaaggcgagcgatgctcgaat	Protospacer
***** .****************  

6. spacer 5.2|1356941|25|NC_017186|CRT matches to MN034612 (Leviviridae sp. isolate H4_Bulk_48_scaffold_2658 sequence) position: , mismatch: 4, identity: 0.84

cgcgatgggcgagcgatgctcgata	CRISPR spacer
cgcgagaggcgagcgatgctcgagt	Protospacer
***** .****************  

7. spacer 5.2|1356941|25|NC_017186|CRT matches to MN034028 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_1266 hypothetical protein (H2RhizoLitter491266_000001) gene, partial cds; hypothetical protein (H2RhizoLitter491266_000002) and hypothetical protein (H2RhizoLitter491266_000003) genes, complete cds; and RNA-dependent RNA polymerase (H2RhizoLitter491266_000004) gene, partial cds) position: , mismatch: 4, identity: 0.84

cgcgatgggcgagcgatgctcgata	CRISPR spacer
cgcgaaaggcgagcgatgctcgaat	Protospacer
***** .****************  

8. spacer 8.13|2088351|27|NC_017186|PILER-CR matches to NZ_KY362371 (Pseudomonas syringae pv. syringae strain UMAF1029 plasmid pPs1029, complete sequence) position: , mismatch: 4, identity: 0.852

-tggccgtgtcccgatgttcgcccgcgc	CRISPR spacer
ggggacat-tcccgatgttcgcccgcgc	Protospacer
  ** *.* *******************

9. spacer 8.13|2088351|27|NC_017186|PILER-CR matches to NZ_KY362370 (Pseudomonas syringae pv. syringae strain UMAF0158 plasmid pPs0158, complete sequence) position: , mismatch: 4, identity: 0.852

-tggccgtgtcccgatgttcgcccgcgc	CRISPR spacer
ggggacat-tcccgatgttcgcccgcgc	Protospacer
  ** *.* *******************

10. spacer 8.13|2088351|27|NC_017186|PILER-CR matches to NZ_CP005971 (Pseudomonas syringae UMAF0158 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

-tggccgtgtcccgatgttcgcccgcgc	CRISPR spacer
ggggacat-tcccgatgttcgcccgcgc	Protospacer
  ** *.* *******************

11. spacer 8.14|2088417|26|NC_017186|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.846

ccgatgcccacccagccgaccgcgtg	CRISPR spacer
gcgatgcccaccgagccgaccgcgaa	Protospacer
 *********** *********** .

12. spacer 8.14|2088417|26|NC_017186|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.846

ccgatgcccacccagccgaccgcgtg	CRISPR spacer
tctatgccgacccagccgaccgcgag	Protospacer
.* ***** *************** *

13. spacer 8.14|2088417|26|NC_017186|PILER-CR matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 4, identity: 0.846

ccgatgcccacccagccgaccgcgtg	CRISPR spacer
gcgatgcccacccagccgaaagcggg	Protospacer
 ******************  *** *

14. spacer 5.3|1356984|24|NC_017186|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.792

catcgcggcgcacaacgaccggcg	CRISPR spacer
gatcgcggcgcacaacgacctcgc	Protospacer
 *******************    

15. spacer 8.14|2088417|26|NC_017186|PILER-CR matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 5, identity: 0.808

ccgatgcccacccagccgaccgcgtg	CRISPR spacer
gcgatggccacccagccgtccgcgcc	Protospacer
 ***** *********** *****. 

16. spacer 8.14|2088417|26|NC_017186|PILER-CR matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

ccgatgcccacccagccgaccgcgtg	CRISPR spacer
tcgatgaccagccagccgaccgcgat	Protospacer
.***** *** *************  

17. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP041018 (Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence) position: , mismatch: 5, identity: 0.828

gtccgatcgcccgggcgctcagcggtgcc-	CRISPR spacer
gagcgatcgcccgagcgctcagc-gtgcgg	Protospacer
*  **********.********* ****  

18. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.828

--gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
cggcccg--tgcccgggcgctcagcagtgcc	Protospacer
  *.***  .***************.*****

19. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 5, identity: 0.828

gtccgatcgcccgggcgctcagcggtgcc-	CRISPR spacer
gagcgatcgcccgagcgctcagc-gtgcgg	Protospacer
*  **********.********* ****  

20. spacer 20.4|6438632|32|NC_017186|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.844

-ggagcactcgcatgacgaccacggagccggcg	CRISPR spacer
tggagc-cgcgcaggacgaccacggaaccggcc	Protospacer
 ***** * **** ************.***** 

21. spacer 20.4|6438632|32|NC_017186|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.844

-ggagcactcgcatgacgaccacggagccggcg	CRISPR spacer
tggagc-cgcgcaggacgaccacggaaccggcc	Protospacer
 ***** * **** ************.***** 

22. spacer 20.4|6438632|32|NC_017186|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.844

-ggagcactcgcatgacgaccacggagccggcg	CRISPR spacer
tggagc-cgcgcaggacgaccacggaaccggcc	Protospacer
 ***** * **** ************.***** 

23. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 5, identity: 0.828

--acaaccggggcttcgccccgagccggggg	CRISPR spacer
cgacga--ggggcatcgccccgagccggcgg	Protospacer
  **.*  ***** ************** **

24. spacer 3.1|763149|30|NC_017186|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.8

gaggaggctcccgctgccgaggaggccaag	CRISPR spacer
gcggaagctcccgctgccgaggacgctccg	Protospacer
* ***.***************** **.  *

25. spacer 3.1|763149|30|NC_017186|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

gaggaggctcccgctgccgaggaggccaag	CRISPR spacer
gccgcgactcccgctgccgcggaggccgag	Protospacer
*  * *.************ *******.**

26. spacer 8.14|2088417|26|NC_017186|PILER-CR matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 6, identity: 0.769

ccgatgcccacccagccgaccgcgtg	CRISPR spacer
atcatgcccacccagccgagcgcgcc	Protospacer
 . **************** ****. 

27. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP047174 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gtccgagcgcccgggccctcagcgcgaac	Protospacer
****** ********* *******  . *

28. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gcagttacgcggatgtcgtcgtcgttgggg	Protospacer
*. **   ****.*****************

29. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gcagttacgcggatgtcgtcgtcgttgggg	Protospacer
*. **   ****.*****************

30. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to NZ_CP045331 (Labrenzia sp. THAF191b plasmid pTHAF191b_c, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gtcgtgtagcggctgtcttcgtcggccgga	Protospacer
************ **** ****** . **.

31. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to NZ_CP045347 (Labrenzia sp. THAF187b plasmid pTHAF187b_c, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gtcgtgtagcggctgtcttcgtcggccgga	Protospacer
************ **** ****** . **.

32. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to NZ_CP045336 (Labrenzia sp. THAF191a plasmid pTHAF191a_c, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gtcgtgtagcggctgtcttcgtcggccgga	Protospacer
************ **** ****** . **.

33. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to NZ_CP045382 (Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gtcgtgtagcggctgtcttcgtcggccgga	Protospacer
************ **** ****** . **.

34. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 6, identity: 0.793

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acgtcgaacgacacgtcggacagcgcttt	Protospacer
* *  ** *****************.**.

35. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 6, identity: 0.793

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acgtcgaacgacacgtcggacagcgcttt	Protospacer
* *  ** *****************.**.

36. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 6, identity: 0.793

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acgtcgaacgacacgtcggacagcgcttt	Protospacer
* *  ** *****************.**.

37. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.793

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acgtcgaacgacacgtcggacagcgcttt	Protospacer
* *  ** *****************.**.

38. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 6, identity: 0.793

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acgtcgaacgacacgtcggacagcgcttt	Protospacer
* *  ** *****************.**.

39. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.793

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acgtcgaacgacacgtcggacagcgcttt	Protospacer
* *  ** *****************.**.

40. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 6, identity: 0.793

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acgtcgaacgacacgtcggacagcgcttt	Protospacer
* *  ** *****************.**.

41. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.793

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acgtcgaacgacacgtcggacagcgcttt	Protospacer
* *  ** *****************.**.

42. spacer 19.6|6437107|30|NC_017186|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.8

caggccgactacgagaagcagagcccgcag	CRISPR spacer
tatgccgactacgagaagctgagcaagctg	Protospacer
.* **************** ****  ** *

43. spacer 19.7|6437166|32|NC_017186|CRISPRCasFinder matches to MH834621 (Arthrobacter phage Nandita, complete genome) position: , mismatch: 6, identity: 0.812

atcccgcagtagcgacaggtgtcgccgtcgcg	CRISPR spacer
ttgaggcagtagcggcaggagtcgccgtcgcg	Protospacer
 *   *********.**** ************

44. spacer 19.7|6437166|32|NC_017186|CRISPRCasFinder matches to MH834627 (Arthrobacter phage Ryan, complete genome) position: , mismatch: 6, identity: 0.812

atcccgcagtagcgacaggtgtcgccgtcgcg	CRISPR spacer
ttgaggcagtagcggcaggagtcgccgtcgcg	Protospacer
 *   *********.**** ************

45. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 6, identity: 0.812

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
aacgcggcggtggcctgcggatcctgggcgtg	Protospacer
*  *.************* *** ******** 

46. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 6, identity: 0.812

acggt-ggcggtggcctgctgatactgggcgtc	CRISPR spacer
-cgctgggcggtggcctgctgatcccgggcaac	Protospacer
 ** * ***************** *.****. *

47. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 6, identity: 0.812

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
acgatgccgcgctcgaccaacaccgggatcgt	Protospacer
***************** ******  * ** .

48. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.812

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
acgatgccgcgctcgaccaacaccgggatcgt	Protospacer
***************** ******  * ** .

49. spacer 21.4|6441628|32|NC_017186|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

gtgaagggcctctccccggccgggcagcggta	CRISPR spacer
gcgcttggcctctcccctgccgggcagcggca	Protospacer
*.*   *********** ************.*

50. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to MH576973 (Mycobacterium phage Bromden, complete genome) position: , mismatch: 6, identity: 0.812

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
accgtggccgactacttcggcctggacaaggt	Protospacer
   ********** *.************** *

51. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

acaaccggggcttcgccccgagccggggg	CRISPR spacer
gcgcccggggctccgccgcgagccgggga	Protospacer
.*. ********.**** **********.

52. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

acaaccggggcttcgccccgagccggggg	CRISPR spacer
gcggcgggggcttcgtcccgcgccggggg	Protospacer
.*..* *********.**** ********

53. spacer 2.1|301050|29|NC_017186|CRISPRCasFinder matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.759

cggcgcggggcggagccccggatggcacg	CRISPR spacer
cggcgcggggcggggccccggcccgcttc	Protospacer
*************.******* . ** . 

54. spacer 3.1|763149|30|NC_017186|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767

gaggaggctcccgctgccgaggaggccaag	CRISPR spacer
ccggaggcgcccgcggccgaggaggaagag	Protospacer
  ****** ***** **********  .**

55. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP011600 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-215, complete sequence) position: , mismatch: 7, identity: 0.759

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gtggtgatgcccggacgctcagcggtgcc	Protospacer
**   . .******.**************

56. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_AP018757 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_1, complete sequence) position: , mismatch: 7, identity: 0.759

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gtggtgatgcccggacgctcagcggtgcc	Protospacer
**   . .******.**************

57. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.759

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
cgacgattgcccgggcgatcagcggtcgc	Protospacer
   ****.********* ********  *

58. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.759

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
cgacgattgcccgggcgatcagcggtcgc	Protospacer
   ****.********* ********  *

59. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.759

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
cgacgattgcccgggcgatcagcggtcgc	Protospacer
   ****.********* ********  *

60. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.759

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
cgacgattgcccgggcgatcagcggtcgc	Protospacer
   ****.********* ********  *

61. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 7, identity: 0.759

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
acccgatcgaccgggcgctcaacggcgtg	Protospacer
..******* ***********.***.*. 

62. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to AP018479 (Mycobacterium phage GS4E DNA, complete sequence) position: , mismatch: 7, identity: 0.767

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gagtagaagcgggtgtcgtcgtccttgtgg	Protospacer
*    * **************** *** **

63. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to MT310877 (Mycobacterium phage VA6, complete genome) position: , mismatch: 7, identity: 0.767

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gagtagaagcgggtgtcgtcgtccttgtgg	Protospacer
*    * **************** *** **

64. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to MT658804 (Mycobacterium phage BengiVuitton, complete genome) position: , mismatch: 7, identity: 0.767

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gagtagaagcgggtgtcgtcgtccttgtgg	Protospacer
*    * **************** *** **

65. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to NC_023597 (Mycobacterium phage 20ES, complete genome) position: , mismatch: 7, identity: 0.767

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gagtagaagcgggtgtcgtcgtccttgtgg	Protospacer
*    * **************** *** **

66. spacer 19.1|6436809|30|NC_017186|CRISPRCasFinder matches to MT310886 (Mycobacterium phage AN3, complete genome) position: , mismatch: 7, identity: 0.767

gtcgtgtagcgggtgtcgtcgtcgttgggg	CRISPR spacer
gagtagaagcgggtgtcgtcgtccttgtgg	Protospacer
*    * **************** *** **

67. spacer 19.3|6436928|32|NC_017186|CRISPRCasFinder matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.781

gcgccttcg-----tcccagctggccggctcgacgat	CRISPR spacer
-----ttcgtcacttcccagctggccggatcgatgat	Protospacer
     ****     ************** ****.***

68. spacer 19.4|6436989|29|NC_017186|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.759

agggagatcgacacgtcggacagcgtttc	CRISPR spacer
acggggatcgaaacgtcggacagcgcaat	Protospacer
* **.****** *************.  .

69. spacer 19.10|6437349|32|NC_017186|CRISPRCasFinder matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 7, identity: 0.781

gtctcgaacgtcgtgggcgagacgacgtgctc	CRISPR spacer
ggttccagggtcatgggcgagacgacgtgatc	Protospacer
* .** *. ***.**************** **

70. spacer 19.10|6437349|32|NC_017186|CRISPRCasFinder matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 7, identity: 0.781

gtctcgaacgtcgtgggcgagacgacgtgctc	CRISPR spacer
ggttccagggtcatgggcgagacgacgtgatc	Protospacer
* .** *. ***.**************** **

71. spacer 19.10|6437349|32|NC_017186|CRISPRCasFinder matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 7, identity: 0.781

gtctcgaacgtcgtgggcgagacgacgtgctc	CRISPR spacer
ggttccagggtcatgggcgagacgacgtgatc	Protospacer
* .** *. ***.**************** **

72. spacer 20.3|6438753|33|NC_017186|PILER-CR,CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 7, identity: 0.788

cacggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
aaacgcggcggtggcctgcggatcctgggcgtg	Protospacer
 *  *.************* *** ******** 

73. spacer 20.3|6438753|33|NC_017186|PILER-CR,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 7, identity: 0.788

-cacggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
tcgctg-ggcggtggcctgctgatcccgggcaac	Protospacer
 *.* * ***************** *.****. *

74. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
acgctctgggtggcctgctcgtactgggcgta	Protospacer
*** *   *********** .********** 

75. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NZ_CP028350 (Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence) position: , mismatch: 7, identity: 0.781

acggtg-gcggtggcctgctgatactgggcgtc	CRISPR spacer
-cggtatttggcggcctgctgattctgggcgtg	Protospacer
 ****.  .**.*********** ******** 

76. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 7, identity: 0.781

acggtg-gcggtggcctgctgatactgggcgtc	CRISPR spacer
-cggtatttggcggcctgctgattctgggcgtg	Protospacer
 ****.  .**.*********** ******** 

77. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

acggtg-gcggtggcctgctgatactgggcgtc	CRISPR spacer
-cggtatttggcggcctgctgattctgggcgtg	Protospacer
 ****.  .**.*********** ******** 

78. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 7, identity: 0.781

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
acgctctgggtggcctgctcgtactgggcgta	Protospacer
*** *   *********** .********** 

79. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
atgtagccgccatcgacgaacacctcgtcgcc	Protospacer
*.*  *****  ****************. **

80. spacer 21.2|6441506|32|NC_017186|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.781

tcggccagcacccggcggaggttccggatact	CRISPR spacer
ggggccagcgcccggcggaggttctggaccat	Protospacer
  *******.**************.***.  *

81. spacer 21.2|6441506|32|NC_017186|CRISPRCasFinder matches to NC_008441 (Streptomyces laurentii plasmid pSLS DNA, complete sequence) position: , mismatch: 7, identity: 0.781

tcggccagcacccggcggaggttccg-gatact	CRISPR spacer
gcgaccagcacccggcggatgttccacgacag-	Protospacer
 **.*************** *****. **.*  

82. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MK919470 (Gordonia phage Mellie, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

83. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MN234179 (Gordonia phage Pipp, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

84. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MN010762 (Gordonia phage MintFen, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

85. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MT553336 (Gordonia phage BlingBling, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

86. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_031265 (Gordonia phage Guacamole, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

87. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MF919521 (Gordonia phage Lysidious, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

88. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MN369740 (Gordonia phage Delian, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

89. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MK801724 (Gordonia phage PhrostedPhlake, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

90. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MH576969 (Gordonia phage Zarbodnamra, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

91. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MK864263 (Gordonia phage Melba, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

92. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

93. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MK878896 (Gordonia phage Begonia, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

94. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

95. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MT723942 (Gordonia phage Archis, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

96. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MK967389 (Gordonia phage JasperJr, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

97. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MK501730 (Gordonia phage Barco, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

98. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to KU963251 (Gordonia phage UmaThurman, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

99. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to KX557274 (Gordonia phage CaptainKirk2, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

100. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MT723936 (Gordonia phage Hitter, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

101. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_031237 (Gordonia phage Obliviate, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

102. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_030921 (Gordonia phage Utz, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

103. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MN585963 (Gordonia phage Wocket, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gagaccggcaagcccgaggcggtcctcaactg	Protospacer
 * ******************.******  ..

104. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cacaccggcgagcccgatgcgatcccggcggt	Protospacer
*********.******* *******. .**  

105. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MK977705 (Gordonia Phage Mollymur, complete genome) position: , mismatch: 7, identity: 0.781

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
acctccggcaagcccgaggcggtcttcaccaa	Protospacer
  * *****************.**.****  *

106. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

cacacc-ggcaagcccgaggcgatcctcacgca	CRISPR spacer
-actccgggcgagcccgaggcgatcttcactgc	Protospacer
 ** ** ***.**************.****   

107. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 7, identity: 0.781

cacacc-ggcaagcccgaggcgatcctcacgca	CRISPR spacer
-actccgggcgagcccgaggcgatcttcactgc	Protospacer
 ** ** ***.**************.****   

108. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_015595 (Sphingobium chlorophenolicum L-1 plasmid pSPHCH01, complete sequence) position: , mismatch: 7, identity: 0.781

cacacc-ggcaagcccgaggcgatcctcacgca	CRISPR spacer
-actccgggcgagcccgaggcgatcttcactgc	Protospacer
 ** ** ***.**************.****   

109. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 7, identity: 0.781

cacacc-ggcaagcccgaggcgatcctcacgca	CRISPR spacer
-actccgggcgagcccgaggcgatcttcactgc	Protospacer
 ** ** ***.**************.****   

110. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP013265 (Sphingobium baderi strain DE-13 plasmid pDE1, complete sequence) position: , mismatch: 7, identity: 0.781

cacacc-ggcaagcccgaggcgatcctcacgca	CRISPR spacer
-actccgggcgagcccgaggcgatcttcactgc	Protospacer
 ** ** ***.**************.****   

111. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 7, identity: 0.781

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aacacgacggcgagcgcgtcgtcgcgctgttc	Protospacer
.**************  *********.* .*.

112. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gctcctacggcgtgccggccgtcgcgttcctg	Protospacer
* . * ****** *****.************ 

113. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gacacga---cggcgagccggtcgtcgcgttcctt	CRISPR spacer
---tcgagctcggcgagccgggcgtcgcgctcctc	Protospacer
    ***   *********** *******.****.

114. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.781

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gacacgacgtcgagccggttgtcgacatgctc	Protospacer
********* *********.****   * **.

115. spacer 21.7|6441444|33|NC_017186|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 7, identity: 0.788

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gacgatgccgcgctcgaccaacaccgggatcgt	Protospacer
 ***************** ******  * ** .

116. spacer 21.7|6441444|33|NC_017186|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.788

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gacgatgccgcgctcgaccaacaccgggatcgt	Protospacer
 ***************** ******  * ** .

117. spacer 21.8|6441505|33|NC_017186|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.788

ctcggccagcacccggcggaggttccggatact	CRISPR spacer
cggggccagcgcccggcggaggttctggaccat	Protospacer
*  *******.**************.***.  *

118. spacer 21.8|6441505|33|NC_017186|CRT matches to NC_008441 (Streptomyces laurentii plasmid pSLS DNA, complete sequence) position: , mismatch: 7, identity: 0.788

ctcggccagcacccggcggaggttccg-gatact	CRISPR spacer
cgcgaccagcacccggcggatgttccacgacag-	Protospacer
* **.*************** *****. **.*  

119. spacer 21.10|6441627|33|NC_017186|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

ggtgaagggcctctccccggccgggcagcggta	CRISPR spacer
cgcgcttggcctctcccctgccgggcagcggca	Protospacer
 *.*   *********** ************.*

120. spacer 21.11|6441688|33|NC_017186|CRT matches to MK919470 (Gordonia phage Mellie, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

121. spacer 21.11|6441688|33|NC_017186|CRT matches to MN234179 (Gordonia phage Pipp, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

122. spacer 21.11|6441688|33|NC_017186|CRT matches to MN010762 (Gordonia phage MintFen, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

123. spacer 21.11|6441688|33|NC_017186|CRT matches to MT553336 (Gordonia phage BlingBling, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

124. spacer 21.11|6441688|33|NC_017186|CRT matches to NC_031265 (Gordonia phage Guacamole, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

125. spacer 21.11|6441688|33|NC_017186|CRT matches to MF919521 (Gordonia phage Lysidious, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

126. spacer 21.11|6441688|33|NC_017186|CRT matches to MN369740 (Gordonia phage Delian, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

127. spacer 21.11|6441688|33|NC_017186|CRT matches to MK801724 (Gordonia phage PhrostedPhlake, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

128. spacer 21.11|6441688|33|NC_017186|CRT matches to MH576969 (Gordonia phage Zarbodnamra, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

129. spacer 21.11|6441688|33|NC_017186|CRT matches to MK864263 (Gordonia phage Melba, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

130. spacer 21.11|6441688|33|NC_017186|CRT matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

131. spacer 21.11|6441688|33|NC_017186|CRT matches to MK878896 (Gordonia phage Begonia, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

132. spacer 21.11|6441688|33|NC_017186|CRT matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

133. spacer 21.11|6441688|33|NC_017186|CRT matches to MT723942 (Gordonia phage Archis, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

134. spacer 21.11|6441688|33|NC_017186|CRT matches to MK967389 (Gordonia phage JasperJr, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

135. spacer 21.11|6441688|33|NC_017186|CRT matches to MK501730 (Gordonia phage Barco, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

136. spacer 21.11|6441688|33|NC_017186|CRT matches to KU963251 (Gordonia phage UmaThurman, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

137. spacer 21.11|6441688|33|NC_017186|CRT matches to KX557274 (Gordonia phage CaptainKirk2, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

138. spacer 21.11|6441688|33|NC_017186|CRT matches to MT723936 (Gordonia phage Hitter, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

139. spacer 21.11|6441688|33|NC_017186|CRT matches to NC_031237 (Gordonia phage Obliviate, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

140. spacer 21.11|6441688|33|NC_017186|CRT matches to NC_030921 (Gordonia phage Utz, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

141. spacer 21.11|6441688|33|NC_017186|CRT matches to MN585963 (Gordonia phage Wocket, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgagaccggcaagcccgaggcggtcctcaactg	Protospacer
* * ******************.******  ..

142. spacer 21.11|6441688|33|NC_017186|CRT matches to MK977705 (Gordonia Phage Mollymur, complete genome) position: , mismatch: 7, identity: 0.788

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cacctccggcaagcccgaggcggtcttcaccaa	Protospacer
*  * *****************.**.****  *

143. spacer 21.12|6441749|33|NC_017186|CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cgctcctacggcgtgccggccgtcgcgttcctg	Protospacer
** . * ****** *****.************ 

144. spacer 21.12|6441749|33|NC_017186|CRT matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

cgacacga---cggcgagccggtcgtcgcgttcctt	CRISPR spacer
---ctcgagctcggcgagccgggcgtcgcgctcctc	Protospacer
   * ***   *********** *******.****.

145. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

146. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

147. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

148. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

149. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

150. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

151. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

152. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

153. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

154. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

155. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

156. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

157. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

158. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

159. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

160. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

161. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

162. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

163. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.781

acgaagtagatgcccgcgtgctggatggtgag--	CRISPR spacer
gcgaagtagagtcccgcgtgctgga--gcgatcc	Protospacer
.*********  *************  *.**   

164. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
ggggtggacgacttccccggcctggatctgcc	Protospacer
 ****** ********.*********.  **.

165. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
ggggtggacgacttccccggcctggatctgcc	Protospacer
 ****** ********.*********.  **.

166. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 7, identity: 0.781

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
aagctggccgacctcgtcggcctggacacggt	Protospacer
 .* ********.** ************ * *

167. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 7, identity: 0.781

tgggtggccgacttcctcggcctggacaagct---	CRISPR spacer
tggcttgccgacttcctcggcct---ccatcttgg	Protospacer
*** * *****************   * * **   

168. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 7, identity: 0.759

acaaccggggcttcgccccgagccggggg	CRISPR spacer
ggcactggggcttcgccccgagacgggca	Protospacer
.  **.**************** **** .

169. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 7, identity: 0.759

acaaccggggcttcgccccgagccggggg	CRISPR spacer
ctatgcggggcttcgccccgaggcgcggc	Protospacer
 .*  ***************** ** ** 

170. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

acaaccggggcttcgccccgagccggggg	CRISPR spacer
acaaccgtggctgcgccccgagcatcgcc	Protospacer
******* **** **********   *  

171. spacer 25.1|6961022|29|NC_017186|CRISPRCasFinder matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 7, identity: 0.759

acaaccggggcttcgccccgagccggggg	CRISPR spacer
cggaccggggcttcgccccgatcccgaag	Protospacer
  .****************** ** *..*

172. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 8, identity: 0.724

gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
cgacgatcgcccgggcgatcagcggacgg	Protospacer
   ************** *******    

173. spacer 19.2|6436868|31|NC_017186|CRISPRCasFinder matches to NZ_CP012899 (Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence) position: , mismatch: 8, identity: 0.742

tgcccg---tggcggaacctgatcgtcaccaagc	CRISPR spacer
---acgaattggcggaacctgaacgtcagcaaag	Protospacer
    **   ************* ***** ***. 

174. spacer 19.2|6436868|31|NC_017186|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742

tgcccgtggcggaacctgatcgtcaccaagc	CRISPR spacer
ggcccgtcgctgaacctgatcgtcctggaga	Protospacer
 ****** ** ************* . .** 

175. spacer 19.5|6437047|31|NC_017186|CRISPRCasFinder matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 8, identity: 0.742

ggaagccggttgagcttcgcgccgcaccgtc	CRISPR spacer
gcctgccggttgatcatcgcgccgcactggg	Protospacer
*   ********* * ***********.*  

176. spacer 19.5|6437047|31|NC_017186|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggaagccggttgagcttcgcgccgcaccgtc	CRISPR spacer
ccagggtggctgagctgcgcgccgcaccgtt	Protospacer
  *.* .**.****** *************.

177. spacer 19.10|6437349|32|NC_017186|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 8, identity: 0.75

gtctcgaacgtcgtgggcgagacgacgtgctc	CRISPR spacer
tcctctaatgtcgtgggcgagacgacgacgac	Protospacer
 .*** **.******************    *

178. spacer 19.11|6437410|32|NC_017186|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 8, identity: 0.75

gacttcaagctgcgcctggtcaccctcggcgt	CRISPR spacer
cgctcgatgctgcacctggtcaacctcggcgc	Protospacer
 .**. * *****.******** ********.

179. spacer 19.11|6437410|32|NC_017186|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 8, identity: 0.75

gacttcaagctgcgcctggtcaccctcggcgt	CRISPR spacer
ggcggtatcctgcgcctgggcaacctcggcgt	Protospacer
*.*  .*  ********** ** *********

180. spacer 19.11|6437410|32|NC_017186|CRISPRCasFinder matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gacttcaagctgcgcctggtcaccctcggcgt	CRISPR spacer
tgccttgagcagcgcctggtcacccttggctt	Protospacer
 .*.*..*** ***************.*** *

181. spacer 20.3|6438753|33|NC_017186|PILER-CR,CRT matches to AF069529 (Bacteriophage HK97, complete genome) position: , mismatch: 8, identity: 0.758

cacggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
ctgcgtggcggtggcctgctgatagtcggagag	Protospacer
*   ******************** * ** *  

182. spacer 20.3|6438753|33|NC_017186|PILER-CR,CRT matches to NC_002167 (Enterobacteria phage HK97, complete genome) position: , mismatch: 8, identity: 0.758

cacggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
ctgcgtggcggtggcctgctgatagtcggagag	Protospacer
*   ******************** * ** *  

183. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to AF069529 (Bacteriophage HK97, complete genome) position: , mismatch: 8, identity: 0.75

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
tgcgtggcggtggcctgctgatagtcggagag	Protospacer
   ******************** * ** *  

184. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NC_002167 (Enterobacteria phage HK97, complete genome) position: , mismatch: 8, identity: 0.75

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
tgcgtggcggtggcctgctgatagtcggagag	Protospacer
   ******************** * ** *  

185. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
tggttggcgttggcctgctgatgctggcggcc	Protospacer
  * ***** ************.****  *.*

186. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.75

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
tggttggcgttggcctgctgatgctggcggcc	Protospacer
  * ***** ************.****  *.*

187. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NZ_CP040824 (Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence) position: , mismatch: 8, identity: 0.75

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
gcggtggcgctggcctgcggatacgcgccgct	Protospacer
.******** ******** *****  * **..

188. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MK494119 (Mycobacterium Phage Niklas, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
cagccgccgcgctcggcgaacacctcgttgag	Protospacer
  * .**********.*************   

189. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MK310138 (Mycobacterium phage Shaobing, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
cagccgccgcgctcggcgaacacctcgttgag	Protospacer
  * .**********.*************   

190. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MF185722 (Mycobacterium phage Peanam, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
cagccgccgcgctcggcgaacacctcgttgag	Protospacer
  * .**********.*************   

191. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gtgacgccgcgctcggcgaacacctcgcgggc	Protospacer
..**.**********.***********.   *

192. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gccgggctacgctcgaggaacacgtcgttccc	Protospacer
.* . **..******* ****** ********

193. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP048634 (Rhizobium oryzihabitans strain M15 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

acgatg-ccgcgctcgacgaacacctcgttccc	CRISPR spacer
-cgagatccgcgctcgacggacgcctcgttgtt	Protospacer
 *** . ************.**.******* ..

194. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP048638 (Rhizobium oryzihabitans strain M15 plasmid p6, complete sequence) position: , mismatch: 8, identity: 0.75

acgatg-ccgcgctcgacgaacacctcgttccc	CRISPR spacer
-cgagatccgcgctcgacggacgcctcgttgtt	Protospacer
 *** . ************.**.******* ..

195. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP048639 (Rhizobium oryzihabitans strain M15 plasmid p7, complete sequence) position: , mismatch: 8, identity: 0.75

acgatg-ccgcgctcgacgaacacctcgttccc	CRISPR spacer
-cgagatccgcgctcgacggacgcctcgttgtt	Protospacer
 *** . ************.**.******* ..

196. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75

acgatgcc-gcgctcgacgaacacctcgttccc	CRISPR spacer
-ccttactggcgcgggacgaacacctcgttccg	Protospacer
 *  *.*. ****  ***************** 

197. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
aacacgtcgggctcgacgaacaccgcgttcgg	Protospacer
*  *.*.** ************** *****  

198. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MK016499 (Mycobacterium phage Mangethe, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
aacacgtcgggctcgacgaacaccgcgttcgg	Protospacer
*  *.*.** ************** *****  

199. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MK919480 (Mycobacterium phage Techage, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
aacacgtcgggctcgacgaacaccgcgttcgg	Protospacer
*  *.*.** ************** *****  

200. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MF919492 (Mycobacterium phage Arib1, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
aacacgtcgggctcgacgaacaccgcgttcgg	Protospacer
*  *.*.** ************** *****  

201. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NC_041969 (Mycobacterium phage Jebeks, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
aacacgtcgggctcgacgaacaccgcgttcgg	Protospacer
*  *.*.** ************** *****  

202. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NC_023552 (Mycobacterium phage Donovan, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
aacacgtcgggctcgacgaacaccgcgttcgg	Protospacer
*  *.*.** ************** *****  

203. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MN693323 (Marine virus AFVG_25M87, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc---	CRISPR spacer
acgatgcagcgctcgaggaaca---cggaccaggg	Protospacer
******* ******** *****   **  **    

204. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MF472894 (Mycobacterium phage Majeke, complete genome) position: , mismatch: 8, identity: 0.75

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
aacacgtcgggctcgacgaacaccgcgttcgg	Protospacer
*  *.*.** ************** *****  

205. spacer 21.2|6441506|32|NC_017186|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

tcggccagcacccggcggaggttccggatact--	CRISPR spacer
tcgggcagcacccggcggagctt--ggccgccgc	Protospacer
**** *************** **  ** ..*.  

206. spacer 21.2|6441506|32|NC_017186|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

tcggccagcacccggcggaggttccggatact--	CRISPR spacer
tcgggcagcacccggcggagctt--ggccgccgc	Protospacer
**** *************** **  ** ..*.  

207. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_031230 (Gordonia phage Yvonnetastic, complete genome) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
atgtccggcaagcccgaggcggtcttcaccaa	Protospacer
    *****************.**.****  *

208. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MH020241 (Gordonia phage Fenry, complete genome) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaaccgggaagcccgaggcggtcctcaactg	Protospacer
 * ***** ************.******  ..

209. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaactggcaagcccgaggcggtcctcaactg	Protospacer
 * **.***************.******  ..

210. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaaccggcaagcccgaagcggtcctcaactg	Protospacer
 * **************.***.******  ..

211. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP022747 (Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
ggcgacggcaagcccgaggctatcatcacaga	Protospacer
 .*. *************** *** ****. *

212. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_016165 (Rhodobacter phage RcapMu, complete genome) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
catctcgacaagcccgaagcgatcctcaccgc	Protospacer
**. .**.*********.***********   

213. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
catctcgacaagcccgaagcgatcctcaccgc	Protospacer
**. .**.*********.***********   

214. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaaatctgcaagcccgaggcgatcgtcgcgac	Protospacer
 * *.* ***************** **.**  

215. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP048608 (Pseudomonas fluorescens strain DR133 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gacgccggcaaccccgaggcgatcgccaacaa	Protospacer
 **.******* ************ .**   *

216. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cgcagcgcggcgagccgggcgtcgcgttcccc	Protospacer
 .**  .*********** ***********..

217. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MN657146 (Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
accgcgacggcgagccggtcgccgcgatcggc	Protospacer
. *.*****************.**** **  .

218. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gacacgacggcgggccggtcgtccgccacccc	Protospacer
************.**********   . **..

219. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cccgcgacggcgagccggtcaccgcgttcggc	Protospacer
  *.****************..*******  .

220. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
tgatcgccggcgagccggtcgtcgccttcatc	Protospacer
 .  ** ****************** *** *.

221. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccccg	Protospacer
.. ******.**************** .**. 

222. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
taacgggcggcgagccggtcggcgcgctcctg	Protospacer
 *   *.************** ****.**** 

223. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
taacgggcggcgagccggtcggcgcgctcctg	Protospacer
 *   *.************** ****.**** 

224. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
taacgggcggcgagccggtcggcgcgctcctg	Protospacer
 *   *.************** ****.**** 

225. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
taacgggcggcgagccggtcggcgcgctcctg	Protospacer
 *   *.************** ****.**** 

226. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
accacgacgacgagcctgtcgtcgcggccgtg	Protospacer
. *******.****** ********* .* * 

227. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
accacgacgacgagcctgtcgtcgcggccgtg	Protospacer
. *******.****** ********* .* * 

228. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cgctcgacggcgagacgatcgtcgcgtcgcgt	Protospacer
 .* ********** **.*********. * *

229. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gcagcaaaggccagccggtcgtcgtgttcctc	Protospacer
*  .*.* *** ************.******.

230. spacer 21.7|6441444|33|NC_017186|CRT matches to MK494119 (Mycobacterium Phage Niklas, complete genome) position: , mismatch: 8, identity: 0.758

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
ccagccgccgcgctcggcgaacacctcgttgag	Protospacer
*  * .**********.*************   

231. spacer 21.7|6441444|33|NC_017186|CRT matches to MK310138 (Mycobacterium phage Shaobing, complete genome) position: , mismatch: 8, identity: 0.758

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
ccagccgccgcgctcggcgaacacctcgttgag	Protospacer
*  * .**********.*************   

232. spacer 21.7|6441444|33|NC_017186|CRT matches to MF185722 (Mycobacterium phage Peanam, complete genome) position: , mismatch: 8, identity: 0.758

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
ccagccgccgcgctcggcgaacacctcgttgag	Protospacer
*  * .**********.*************   

233. spacer 21.7|6441444|33|NC_017186|CRT matches to MN693323 (Marine virus AFVG_25M87, complete genome) position: , mismatch: 8, identity: 0.758

cacgatgccgcgctcgacgaacacctcgttccc---	CRISPR spacer
cacgatgcagcgctcgaggaaca---cggaccaggg	Protospacer
******** ******** *****   **  **    

234. spacer 21.11|6441688|33|NC_017186|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.758

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gcacaccggcgagcccgatgcgatcccggcggt	Protospacer
 *********.******* *******. .**  

235. spacer 21.11|6441688|33|NC_017186|CRT matches to NC_031230 (Gordonia phage Yvonnetastic, complete genome) position: , mismatch: 8, identity: 0.758

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
catgtccggcaagcccgaggcggtcttcaccaa	Protospacer
*    *****************.**.****  *

236. spacer 21.11|6441688|33|NC_017186|CRT matches to MH020241 (Gordonia phage Fenry, complete genome) position: , mismatch: 8, identity: 0.758

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaaccgggaagcccgaggcggtcctcaactg	Protospacer
* * ***** ************.******  ..

237. spacer 21.11|6441688|33|NC_017186|CRT matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 8, identity: 0.758

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaactggcaagcccgaggcggtcctcaactg	Protospacer
* * **.***************.******  ..

238. spacer 21.11|6441688|33|NC_017186|CRT matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 8, identity: 0.758

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
cgaaaccggcaagcccgaagcggtcctcaactg	Protospacer
* * **************.***.******  ..

239. spacer 21.12|6441749|33|NC_017186|CRT matches to MN657146 (Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence) position: , mismatch: 8, identity: 0.758

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
caccgcgacggcgagccggtcgccgcgatcggc	Protospacer
*. *.*****************.**** **  .

240. spacer 21.12|6441749|33|NC_017186|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.758

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gaacacgacggcgagcgcgtcgtcgcgctgttc	Protospacer
 .**************  *********.* .*.

241. spacer 21.12|6441749|33|NC_017186|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.758

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
ctgatcgccggcgagccggtcgtcgccttcatc	Protospacer
* .  ** ****************** *** *.

242. spacer 21.12|6441749|33|NC_017186|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.758

-cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gtaacg-ggcggcgagccggtcggcgcgctcctg	Protospacer
 ..**. *.************** ****.**** 

243. spacer 21.12|6441749|33|NC_017186|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.758

-cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gtaacg-ggcggcgagccggtcggcgcgctcctg	Protospacer
 ..**. *.************** ****.**** 

244. spacer 21.12|6441749|33|NC_017186|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.758

-cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gtaacg-ggcggcgagccggtcggcgcgctcctg	Protospacer
 ..**. *.************** ****.**** 

245. spacer 21.12|6441749|33|NC_017186|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.758

-cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gtaacg-ggcggcgagccggtcggcgcgctcctg	Protospacer
 ..**. *.************** ****.**** 

246. spacer 21.12|6441749|33|NC_017186|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.758

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
ggacacgacgtcgagccggttgtcgacatgctc	Protospacer
 ********* *********.****   * **.

247. spacer 22.1|6441980|32|NC_017186|CRISPRCasFinder matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

tgcacgaccggccaatcgaccgccttgtagtc	CRISPR spacer
agcacgaccggccaatcgagcacctgatcgat	Protospacer
 ****************** *.*** .* * .

248. spacer 22.1|6441980|32|NC_017186|CRISPRCasFinder matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.75

tgcacgaccggccaatcgaccgccttgtagtc	CRISPR spacer
tgttcgaccgcccaatcgaccgcattgatacc	Protospacer
**. ****** ************ ***  ..*

249. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.75

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gagctggccgacttcatcggcctggacacctg	Protospacer
 .* *********** ************  . 

250. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gagctggccgacttcatcggcctggacacctg	Protospacer
 .* *********** ************  . 

251. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
tgggtggccgaattcctgggcctgcccgacgc	Protospacer
*********** ***** ******  *.*  .

252. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP029363 (Streptomyces globisporus strain TFH56 plasmid pTFSG2, complete sequence) position: , mismatch: 8, identity: 0.75

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gagatggccgactgcttcggcctggacccggt	Protospacer
 .*.********* *.***********  * *

253. spacer 26.6|8280108|34|NC_017186|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.765

ctgggttcggctcggctcggctcggctcggctcg	CRISPR spacer
cgccctgcggctcggctcggctcggctcggccgt	Protospacer
*    * ************************.  

254. spacer 26.6|8280108|34|NC_017186|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctgggt--tcggctcggctcggctcggctcggctcg	CRISPR spacer
--gggccgccggctcggctcggcttggcccggctgc	Protospacer
  ***.  .***************.***.*****  

255. spacer 16.1|5356410|34|NC_017186|CRISPRCasFinder matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 9, identity: 0.735

ctccgacgcaaccgggcgccccgatgtctcgaca	CRISPR spacer
gggcgtccggacagggcgccccgatgtcccgaca	Protospacer
   ** *  .** ***************.*****

256. spacer 19.2|6436868|31|NC_017186|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71

tgcccgtggcggaacctgatcgtcaccaagc	CRISPR spacer
ggcccgtcgctgaacctgatcgtcctggaaa	Protospacer
 ****** ** ************* . .*. 

257. spacer 19.3|6436928|32|NC_017186|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gcgccttcgtcccagctggccggctcgacgat	CRISPR spacer
aaggcttcgtcccagcttaccggctcgaactc	Protospacer
. * ************* .*********   .

258. spacer 19.3|6436928|32|NC_017186|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 9, identity: 0.719

gcgccttcgtcccagctggccggctcgacgat	CRISPR spacer
tgacgatcgtcccagcgggccggctcggcggc	Protospacer
  .*  ********** **********.**..

259. spacer 19.3|6436928|32|NC_017186|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.719

gcgccttcgtcccagctggccggctcgacgat	CRISPR spacer
atgacctcgtcccagctggcgggcacgacctg	Protospacer
..* *.************** *** ****   

260. spacer 19.6|6437107|30|NC_017186|CRISPRCasFinder matches to MN317029 (Aeromonas phage vB_AhyS-A18P4, complete genome) position: , mismatch: 9, identity: 0.7

caggccgactacgagaagcagagcccgcag	CRISPR spacer
gaggccgactacgagaagcagaatttctgc	Protospacer
 *********************.... .. 

261. spacer 19.7|6437166|32|NC_017186|CRISPRCasFinder matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcccgcagtagcgacaggtgtcgccgtcgcg	CRISPR spacer
tgattgccatagcgacaggtatcgccatcgcg	Protospacer
   ..** .***********.*****.*****

262. spacer 19.8|6437227|32|NC_017186|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

cacacgatcggcggtttcacccgaccttcgcg	CRISPR spacer
attccgatcggcgatttcacccgacctaagac	Protospacer
  . *********.*************  *  

263. spacer 19.8|6437227|32|NC_017186|CRISPRCasFinder matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 9, identity: 0.719

cacacgatcggcggtttcacccgaccttcgcg	CRISPR spacer
cacacgatcggcggttttacgcgcaaaaccca	Protospacer
*****************.** **     * *.

264. spacer 19.10|6437349|32|NC_017186|CRISPRCasFinder matches to MT889391 (Mycobacterium phage MiniMac, complete genome) position: , mismatch: 9, identity: 0.719

gtctcgaacgtcgtgggcgagacgacgtgctc	CRISPR spacer
ataccgaacgtcgtgggcgagaagccggaaac	Protospacer
.* .****************** * ** .  *

265. spacer 19.11|6437410|32|NC_017186|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 9, identity: 0.719

gacttcaagctgcgcctggtcaccctcggcgt	CRISPR spacer
cggtcggtgctgcacctggtcaccctcggcgc	Protospacer
 . *. . *****.*****************.

266. spacer 19.11|6437410|32|NC_017186|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 9, identity: 0.719

gacttcaagctgcgcctggtcaccctcggcgt	CRISPR spacer
cgctcggtgctgcacctggtcactctcggcgc	Protospacer
 .**. . *****.*********.*******.

267. spacer 19.11|6437410|32|NC_017186|CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 9, identity: 0.719

gacttcaagctgcgcctggtcaccctcggcgt	CRISPR spacer
cggtcgatgctgcacctgatcaccctcggcgc	Protospacer
 . *. * *****.****.************.

268. spacer 19.15|6437657|32|NC_017186|CRISPRCasFinder matches to NC_022877 (Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence) position: , mismatch: 9, identity: 0.719

tacgtgtacgttggcgcctacggaacaggaac	CRISPR spacer
taactgtacgttggtgcctacggtacaatcta	Protospacer
**  **********.******** ***.    

269. spacer 19.15|6437657|32|NC_017186|CRISPRCasFinder matches to NC_022877 (Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence) position: , mismatch: 9, identity: 0.719

tacgtgtacgttggcgcctacggaacaggaac	CRISPR spacer
taactgtacgttggtgcctacggtacaatcta	Protospacer
**  **********.******** ***.    

270. spacer 20.3|6438753|33|NC_017186|PILER-CR,CRT matches to MH067969 (Arthrobacter sp. strain ANT_H2 plasmid pA2H2, complete sequence) position: , mismatch: 9, identity: 0.727

cacggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
ctgggtggcggtggcctgatgatcctgtcccag	Protospacer
*  *************** **** ***  *   

271. spacer 20.5|6438693|32|NC_017186|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

tggttgatccggatgtcccagtcgtccaccgc	CRISPR spacer
ccgaacagccggatgtgccagtcgtccagcgt	Protospacer
. *   * ******** *********** **.

272. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to MH067969 (Arthrobacter sp. strain ANT_H2 plasmid pA2H2, complete sequence) position: , mismatch: 9, identity: 0.719

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
tgggtggcggtggcctgatgatcctgtcccag	Protospacer
  *************** **** ***  *   

273. spacer 20.6|6438754|32|NC_017186|CRISPRCasFinder matches to NZ_CP013125 (Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence) position: , mismatch: 9, identity: 0.719

acggtggcggtggcctgctgatactgggcgtc	CRISPR spacer
gccacaaccgtggcctgctgatcctggccgtc	Protospacer
.* ....* ************* **** ****

274. spacer 20.7|6438815|32|NC_017186|CRISPRCasFinder matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 9, identity: 0.719

gacggttggggcaacctgaaggcggccggcct	CRISPR spacer
tccacctggcgcatcctgaaggcggccggctg	Protospacer
  *. .*** *** ****************. 

275. spacer 20.7|6438815|32|NC_017186|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719

gacggttggggcaacctgaaggcggccggcct	CRISPR spacer
gagaccgcaggccgcctgaaggcggccggcct	Protospacer
** . .  .*** .******************

276. spacer 20.7|6438815|32|NC_017186|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719

gacggttggggcaacctgaaggcggccggcct	CRISPR spacer
gagaccgcaggccgcctgaaggcggccggcct	Protospacer
** . .  .*** .******************

277. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP028972 (Aminobacter sp. MSH1 plasmid pUSP4, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
ctactgccgcgctcgacgaaaacctcgcccgg	Protospacer
 .. **************** ******..*  

278. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

279. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

280. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

281. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

282. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

283. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

284. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

285. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

286. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

287. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

288. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

289. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tggatgccgcgctcgaagagcacctcataggg	Protospacer
  ************** **.******.*    

290. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tggatgccgcgctcgaagagcacctcataggg	Protospacer
  ************** **.******.*    

291. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

292. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

293. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

294. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

295. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

296. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

297. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

298. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

299. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tcgatgccgcgatcgaagaacaccttggaata	Protospacer
 ********** **** ********.*   . 

300. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

301. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

302. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

303. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

304. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

305. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

306. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

307. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

308. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

309. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

310. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

311. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

312. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

313. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

314. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

315. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

316. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

317. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

318. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

319. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

320. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

321. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

322. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

323. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

324. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

325. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

326. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

327. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

328. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gtgatgccgagcttgacgaacaccttgcgcag	Protospacer
..******* ***.***********.*. *  

329. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

330. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

331. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

332. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

333. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

334. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

335. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

336. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

337. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

338. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

339. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

340. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gagatgccgcgctcgccgaactccttggatgc	Protospacer
. ************* ***** ***.*  . *

341. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

342. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

343. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcctcgccgcgctcgacgatcatctcgtacgt	Protospacer
.*  .************** **.***** * .

344. spacer 21.2|6441506|32|NC_017186|CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 9, identity: 0.719

tcggccagcacccggcggaggttccggatact	CRISPR spacer
ggcgacagcacccggcggagcttgcggagccg	Protospacer
   * *************** ** ****  * 

345. spacer 21.2|6441506|32|NC_017186|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggccagcacccggcggaggttccggatact	CRISPR spacer
tcggccagcacccggacgaggttgagtccccg	Protospacer
***************  ******  *  . * 

346. spacer 21.3|6441567|32|NC_017186|CRISPRCasFinder matches to MN855771 (Siphoviridae sp. isolate 189, complete genome) position: , mismatch: 9, identity: 0.719

atcgattcgctgaggacctccggcagcacgat	CRISPR spacer
gacatcgcgctgatgaccttcggcagcacgaa	Protospacer
. *. . ****** *****.*********** 

347. spacer 21.3|6441567|32|NC_017186|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.719

atcgattcgctgaggacctccggcagcacgat	CRISPR spacer
ccggattcgcggaggatctccggcagggtgag	Protospacer
 . ******* *****.********* ..** 

348. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_010721 (Methylorubrum populi BJ001 plasmid pMPOP02, complete sequence) position: , mismatch: 9, identity: 0.719

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gtcgccggccagcccgagacgatcctcggccg	Protospacer
  *.***** ********.********.  *.

349. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.719

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
accccgggcgagcccgaggcgatcttcactgc	Protospacer
  * * ***.**************.****   

350. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.719

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
accccgggcgagcccgaggcgatcttcactgc	Protospacer
  * * ***.**************.****   

351. spacer 21.5|6441689|32|NC_017186|CRISPRCasFinder matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 9, identity: 0.719

cacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
gaagccggcacgcccgaggcgatcttcgacaa	Protospacer
 * .****** *************.**.   *

352. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cggagttcggcgagcccgtcgtcgcgttcccg	Protospacer
 . *   ********* *************. 

353. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
tgcacggcgtcgagccggtcgtcgccggcttc	Protospacer
 .****.** ***************   *.*.

354. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cggagttcggcgagcccgtcgtcgcgttcccg	Protospacer
 . *   ********* *************. 

355. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aactcgacggcgagccggccgtcgcggaagaa	Protospacer
.** **************.*******      

356. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

357. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

358. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MN945904 (Mycobacterium phage Eponine, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

359. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

360. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

361. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

362. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

363. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

364. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

365. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

366. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MF140435 (Mycobacterium phage Wintermute, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

367. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_027365 (Mycobacterium virus Fionnbarth, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aggacgacgacgagccggtcgtcgcggccgcc	Protospacer
.. ******.**************** .* ..

368. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
atcacgacggcgagccgggcgacgcggacgcg	Protospacer
. **************** ** ****  * . 

369. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cgcatgacggcgagccggtggtcgcggtggcg	Protospacer
 .**.************** ****** *  . 

370. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
tcccagacgacgcgccggtcgtcgcgtttcgg	Protospacer
  *  ****.** ***************.*  

371. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
acgacgacgaccagccggtcgtcgcggccatg	Protospacer
.  ******.* ************** .* * 

372. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719

gacacga----cggcgagccggtcgtcgcgttcctt	CRISPR spacer
----tgatgttcggcgagccgatcgtcgcgctccag	Protospacer
    .**    **********.********.***  

373. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP050090 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b4, complete sequence) position: , mismatch: 9, identity: 0.719

gacacga----cggcgagccggtcgtcgcgttcctt	CRISPR spacer
----tgatgttcggcgagccggtcgtcgcactccag	Protospacer
    .**    ******************..***  

374. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MK433264 (Gordonia phage Tiamoceli, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cggccgacggcgtgccggtcgtcgggtggcta	Protospacer
 .  ******** *********** **  ** 

375. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MT952843 (Gordonia phage Twonlo, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cggccgacggcgtgccggtcgtcgggtggcta	Protospacer
 .  ******** *********** **  ** 

376. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to MK977704 (Gordonia Terrae phage RoadKill, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cggccgacggcgtgccggtcgtcgggtggcta	Protospacer
 .  ******** *********** **  ** 

377. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to KR053200 (Gordonia phage GTE6, complete genome) position: , mismatch: 9, identity: 0.719

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
cggccgacggcgtgccggtcgtcgggtggcta	Protospacer
 .  ******** *********** **  ** 

378. spacer 21.7|6441444|33|NC_017186|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.727

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
ggtgacgccgcgctcggcgaacacctcgcgggc	Protospacer
 ..**.**********.***********.   *

379. spacer 21.11|6441688|33|NC_017186|CRT matches to NC_016165 (Rhodobacter phage RcapMu, complete genome) position: , mismatch: 9, identity: 0.727

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
tcatctcgacaagcccgaagcgatcctcaccgc	Protospacer
.**. .**.*********.***********   

380. spacer 21.11|6441688|33|NC_017186|CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 9, identity: 0.727

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
tcatctcgacaagcccgaagcgatcctcaccgc	Protospacer
.**. .**.*********.***********   

381. spacer 21.11|6441688|33|NC_017186|CRT matches to NZ_CP022747 (Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

ccacaccggcaagcccgaggcgatcctcacgca	CRISPR spacer
tggcgacggcaagcccgaggctatcatcacaga	Protospacer
. .*. *************** *** ****. *

382. spacer 21.12|6441749|33|NC_017186|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 9, identity: 0.727

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
acccgcgacggcgagccggtcaccgcgttcggc	Protospacer
   *.****************..*******  .

383. spacer 21.12|6441749|33|NC_017186|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gaccacgacgacgagcctgtcgtcgcggccgtg	Protospacer
 . *******.****** ********* .* * 

384. spacer 21.12|6441749|33|NC_017186|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.727

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gaccacgacgacgagcctgtcgtcgcggccgtg	Protospacer
 . *******.****** ********* .* * 

385. spacer 22.1|6441980|32|NC_017186|CRISPRCasFinder matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tgcacgaccggccaatcgaccgccttgtagtc	CRISPR spacer
agcaggaccggccaatcgacagcccgacagaa	Protospacer
 *** *************** ***. ..**  

386. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gaactggccgacttcatcggcctggacacctg	Protospacer
 .. *********** ************  . 

387. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gaactggccgacttcatcggcctggacacctg	Protospacer
 .. *********** ************  . 

388. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
ctggcggccgatttcctcggcctggcggatca	Protospacer
. **.******.*************  .* * 

389. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
ctggcggccgatttcctcggcctggcggatca	Protospacer
. **.******.*************  .* * 

390. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
cgggtggccgcgttcctcggcctgtcctaaga	Protospacer
.*********  ************  * *.  

391. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
ctggcggccgatttcctcggcctggcggatca	Protospacer
. **.******.*************  .* * 

392. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gagctggccgacttcatcgggctggacacctg	Protospacer
 .* *********** **** *******  . 

393. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
ctggcggccgacttcctcgacctggcggatca	Protospacer
. **.**************.*****  .* * 

394. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
cgcatggtcgactttctcggcctggacatttg	Protospacer
.* .***.******.*************  . 

395. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
cgcatggtcgactttctcggcctggacatctg	Protospacer
.* .***.******.*************  . 

396. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gcgctggccgacttcctccgcctcgacgacga	Protospacer
  * ************** **** ***.*   

397. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
ctggcggccgatttcctcggcctggcagatcg	Protospacer
. **.******.*************  .* * 

398. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_LR594676 (Variovorax sp. PBS-H4 plasmid 2) position: , mismatch: 9, identity: 0.719

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
tacatcttcgacttcctcgacctggacgagcg	Protospacer
*. .*  .***********.*******.*** 

399. spacer 26.6|8280108|34|NC_017186|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.735

ctgggttcggctcggctcggctcggctcggctcg	CRISPR spacer
accggcccggctcggctcggcccggcccggccgg	Protospacer
 . **..**************.****.****. *

400. spacer 26.6|8280108|34|NC_017186|CRT matches to MN693688 (Marine virus AFVG_250M167, complete genome) position: , mismatch: 9, identity: 0.735

ctgggttcggctcggctcggctcggctcggctcg	CRISPR spacer
gctagtcgggctcggctcggctcgactcgacttg	Protospacer
 . .**. ****************.****.**.*

401. spacer 19.3|6436928|32|NC_017186|CRISPRCasFinder matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gcgccttcgtcccagctggccggctcgacgat	CRISPR spacer
aaagcttcatcccagctgaccggctcgaactc	Protospacer
. . ****.*********.*********   .

402. spacer 19.8|6437227|32|NC_017186|CRISPRCasFinder matches to NZ_CP022370 (Bosea sp. AS-1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cacacgatcggcggtttcacccgaccttcgcg	CRISPR spacer
ggccatggcggcggtttcacacgacctgcgca	Protospacer
 .*   . ************ ****** ***.

403. spacer 19.20|6436988|34|NC_017186|CRT matches to NZ_CP020812 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706

cagggagatcgacacgtcggacagcgtttcgcgg	CRISPR spacer
tgcggtcgccgacacgtcggacagcgttacccgc	Protospacer
.. **  ..******************* * ** 

404. spacer 19.23|6437165|37|NC_017186|CRT matches to MH834621 (Arthrobacter phage Nandita, complete genome) position: , mismatch: 10, identity: 0.73

gatcccgcagtagcgacaggtgtcgccgtcgcggttt	CRISPR spacer
tttgaggcagtagcggcaggagtcgccgtcgcggagc	Protospacer
  *   *********.**** *************  .

405. spacer 19.23|6437165|37|NC_017186|CRT matches to MH834627 (Arthrobacter phage Ryan, complete genome) position: , mismatch: 10, identity: 0.73

gatcccgcagtagcgacaggtgtcgccgtcgcggttt	CRISPR spacer
cttgaggcagtagcggcaggagtcgccgtcgcggagc	Protospacer
  *   *********.**** *************  .

406. spacer 20.5|6438693|32|NC_017186|CRISPRCasFinder matches to NZ_CP017304 (Rhodococcus sp. YL-1 plasmid pYLL2 sequence) position: , mismatch: 10, identity: 0.688

tggttgatccggatgtcccagtcgtccaccgc	CRISPR spacer
aggttgttccagatgtcccagtcggtgtggac	Protospacer
 ***** ***.************* .    .*

407. spacer 20.5|6438693|32|NC_017186|CRISPRCasFinder matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 10, identity: 0.688

tggttgatccggatgtcccagtcgtccaccgc	CRISPR spacer
aggttgttccagatgtcccagtcggtgtagac	Protospacer
 ***** ***.************* .    .*

408. spacer 20.8|6438814|33|NC_017186|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 10, identity: 0.697

agacggttggggcaacctgaaggcggccggcct	CRISPR spacer
ctccacctggcgcatcctgaaggcggccggctg	Protospacer
   *. .*** *** ****************. 

409. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
caaccgccgcggtcggcgaacacctcgttgag	Protospacer
  . .****** ***.*************   

410. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP031117 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcgacgccgcgctcgacgagcaccctgccgaa	Protospacer
.***.**************.****..*..   

411. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcgatgccgcgctcgacgatcgcccaccgcag	Protospacer
.****************** *.**.  . *  

412. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgagtgccgcgctcgacggagacctcgaccga	Protospacer
  ..**************.* ****** .*  

413. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgagtgccgcgctcgacggagacctcgaccga	Protospacer
  ..**************.* ****** .*  

414. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gcattgccgcgctcgaagaagacctcggcgtg	Protospacer
.*. ************ *** ****** . . 

415. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgagtgccgcgctcgacggagacctcgaccga	Protospacer
  ..**************.* ****** .*  

416. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgagtgccgcgctcgacggagacctcgaccga	Protospacer
  ..**************.* ****** .*  

417. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgagtgccgcgctcgacggagacctcgaccga	Protospacer
  ..**************.* ****** .*  

418. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to CP016643 (Mycobacterium sp. djl-10 plasmid djl-10_3, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
ttgatgccgtgctcgacgatcaccttcgaatc	Protospacer
 .*******.********* *****.    .*

419. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgagtgccgcgctcgacggagacctcgaccga	Protospacer
  ..**************.* ****** .*  

420. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgagtgccgcgctcgacggagacctcgaccga	Protospacer
  ..**************.* ****** .*  

421. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgagtgccgcgctcgacggagacctcgaccga	Protospacer
  ..**************.* ****** .*  

422. spacer 21.4|6441628|32|NC_017186|CRISPRCasFinder matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 10, identity: 0.688

gtgaagggcctctccccggccgggcagcggta	CRISPR spacer
gctccgggccccgccccggccgggcagcccgc	Protospacer
*.   *****.* ***************    

423. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 10, identity: 0.688

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
tcggcgccggcgagccgggcgtcgcgtatcag	Protospacer
   .** *********** ******** .*  

424. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gcgacgacggtcagccggtcgtcgcgccagcc	Protospacer
*  *******. **************..  ..

425. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 10, identity: 0.688

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
ggtggtacggcgcgccgttcgtcgcgttcgaa	Protospacer
*...  ****** **** ***********   

426. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 10, identity: 0.688

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
tcggcgccggcgagccgggcgtcgcgtatcag	Protospacer
   .** *********** ******** .*  

427. spacer 21.7|6441444|33|NC_017186|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 10, identity: 0.697

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
atggatgccgcgctcgaagagcacctcataggg	Protospacer
   ************** **.******.*    

428. spacer 21.7|6441444|33|NC_017186|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 10, identity: 0.697

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
atggatgccgcgctcgaagagcacctcataggg	Protospacer
   ************** **.******.*    

429. spacer 21.7|6441444|33|NC_017186|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
gtcgatgccgcgatcgaagaacaccttggaata	Protospacer
  ********** **** ********.*   . 

430. spacer 21.7|6441444|33|NC_017186|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 10, identity: 0.697

cacgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
ccaaccgccgcggtcggcgaacacctcgttgag	Protospacer
*  . .****** ***.*************   

431. spacer 21.9|6441566|33|NC_017186|CRT matches to MN855771 (Siphoviridae sp. isolate 189, complete genome) position: , mismatch: 10, identity: 0.697

gatcgattcgctgaggacctccggcagcacgat	CRISPR spacer
cgacatcgcgctgatgaccttcggcagcacgaa	Protospacer
 . *. . ****** *****.*********** 

432. spacer 21.12|6441749|33|NC_017186|CRT matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 10, identity: 0.697

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
aaactcgacggcgagccggccgtcgcggaagaa	Protospacer
 .** **************.*******      

433. spacer 21.12|6441749|33|NC_017186|CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 10, identity: 0.697

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
tatcacgacggcgagccgggcgacgcggacgcg	Protospacer
.. **************** ** ****  * . 

434. spacer 21.12|6441749|33|NC_017186|CRT matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 10, identity: 0.697

cgacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gcgcatgacggcgagccggtggtcgcggtggcg	Protospacer
  .**.************** ****** *  . 

435. spacer 22.1|6441980|32|NC_017186|CRISPRCasFinder matches to MH992209 (Apis mellifera associated microvirus 17 isolate INH_SP_257, complete genome) position: , mismatch: 10, identity: 0.688

tgcacgaccggccaatcgaccgccttgtagtc	CRISPR spacer
ggcacgaccggcctatcggccgccggatttaa	Protospacer
 ************ ****.*****  .*    

436. spacer 22.2|6442041|32|NC_017186|CRISPRCasFinder matches to NZ_CP032827 (Sphingomonas sp. YZ-8 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

acgaagtagatgcccgcgtgctggatggtgag	CRISPR spacer
taccggccgatgcgcgcctgctggatggtgac	Protospacer
    .*. ***** *** ************* 

437. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gacgtggccgtgttcctcggcctggacgtcgg	Protospacer
 . *******  ***************.    

438. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gacgtgggcgtcttcctcggcctggacgtcgg	Protospacer
 . **** ** ****************.    

439. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gaactggcggacttcatcggcctggacacctg	Protospacer
 .. **** ****** ************  . 

440. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
agggcggccgacatcctcggcctgttccgcga	Protospacer
 ***.******* ***********  * .   

441. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
tactaccccgacttcatcgccctggacaagga	Protospacer
*.     ******** *** **********  

442. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
agggcggccgacatcctcggcctgttccgcga	Protospacer
 ***.******* ***********  * .   

443. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
tactaccccgacttcatcgccctggacaagga	Protospacer
*.     ******** *** **********  

444. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to MN062714 (Microbacterium Phage DirtyBubble, complete genome) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
aacctggccaacctcctcggcctggactcccc	Protospacer
 .  *****.**.**************   *.

445. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to MT024860 (Microbacterium phage Stromboli, complete genome) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
aacctggccaacctcctcggcctggactcccc	Protospacer
 .  *****.**.**************   *.

446. spacer 22.4|6442162|32|NC_017186|CRISPRCasFinder matches to NC_016435 (Gordonia phage GRU1, complete genome) position: , mismatch: 10, identity: 0.688

tgggtggccgacttcctcggcctggacaagct	CRISPR spacer
gatgaggctgacttcctcggcctgcacagcgg	Protospacer
 . * ***.*************** ***.   

447. spacer 21.1|6441445|32|NC_017186|CRISPRCasFinder matches to MK305889 (Gordonia phage Mutzi, complete genome) position: , mismatch: 11, identity: 0.656

acgatgccgcgctcgacgaacacctcgttccc	CRISPR spacer
tgattgccgccctcgccgaacacctcggcgag	Protospacer
  . ****** **** *********** .   

448. spacer 21.2|6441506|32|NC_017186|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 11, identity: 0.656

tcggccagcacccggcggaggttccggatact	CRISPR spacer
ctctccagcacccggcggcggttcgggtccag	Protospacer
..  ************** ***** ** .   

449. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 11, identity: 0.656

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
agggttttcgcgacccggtcgacgcgttcctt	Protospacer
.. ..  . **** ******* **********

450. spacer 21.6|6441750|32|NC_017186|CRISPRCasFinder matches to KX815338 (Streptomyces phage Joe, complete genome) position: , mismatch: 11, identity: 0.656

gacacgacggcgagccggtcgtcgcgttcctt	CRISPR spacer
gacacgacggccagccgatcgtcatcgctgac	Protospacer
*********** *****.*****..  ..  .

451. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 12, identity: 0.586

-----gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gcgaccgctgatcgcccgggcaatcgtcg-----	Protospacer
       *.************. **. **     

452. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 12, identity: 0.586

-----gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gcgaccgctgatcgcccgggcaatcgtcg-----	Protospacer
       *.************. **. **     

453. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 12, identity: 0.586

-----gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gcgaccgctgatcgcccgggcaatcgtcg-----	Protospacer
       *.************. **. **     

454. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 12, identity: 0.586

-----gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gcgaccgctgatcgcccgggcaatcgtcg-----	Protospacer
       *.************. **. **     

455. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 12, identity: 0.586

-----gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gcgaccgctgatcgcccgggcaatcgtcg-----	Protospacer
       *.************. **. **     

456. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 12, identity: 0.586

-----gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gcgaccgctgatcgcccgggcaatcgtcg-----	Protospacer
       *.************. **. **     

457. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 12, identity: 0.586

-----gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gcgaccgctgatcgcccgggcaatcgtcg-----	Protospacer
       *.************. **. **     

458. spacer 10.1|2899133|29|NC_017186|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 12, identity: 0.586

-----gtccgatcgcccgggcgctcagcggtgcc	CRISPR spacer
gcgaccgctgatcgcccgggcaatcgtcg-----	Protospacer
       *.************. **. **     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1538493 : 1582883 43 Acinetobacter_phage(28.57%) integrase,transposase attL 1538692:1538710|attR 1589764:1589782
DBSCAN-SWA_2 4670147 : 4677779 7 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_3 6405357 : 6460869 43 Acinetobacter_phage(100.0%) transposase,integrase attL 6399763:6399783|attR 6441361:6441381
DBSCAN-SWA_4 8559516 : 8633698 59 Salmonella_phage(14.29%) transposase,protease,tRNA,integrase attL 8555328:8555345|attR 8590943:8590960
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage