Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015858 Brucella pinnipedialis B2/94 chromosome 2, complete sequence 0 crisprs csa3,cas3,DEDDh 0 0 1 0
NC_015857 Brucella pinnipedialis B2/94 chromosome 1, complete sequence 1 crisprs csa3,WYL,DEDDh 0 1 3 0

Results visualization

1. NC_015858
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 498555 : 636423 111 Planktothrix_phage(22.22%) tRNA,holin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_015857
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015857_1 664489-664571 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015857_1 1.1|664517|27|NC_015857|CRISPRCasFinder 664517-664543 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|664517|27|NC_015857|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ataagatgcgcgcaaggaaagatctgt	CRISPR spacer
aacagatgctctcaaggaaagatctga	Protospacer
*  ****** * ************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 484694 : 610280 115 Paenibacillus_phage(17.86%) protease,capsid,tail,head,transposase,portal,holin NA
DBSCAN-SWA_2 881818 : 894524 13 uncultured_Mediterranean_phage(80.0%) transposase,tRNA NA
DBSCAN-SWA_3 965252 : 973603 11 Brucella_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage