1. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 5, identity: 0.833
attataagtataacaaaaaagctaatgtac CRISPR spacer
cttataagtataacaaaaaggctatttaac Protospacer
******************.**** * **
2. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
gttatgagtataacaaaaaagcaaatcaaa Protospacer
.****.**************** *** *
3. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to CP002509 (Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
gttatgagtataacaaaaaagcaaatcaaa Protospacer
.****.**************** *** *
4. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to CP002510 (Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB28, complete sequence) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
gttatgagtataacaaaaaagcaaatcaaa Protospacer
.****.**************** *** *
5. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
gttatgagtataacaaaaaagcaaatcaaa Protospacer
.****.**************** *** *
6. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NC_018492 (Bacillus cereus FRI-35 plasmid p01, complete sequence) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac- CRISPR spacer
gttgtaagtttaacaaaaaagct-atttgca Protospacer
.**.***** ************* ** *.*
7. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MG557618 (Staphylococcus phage HSA30, complete genome) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgaat Protospacer
***** *************** .*** *.
8. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to LR215718 (Staphylococcus phage Stab20 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatggat Protospacer
***** *************** .*** *.
9. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MH159197 (Staphylococcus phage VB_SavM_JYL01, complete genome) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgaat Protospacer
***** *************** .*** *.
10. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MK250904 (Staphylococcus phage VB-SavM-JYL02, complete genome) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgaat Protospacer
***** *************** .*** *.
11. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NC_025416 (Staphylococcus phage MCE-2014, complete genome) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgaat Protospacer
***** *************** .*** *.
12. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to KM216423 (Staphylococcus phage P108, complete genome) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgaat Protospacer
***** *************** .*** *.
13. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NC_019448 (Staphylococcus phage GH15, complete genome) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgaat Protospacer
***** *************** .*** *.
14. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MG721208 (Staphylococcus phage vB_SauM_LM12, complete genome) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgaat Protospacer
***** *************** .*** *.
15. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MN304941 (Staphylococcus phage vB_SauH_IME522, complete genome) position: , mismatch: 6, identity: 0.8
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgaat Protospacer
***** *************** .*** *.
16. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NZ_CP019718 (Paenibacillus larvae subsp. larvae strain Eric_V plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac- CRISPR spacer
tttataagtataacagaaaagc-gctggata Protospacer
**************.****** . ** *.
17. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MT411892 (Staphylococcus phage Metroid, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
18. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MH107769 (Staphylococcus phage vB_SauM_0414_108, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
19. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to JX080302 (Staphylococcus phage 676Z, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
20. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MK533143 (Paenibacillus phage vB_PlaP_API480, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac- CRISPR spacer
tttataagtataacagaaaagc-gctggata Protospacer
**************.****** . ** *.
21. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MN693268 (Marine virus AFVG_25M194, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
atgcgaagtataacgaaaaagctaaagtgg Protospacer
** *********.********** **.
22. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to KP687432 (Staphylococcus phage IME-SA2, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
23. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to AB853331 (Staphylococcus phage S25-4 DNA, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
24. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MK331930 (Staphylococcus phage CH1, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
25. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to JX080305 (Staphylococcus phage P4W, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
26. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to MT554104 (Staphylococcus phage ESa1, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
27. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NC_022920 (Staphylococcus phage S25-3 DNA, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
28. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NC_019726 (Staphylococcus phage JD007, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
29. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NC_047721 (Staphylococcus phage SA5, complete genome) position: , mismatch: 7, identity: 0.767
attataagtataacaaaaaagctaatgtac CRISPR spacer
attattagtataacaaaaaaggagatgggt Protospacer
***** *************** .*** ..
30. spacer 2.1|576223|30|NC_015946|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733
attataagtataacaaaaaagctaatgtac CRISPR spacer
ccaatagctataacaaaaaagctaatactc Protospacer
. ***. ******************.. *