1. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 8.15|1572145|22|NC_017524|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 8.15|1572145|22|NC_017524|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 8.15|1572145|22|NC_017524|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 8.15|1572145|22|NC_017524|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 8.2|1571218|22|NC_017524|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
9. spacer 8.2|1571218|22|NC_017524|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 8.2|1571218|22|NC_017524|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 8.2|1571218|22|NC_017524|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 8.2|1571218|22|NC_017524|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 8.3|1571272|22|NC_017524|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
14. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
15. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
16. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
18. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
19. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
24. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
25. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
26. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
27. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
28. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
30. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
31. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
32. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
33. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
34. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
35. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
36. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
37. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
38. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 1.11|333973|27|NC_017524|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
41. spacer 1.11|333973|27|NC_017524|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
42. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
43. spacer 8.4|1571326|22|NC_017524|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
44. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
45. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
46. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
47. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
48. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
49. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
50. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
51. spacer 8.15|1572145|22|NC_017524|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
52. spacer 10.5|2082208|24|NC_017524|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
53. spacer 10.5|2082208|24|NC_017524|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
54. spacer 2.1|368829|27|NC_017524|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
55. spacer 2.1|368829|27|NC_017524|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
56. spacer 2.7|369225|27|NC_017524|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
57. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
58. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
59. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
60. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggctggcggggatat Protospacer
********** ************* .
61. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
62. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
63. spacer 5.6|926045|27|NC_017524|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
64. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
65. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
66. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
67. spacer 5.6|926045|27|NC_017524|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
68. spacer 5.6|926045|27|NC_017524|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
69. spacer 5.10|926201|30|NC_017524|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cccgcccggcggcgacgccgccctggtggt Protospacer
* ***************** **** ****
70. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
71. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
72. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
73. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
74. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
75. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
76. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
77. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
78. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
79. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
80. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
81. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
82. spacer 8.14|1572088|25|NC_017524|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
83. spacer 10.5|2082208|24|NC_017524|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
84. spacer 10.5|2082208|24|NC_017524|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
85. spacer 10.5|2082208|24|NC_017524|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
86. spacer 1.2|333493|27|NC_017524|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
87. spacer 1.11|333973|27|NC_017524|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
88. spacer 1.11|333973|27|NC_017524|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
89. spacer 1.11|333973|27|NC_017524|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
90. spacer 1.12|334018|30|NC_017524|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
91. spacer 1.12|334018|30|NC_017524|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
92. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
93. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
94. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
95. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
96. spacer 2.1|368829|27|NC_017524|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
97. spacer 2.1|368829|27|NC_017524|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
98. spacer 2.7|369225|27|NC_017524|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
99. spacer 2.7|369225|27|NC_017524|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
100. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
101. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
102. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
103. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
104. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
105. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
106. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
107. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
108. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
109. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
110. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
111. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
112. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
113. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
114. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
115. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
116. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
117. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
118. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
119. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
120. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
121. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
122. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
123. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
124. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
125. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
126. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
127. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
128. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
129. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
130. spacer 5.6|926045|27|NC_017524|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggcaggcggggatat Protospacer
********** **** ******** .
131. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcaccggcggggctggcggcatcgg Protospacer
***** *************** . **
132. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
ccaaagcggcgagactggcggggaggg Protospacer
* *******.*.*************
133. spacer 5.6|926045|27|NC_017524|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgttcacggcggggctggcggggacgg Protospacer
.**. .****************** **
134. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
135. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
136. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
actcgccggcgcggctggcggggaggg Protospacer
**. ***** ***************
137. spacer 5.10|926201|30|NC_017524|CRT matches to MN234196 (Gordonia phage CloverMinnie, complete genome) position: , mismatch: 5, identity: 0.833
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggtggacggcggcgacggcggcctgctggt Protospacer
* * *********** ************
138. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggggccggcggcgacgcgggcctgatcgg Protospacer
**** ************* ****** * *
139. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgtcaccggcggcgccgccggcctgctgat Protospacer
** ********* *************.*
140. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgtcaccggcggcgccgccggcctgctgat Protospacer
** ********* *************.*
141. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 5, identity: 0.833
cgggcccg-gcggcgacgccggcctgctggt CRISPR spacer
-ggacgcgcgcggcgacgccgccctgctggc Protospacer
**.* ** ************ ********.
142. spacer 5.10|926201|30|NC_017524|CRT matches to MH834625 (Arthrobacter phage Richie, complete genome) position: , mismatch: 5, identity: 0.833
cgggcccggcggcgacgccggcct-gctggt CRISPR spacer
cgggcccgtcggtgacgccggcctcgatga- Protospacer
******** ***.*********** * **.
143. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022317 (Brachybacterium avium strain VR2415 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgggcccggcggcgacgccggcctgctggt-- CRISPR spacer
cgagctcggcggcgacgccggcccg--ggtca Protospacer
**.**.*****************.* ***
144. spacer 5.10|926201|30|NC_017524|CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 5, identity: 0.833
cgggcccggcggcgacgccgg-cctgctggt CRISPR spacer
cgggcccggcggcggcgccggacacgctgc- Protospacer
**************.****** * .****
145. spacer 5.10|926201|30|NC_017524|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.833
cgggcccgg---cggcgacgccggcctgctggt CRISPR spacer
---gctcggcctcggcgacgccgccctgctggt Protospacer
**.*** *********** *********
146. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.833
cgggcccgg---cggcgacgccggcctgctggt CRISPR spacer
---gctcggcctcggcgacgccgccctgctggt Protospacer
**.*** *********** *********
147. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 5, identity: 0.833
cgggcc--cggcggcgacgccggcctgctggt CRISPR spacer
--ggccggaggcggcgatgccggccagctggt Protospacer
**** ********.******* ******
148. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
149. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
150. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
151. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
152. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
153. spacer 8.5|1571380|25|NC_017524|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
154. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
155. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
156. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
157. spacer 8.13|1572022|34|NC_017524|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
158. spacer 15.7|3739509|31|NC_017524|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
159. spacer 1.3|333538|30|NC_017524|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
tcagcggagccgaagatcacgccgccgagc Protospacer
.*.************* ** ******* *
160. spacer 1.12|334018|30|NC_017524|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
161. spacer 1.12|334018|30|NC_017524|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
162. spacer 1.12|334018|30|NC_017524|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
163. spacer 2.1|368829|27|NC_017524|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
164. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
165. spacer 2.7|369225|27|NC_017524|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
166. spacer 2.9|369375|27|NC_017524|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
167. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
168. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
169. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
170. spacer 2.10|369435|27|NC_017524|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
171. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
172. spacer 3.2|631000|30|NC_017524|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
173. spacer 3.2|631000|30|NC_017524|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
174. spacer 3.2|631000|30|NC_017524|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
175. spacer 3.2|631000|30|NC_017524|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
176. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
177. spacer 3.2|631000|30|NC_017524|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
178. spacer 3.2|631000|30|NC_017524|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
179. spacer 3.2|631000|30|NC_017524|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
180. spacer 3.2|631000|30|NC_017524|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
181. spacer 3.2|631000|30|NC_017524|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
182. spacer 3.2|631000|30|NC_017524|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
183. spacer 3.2|631000|30|NC_017524|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
184. spacer 3.2|631000|30|NC_017524|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
185. spacer 3.2|631000|30|NC_017524|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
186. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
187. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtaagcggctgggctggcggggatat Protospacer
.** ****** ************* .
188. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtcagcggcggggctggcgttcatcg Protospacer
.******************* * *
189. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tagaagcggcggggctggtggagaggg Protospacer
.. **************.**.*****
190. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
gcgcaccggcggggctggcggggcggc Protospacer
** ***************** **
191. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 6, identity: 0.8
-cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gctgatcc-tcggcggcgccggcctgctggt Protospacer
* *..** *****.***************
192. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
caaacccggcggcgacgccgggctgctgtc Protospacer
*...***************** ****** .
193. spacer 5.10|926201|30|NC_017524|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
caagcccggcggcgacgcgggcctgctctc Protospacer
*..*************** ******** .
194. spacer 5.10|926201|30|NC_017524|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
caagcccggcggcgacgcgggcctgctctc Protospacer
*..*************** ******** .
195. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cttcaccggcggcgccgccggcctgctgat Protospacer
* ********* *************.*
196. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctgtccggcggcgacgtcggccggctgct Protospacer
* *.************.***** **** *
197. spacer 5.10|926201|30|NC_017524|CRT matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cttcaccggcggcgacgacggcctgccggt Protospacer
* ************ ********.***
198. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cttcaccggcggcgccgccggcctgctgat Protospacer
* ********* *************.*
199. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cttcaccggcggcgccgccggcctgctgat Protospacer
* ********* *************.*
200. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgaagccgccggcgacgacggcctgctggt Protospacer
.*.. *** ******** ************
201. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctgtccggcggcgacgtcggccggctgct Protospacer
* *.************.***** **** *
202. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgaagccgccggcgacgacggcctgctggt Protospacer
.*.. *** ******** ************
203. spacer 5.10|926201|30|NC_017524|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctgcccggcggcgacaccggccggctgtg Protospacer
* *************.****** ****
204. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgttcccggcggcgacggcggcctcctcga Protospacer
** ************* ****** ** *
205. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgtcaccggcggcgacgacggcctgcaggg Protospacer
** ************ ******** **
206. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.8
--cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gccgga--cggcagcggcgccggcctgctgga Protospacer
***. ****.***.**************
207. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgacgccggcggcgtggc Protospacer
*** ****************** ***.
208. spacer 5.10|926201|30|NC_017524|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
agcgcccggccgggacgccggcctgctcct Protospacer
* ******* * ************** *
209. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcc---cggcggcgacgccggcctgctggt CRISPR spacer
---gccagtcggcggtgacgccgccctgctgga Protospacer
*** ******.******* ********
210. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ctggccgggcggcgatgccggcctggcggg Protospacer
* **** ********.********* .**
211. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcc--cggcggcgacgccggcctgctggt CRISPR spacer
--ggtcggtgtcggcgacgccggccagctggt Protospacer
**.* .* ************** ******
212. spacer 5.10|926201|30|NC_017524|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctgaccggcagcgacgccggccttctgat Protospacer
* * *****.************* ***.*
213. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgacgtcggccagatcgc Protospacer
*** *************.***** * * *.
214. spacer 5.10|926201|30|NC_017524|CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 6, identity: 0.8
cgggcccggcggcgacgccggcctgctggt- CRISPR spacer
cgggcgcggcggcgacgccgg-gtgccgacg Protospacer
***** *************** ***.*..
215. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
216. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
217. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
218. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
219. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
220. spacer 8.13|1572022|34|NC_017524|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
221. spacer 15.7|3739509|31|NC_017524|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
222. spacer 1.3|333538|30|NC_017524|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc Protospacer
******.******** ******** .. *
223. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
224. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
225. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
226. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
227. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
228. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
229. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
230. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
231. spacer 1.12|334018|30|NC_017524|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
232. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
233. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
234. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
235. spacer 1.12|334018|30|NC_017524|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
236. spacer 2.4|369024|27|NC_017524|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
237. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
238. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
239. spacer 3.2|631000|30|NC_017524|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
240. spacer 3.2|631000|30|NC_017524|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
241. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
242. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
243. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
244. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
245. spacer 3.2|631000|30|NC_017524|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
246. spacer 3.2|631000|30|NC_017524|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
247. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
248. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
249. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
250. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
251. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
252. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
253. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
254. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
255. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
256. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
257. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
258. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
259. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
260. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
261. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
262. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
263. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
264. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
265. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
266. spacer 5.6|926045|27|NC_017524|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
267. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
268. spacer 5.6|926045|27|NC_017524|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
269. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
270. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattggcggcggggctggcggggatct Protospacer
.*..*******************
271. spacer 5.6|926045|27|NC_017524|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
272. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
273. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
274. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
275. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
276. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
277. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
278. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
279. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
280. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
281. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
282. spacer 5.6|926045|27|NC_017524|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
283. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctcgccggccgcgccgccggcctgctggc Protospacer
* ***** *** **************.
284. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctgcccggcggcgacacccgcctgcacct Protospacer
* *************.** ****** *
285. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggcccgcggcggcgtcggcggcctgctggc Protospacer
* * ******** ** ***********.
286. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctgcccggcggcgacacccgcctgcacct Protospacer
* *************.** ****** *
287. spacer 5.10|926201|30|NC_017524|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
288. spacer 5.10|926201|30|NC_017524|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
289. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
290. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
291. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgggcccgggggcgccgccggcctcccccg Protospacer
********* **** ********* *.
292. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
293. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
294. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
295. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
296. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
297. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
298. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
299. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
300. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gatggccggcggctacaccggcctgctggc Protospacer
. * ******** **.************.
301. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
302. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
303. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
304. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctcctcggcggcgccgccggcctgcaggg Protospacer
* *.******** *********** **
305. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
306. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
307. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
308. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
309. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
310. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
311. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
312. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
313. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gctggccgtcggcggcgccggcctgctggc Protospacer
* *** *****.**************.
314. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
315. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
316. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
317. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
318. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
319. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
320. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
321. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
322. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
323. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
324. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
325. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
326. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
327. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
328. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
329. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
330. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
331. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
332. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
333. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
334. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
335. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
336. spacer 5.10|926201|30|NC_017524|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
337. spacer 5.10|926201|30|NC_017524|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
338. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggaagccggcggcaacgccggcatgctgga Protospacer
*.. ********.******** ******
339. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ccttgacggcggcggcgccggcctgcgggt Protospacer
* ********.*********** ***
340. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ccagcacggcggcggcgccggcctgcatgg Protospacer
* .** ********.*********** *
341. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
342. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
343. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
344. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
345. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
346. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
347. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
348. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
349. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
350. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
351. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
352. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
353. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
354. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
355. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
356. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
357. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
358. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
359. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
360. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
361. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
agcagccggcggcgacgccgtccagctggc Protospacer
* . *************** ** *****.
362. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
363. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
364. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
365. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
366. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
367. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
368. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
369. spacer 5.10|926201|30|NC_017524|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tccggccggccgcgacgccggcctggtggc Protospacer
. * ***** ************** ***.
370. spacer 5.10|926201|30|NC_017524|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
371. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgaagctgccggcgacgacggcctgctggt Protospacer
.*.. *.* ******** ************
372. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ccagcccggcggcgatgcccgcctgcgcga Protospacer
* .************.*** ****** *
373. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ccgaggcggcggcgccgccggcctgctcgc Protospacer
* *. ******** ************ *.
374. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
375. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgaagctgccggcgacgacggcctgctggt Protospacer
.*.. *.* ******** ************
376. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
377. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgaagctgccggcgacgacggcctgctggt Protospacer
.*.. *.* ******** ************
378. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
379. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgaagctgccggcgacgacggcctgctggt Protospacer
.*.. *.* ******** ************
380. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
381. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ccttcgcggcggcgacggcggcctgcttct Protospacer
* * *********** ********* *
382. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctgcccggcggcgacacccgcctgcacct Protospacer
* *************.** ****** *
383. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cttcaccggcggcgccgccggactgctgat Protospacer
* ********* ****** ******.*
384. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ccgcatcgacggcgaggccggcctgctggc Protospacer
* * .**.****** *************.
385. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
386. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
387. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
388. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
389. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP041605 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgccgccggcggcgacgccgaccggctgcc Protospacer
** ***************.** **** .
390. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgaagctgccggcgacgacggcctgctggt Protospacer
.*.. *.* ******** ************
391. spacer 5.10|926201|30|NC_017524|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
392. spacer 5.10|926201|30|NC_017524|CRT matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
393. spacer 5.10|926201|30|NC_017524|CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
394. spacer 5.10|926201|30|NC_017524|CRT matches to MG925339 (Mycobacterium phage Chunky, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
395. spacer 5.10|926201|30|NC_017524|CRT matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
396. spacer 5.10|926201|30|NC_017524|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
397. spacer 5.10|926201|30|NC_017524|CRT matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
398. spacer 5.10|926201|30|NC_017524|CRT matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
399. spacer 5.10|926201|30|NC_017524|CRT matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
400. spacer 5.10|926201|30|NC_017524|CRT matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
401. spacer 5.10|926201|30|NC_017524|CRT matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
402. spacer 5.10|926201|30|NC_017524|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
403. spacer 5.10|926201|30|NC_017524|CRT matches to MH779500 (Mycobacterium phage Crownjwl, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
404. spacer 5.10|926201|30|NC_017524|CRT matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
405. spacer 5.10|926201|30|NC_017524|CRT matches to MF919511 (Mycobacterium phage Kailash, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
406. spacer 5.10|926201|30|NC_017524|CRT matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
407. spacer 5.10|926201|30|NC_017524|CRT matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
408. spacer 5.10|926201|30|NC_017524|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
409. spacer 5.10|926201|30|NC_017524|CRT matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
410. spacer 5.10|926201|30|NC_017524|CRT matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
411. spacer 5.10|926201|30|NC_017524|CRT matches to MK524512 (Mycobacterium phage Carthage, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
412. spacer 5.10|926201|30|NC_017524|CRT matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
413. spacer 5.10|926201|30|NC_017524|CRT matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
414. spacer 5.10|926201|30|NC_017524|CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
415. spacer 5.10|926201|30|NC_017524|CRT matches to KM347890 (Mycobacterium phage Vivaldi, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
416. spacer 5.10|926201|30|NC_017524|CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
417. spacer 5.10|926201|30|NC_017524|CRT matches to KY006474 (Mycobacterium phage Prann, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
418. spacer 5.10|926201|30|NC_017524|CRT matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
419. spacer 5.10|926201|30|NC_017524|CRT matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
420. spacer 5.10|926201|30|NC_017524|CRT matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
421. spacer 5.10|926201|30|NC_017524|CRT matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
422. spacer 5.10|926201|30|NC_017524|CRT matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
423. spacer 5.10|926201|30|NC_017524|CRT matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
424. spacer 5.10|926201|30|NC_017524|CRT matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
425. spacer 5.10|926201|30|NC_017524|CRT matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
426. spacer 5.10|926201|30|NC_017524|CRT matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
427. spacer 5.10|926201|30|NC_017524|CRT matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
428. spacer 5.10|926201|30|NC_017524|CRT matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
429. spacer 5.10|926201|30|NC_017524|CRT matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
430. spacer 5.10|926201|30|NC_017524|CRT matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
431. spacer 5.10|926201|30|NC_017524|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
432. spacer 5.10|926201|30|NC_017524|CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
433. spacer 5.10|926201|30|NC_017524|CRT matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
434. spacer 5.10|926201|30|NC_017524|CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
435. spacer 5.10|926201|30|NC_017524|CRT matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
436. spacer 5.10|926201|30|NC_017524|CRT matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
437. spacer 5.10|926201|30|NC_017524|CRT matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
438. spacer 5.10|926201|30|NC_017524|CRT matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
439. spacer 5.10|926201|30|NC_017524|CRT matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
440. spacer 5.10|926201|30|NC_017524|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
441. spacer 5.10|926201|30|NC_017524|CRT matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
442. spacer 5.10|926201|30|NC_017524|CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
443. spacer 5.10|926201|30|NC_017524|CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
444. spacer 5.10|926201|30|NC_017524|CRT matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
445. spacer 5.10|926201|30|NC_017524|CRT matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
446. spacer 5.10|926201|30|NC_017524|CRT matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
447. spacer 5.10|926201|30|NC_017524|CRT matches to MK279879 (Mycobacterium phage SassyCat97, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
448. spacer 5.10|926201|30|NC_017524|CRT matches to MN586058 (Mycobacterium phage Vaishali24, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
449. spacer 5.10|926201|30|NC_017524|CRT matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
450. spacer 5.10|926201|30|NC_017524|CRT matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
451. spacer 5.10|926201|30|NC_017524|CRT matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
452. spacer 5.10|926201|30|NC_017524|CRT matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
453. spacer 5.10|926201|30|NC_017524|CRT matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
454. spacer 5.10|926201|30|NC_017524|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
455. spacer 5.10|926201|30|NC_017524|CRT matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
456. spacer 5.10|926201|30|NC_017524|CRT matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
457. spacer 5.10|926201|30|NC_017524|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
458. spacer 5.10|926201|30|NC_017524|CRT matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
459. spacer 5.10|926201|30|NC_017524|CRT matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
460. spacer 5.10|926201|30|NC_017524|CRT matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
461. spacer 5.10|926201|30|NC_017524|CRT matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
462. spacer 5.10|926201|30|NC_017524|CRT matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
463. spacer 5.10|926201|30|NC_017524|CRT matches to MK279910 (Mycobacterium phage Antonia, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
464. spacer 5.10|926201|30|NC_017524|CRT matches to KX576643 (Mycobacterium phage FriarPreacher, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
465. spacer 5.10|926201|30|NC_017524|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
466. spacer 5.10|926201|30|NC_017524|CRT matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
467. spacer 5.10|926201|30|NC_017524|CRT matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
468. spacer 5.10|926201|30|NC_017524|CRT matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
469. spacer 5.10|926201|30|NC_017524|CRT matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
470. spacer 5.10|926201|30|NC_017524|CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
471. spacer 5.10|926201|30|NC_017524|CRT matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
472. spacer 5.10|926201|30|NC_017524|CRT matches to MH371125 (Mycobacterium phage Morty, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
473. spacer 5.10|926201|30|NC_017524|CRT matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
474. spacer 5.10|926201|30|NC_017524|CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
475. spacer 5.10|926201|30|NC_017524|CRT matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
476. spacer 5.10|926201|30|NC_017524|CRT matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
477. spacer 5.10|926201|30|NC_017524|CRT matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
478. spacer 5.10|926201|30|NC_017524|CRT matches to KR816508 (Mycobacterium phage Phamished, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
479. spacer 5.10|926201|30|NC_017524|CRT matches to JF937095 (Mycobacterium phage Harvey, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
480. spacer 5.10|926201|30|NC_017524|CRT matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
481. spacer 5.10|926201|30|NC_017524|CRT matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
482. spacer 5.10|926201|30|NC_017524|CRT matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
483. spacer 5.10|926201|30|NC_017524|CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
484. spacer 5.10|926201|30|NC_017524|CRT matches to MK279890 (Mycobacterium phage Veritas, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
485. spacer 5.10|926201|30|NC_017524|CRT matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
486. spacer 5.10|926201|30|NC_017524|CRT matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgacaccggccgcgacgccggcgtgctgac Protospacer
**. ***** *********** *****..
487. spacer 5.10|926201|30|NC_017524|CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
488. spacer 5.10|926201|30|NC_017524|CRT matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
489. spacer 5.10|926201|30|NC_017524|CRT matches to MK279864 (Mycobacterium phage Mag7, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
490. spacer 5.10|926201|30|NC_017524|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
491. spacer 5.10|926201|30|NC_017524|CRT matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
492. spacer 5.10|926201|30|NC_017524|CRT matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
493. spacer 5.10|926201|30|NC_017524|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
494. spacer 5.10|926201|30|NC_017524|CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
495. spacer 5.10|926201|30|NC_017524|CRT matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
496. spacer 5.10|926201|30|NC_017524|CRT matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
497. spacer 5.10|926201|30|NC_017524|CRT matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
498. spacer 5.10|926201|30|NC_017524|CRT matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
499. spacer 5.10|926201|30|NC_017524|CRT matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
500. spacer 5.10|926201|30|NC_017524|CRT matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
501. spacer 5.10|926201|30|NC_017524|CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
502. spacer 5.10|926201|30|NC_017524|CRT matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
503. spacer 5.10|926201|30|NC_017524|CRT matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
504. spacer 5.10|926201|30|NC_017524|CRT matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
505. spacer 5.10|926201|30|NC_017524|CRT matches to KT599441 (Mycobacterium phage Squid, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
506. spacer 5.10|926201|30|NC_017524|CRT matches to MG925346 (Mycobacterium phage LeeLot, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
507. spacer 5.10|926201|30|NC_017524|CRT matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
508. spacer 5.10|926201|30|NC_017524|CRT matches to MG925348 (Mycobacterium phage Megatron, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
509. spacer 5.10|926201|30|NC_017524|CRT matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
510. spacer 5.10|926201|30|NC_017524|CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
511. spacer 5.10|926201|30|NC_017524|CRT matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
512. spacer 5.10|926201|30|NC_017524|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
513. spacer 5.10|926201|30|NC_017524|CRT matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
514. spacer 5.10|926201|30|NC_017524|CRT matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
515. spacer 5.10|926201|30|NC_017524|CRT matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
516. spacer 5.10|926201|30|NC_017524|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
517. spacer 5.10|926201|30|NC_017524|CRT matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
518. spacer 5.10|926201|30|NC_017524|CRT matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
519. spacer 5.10|926201|30|NC_017524|CRT matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
520. spacer 5.10|926201|30|NC_017524|CRT matches to MH576958 (Mycobacterium phage MichaelPhcott, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
521. spacer 5.10|926201|30|NC_017524|CRT matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
522. spacer 5.10|926201|30|NC_017524|CRT matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
523. spacer 5.10|926201|30|NC_017524|CRT matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
524. spacer 5.10|926201|30|NC_017524|CRT matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
525. spacer 5.10|926201|30|NC_017524|CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
526. spacer 5.10|926201|30|NC_017524|CRT matches to MK524526 (Mycobacterium phage Robyn, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
527. spacer 5.10|926201|30|NC_017524|CRT matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
528. spacer 5.10|926201|30|NC_017524|CRT matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
529. spacer 5.10|926201|30|NC_017524|CRT matches to MH316568 (Mycobacterium phage Phleuron, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
530. spacer 5.10|926201|30|NC_017524|CRT matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
531. spacer 5.10|926201|30|NC_017524|CRT matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
532. spacer 5.10|926201|30|NC_017524|CRT matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
533. spacer 5.10|926201|30|NC_017524|CRT matches to KJ595576 (Mycobacterium phage Manad, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
534. spacer 5.10|926201|30|NC_017524|CRT matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgacaccggccgcgacgccggcgtgctgac Protospacer
**. ***** *********** *****..
535. spacer 5.10|926201|30|NC_017524|CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
536. spacer 5.10|926201|30|NC_017524|CRT matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
537. spacer 5.10|926201|30|NC_017524|CRT matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
538. spacer 5.10|926201|30|NC_017524|CRT matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
539. spacer 5.10|926201|30|NC_017524|CRT matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
540. spacer 5.10|926201|30|NC_017524|CRT matches to KX683292 (Mycobacterium phage Held, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
541. spacer 5.10|926201|30|NC_017524|CRT matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
542. spacer 5.10|926201|30|NC_017524|CRT matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
543. spacer 5.10|926201|30|NC_017524|CRT matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
544. spacer 5.10|926201|30|NC_017524|CRT matches to KT364588 (Mycobacterium phage Hetaeria, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
545. spacer 5.10|926201|30|NC_017524|CRT matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
546. spacer 5.10|926201|30|NC_017524|CRT matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
547. spacer 5.10|926201|30|NC_017524|CRT matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
548. spacer 5.10|926201|30|NC_017524|CRT matches to MH926060 (Mycobacterium phage Schadenfreude, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
549. spacer 5.10|926201|30|NC_017524|CRT matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
550. spacer 5.10|926201|30|NC_017524|CRT matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
551. spacer 5.10|926201|30|NC_017524|CRT matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
552. spacer 5.10|926201|30|NC_017524|CRT matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
553. spacer 5.10|926201|30|NC_017524|CRT matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
554. spacer 5.10|926201|30|NC_017524|CRT matches to MH576967 (Mycobacterium phage UAch1, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
555. spacer 5.10|926201|30|NC_017524|CRT matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
556. spacer 5.10|926201|30|NC_017524|CRT matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
557. spacer 5.10|926201|30|NC_017524|CRT matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
558. spacer 5.10|926201|30|NC_017524|CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
559. spacer 5.10|926201|30|NC_017524|CRT matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
560. spacer 5.10|926201|30|NC_017524|CRT matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
561. spacer 5.10|926201|30|NC_017524|CRT matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
562. spacer 5.10|926201|30|NC_017524|CRT matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
563. spacer 5.10|926201|30|NC_017524|CRT matches to GQ303259 (Mycobacterium phage Colbert, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
564. spacer 5.10|926201|30|NC_017524|CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
565. spacer 5.10|926201|30|NC_017524|CRT matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
566. spacer 5.10|926201|30|NC_017524|CRT matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
567. spacer 5.10|926201|30|NC_017524|CRT matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
568. spacer 5.10|926201|30|NC_017524|CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
569. spacer 5.10|926201|30|NC_017524|CRT matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
570. spacer 5.10|926201|30|NC_017524|CRT matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
571. spacer 5.10|926201|30|NC_017524|CRT matches to JF704091 (Mycobacterium phage ABU, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
572. spacer 5.10|926201|30|NC_017524|CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
573. spacer 5.10|926201|30|NC_017524|CRT matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
574. spacer 5.10|926201|30|NC_017524|CRT matches to MG962363 (Mycobacterium phage BatteryCK, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
575. spacer 5.10|926201|30|NC_017524|CRT matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
576. spacer 5.10|926201|30|NC_017524|CRT matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
577. spacer 5.10|926201|30|NC_017524|CRT matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
578. spacer 5.10|926201|30|NC_017524|CRT matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
579. spacer 5.10|926201|30|NC_017524|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
580. spacer 5.10|926201|30|NC_017524|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
581. spacer 5.10|926201|30|NC_017524|CRT matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
582. spacer 5.10|926201|30|NC_017524|CRT matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
583. spacer 5.10|926201|30|NC_017524|CRT matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
584. spacer 5.10|926201|30|NC_017524|CRT matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
585. spacer 5.10|926201|30|NC_017524|CRT matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgaccccggccaggaagg Protospacer
*** ************ ****** * .*
586. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgggcctggcggcgacgctggccttcctgg Protospacer
.*****.***********.***** *. *
587. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gcgtcccggcgccgacgccggcccgcttgg Protospacer
* ******* ***********.*** *
588. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP009963 (Collimonas arenae strain Cal35 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggccgccggcggcggcgccggccagctgat Protospacer
* *********.******** ****.*
589. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgaagctgccggcgacgacggcctgctggt Protospacer
.*.. *.* ******** ************
590. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ctggcccggcggcggcgccggccggtccat Protospacer
* ************.******** *.. .*
591. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_LN997849 (Magnetospirillum sp. XM-1 isolate XM1 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggtctcggcggcgacgccggccagggcga Protospacer
*** *.***************** * *
592. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggcgatggcggcgacgtcggcctgctgag Protospacer
*** .**********.**********.
593. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP023739 (Methylosinus trichosporium OB3b plasmid pOB3b2, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ccgcgccgccggcgatgccggcctgctgtc Protospacer
* * *** ******.************ .
594. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 7, identity: 0.767
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggaaacaggcggcgatgccggcctgctgct Protospacer
*.. * ********.************ *
595. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
596. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
597. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgggc---ccggcggcgacgccggcctgctggt CRISPR spacer
---gctcaccggcggcgacgacggcctgcgcgg Protospacer
** ************ ******** *
598. spacer 8.1|1571158|28|NC_017524|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
599. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
600. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
601. spacer 10.3|2082118|30|NC_017524|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
602. spacer 10.3|2082118|30|NC_017524|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
603. spacer 10.3|2082118|30|NC_017524|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
604. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
605. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
606. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
607. spacer 1.3|333538|30|NC_017524|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
agcacgaagccgaagagaaagccgccgatg Protospacer
.**.********** ********* *
608. spacer 1.12|334018|30|NC_017524|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
609. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
610. spacer 1.12|334018|30|NC_017524|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
611. spacer 1.12|334018|30|NC_017524|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
612. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
613. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
614. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
615. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
616. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
617. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
618. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
619. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggcggagagcggcgacgccggcctgcggga Protospacer
* * .****************** **
620. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
catcggcggcggcgacggcggcctgctgcg Protospacer
*. *********** **********
621. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgggcgcggcggcgacgccgacctcgaccc Protospacer
***** **************.*** .
622. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgcggttcgcggcgacgcccgcctgctgga Protospacer
.* * .. *********** *********
623. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggccccggcggcgacgccggggttcgcac Protospacer
*** ***************** * * ..
624. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctgcacggcggcgacgccagcctgcgcaa Protospacer
* ** *************.****** .
625. spacer 5.10|926201|30|NC_017524|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gctgcccggcggcgatcccggcctgcagcg Protospacer
************. ********* *
626. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ccagcccggcggcggcgccggccagcgcca Protospacer
* .***********.******** **
627. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gccgaccggcggcgccgccggcatgctgac Protospacer
* ********* ******* *****..
628. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgccgacggcagcgacggcggcctgctggc Protospacer
.* ****.****** ***********.
629. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgccgacggcagcgacggcggcctgctggc Protospacer
.* ****.****** ***********.
630. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cctcagcggcaccgacgccggcctgctggc Protospacer
* ****. *****************.
631. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gctgaacggccgcgacgccggccggctgga Protospacer
* **** ************ *****
632. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
aatgggcggcgccgaggccggcctgctggc Protospacer
. * ***** *** *************.
633. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP011275 (Planctomyces sp. SH-PL62 plasmid pPL62-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cggggccggccgcgacgccggccccgccgc Protospacer
**** ***** ************. . *.
634. spacer 5.10|926201|30|NC_017524|CRT matches to MF919500 (Mycobacterium phage Dalmatian, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgggcgcggcggcgaagccggccggtaacg Protospacer
***** ********* ******* *. .
635. spacer 5.10|926201|30|NC_017524|CRT matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
636. spacer 5.10|926201|30|NC_017524|CRT matches to KP027207 (Mycobacterium phage Chandler, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
637. spacer 5.10|926201|30|NC_017524|CRT matches to MN096360 (Mycobacterium phage Rita1961, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
638. spacer 5.10|926201|30|NC_017524|CRT matches to MG839014 (Mycobacterium phage RagingRooster, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
639. spacer 5.10|926201|30|NC_017524|CRT matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
640. spacer 5.10|926201|30|NC_017524|CRT matches to KR080203 (Mycobacterium phage OrangeOswald, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
641. spacer 5.10|926201|30|NC_017524|CRT matches to MH513976 (Mycobacterium phage Morty007, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
642. spacer 5.10|926201|30|NC_017524|CRT matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
643. spacer 5.10|926201|30|NC_017524|CRT matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
644. spacer 5.10|926201|30|NC_017524|CRT matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttag Protospacer
*. ****** ********* ****** .
645. spacer 5.10|926201|30|NC_017524|CRT matches to MK359357 (Mycobacterium phage RomaT, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
646. spacer 5.10|926201|30|NC_017524|CRT matches to JF704095 (Mycobacterium phage Daisy, complete sequence) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttag Protospacer
*. ****** ********* ****** .
647. spacer 5.10|926201|30|NC_017524|CRT matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
648. spacer 5.10|926201|30|NC_017524|CRT matches to MN096359 (Mycobacterium phage Obutu, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
649. spacer 5.10|926201|30|NC_017524|CRT matches to MK061414 (Mycobacterium phage Marley1013, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
650. spacer 5.10|926201|30|NC_017524|CRT matches to MF919490 (Mycobacterium phage Anselm, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgggcgcggcggcgaagccggccggtaacg Protospacer
***** ********* ******* *. .
651. spacer 5.10|926201|30|NC_017524|CRT matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
652. spacer 5.10|926201|30|NC_017524|CRT matches to MG925353 (Mycobacterium phage Nozo, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
653. spacer 5.10|926201|30|NC_017524|CRT matches to KX576639 (Mycobacterium phage DudeLittle, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgggcgcggcggcgaagccggccggtaacg Protospacer
***** ********* ******* *. .
654. spacer 5.10|926201|30|NC_017524|CRT matches to KJ194584 (Mycobacterium phage Heathcliff, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
655. spacer 5.10|926201|30|NC_017524|CRT matches to MN444872 (Mycobacterium phage SynergyX, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
656. spacer 5.10|926201|30|NC_017524|CRT matches to MH576977 (Mycobacterium phage Tydolla, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
657. spacer 5.10|926201|30|NC_017524|CRT matches to MG925338 (Mycobacterium phage ChaChing, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
658. spacer 5.10|926201|30|NC_017524|CRT matches to NC_023742 (Mycobacterium phage Akoma, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
659. spacer 5.10|926201|30|NC_017524|CRT matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
660. spacer 5.10|926201|30|NC_017524|CRT matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
661. spacer 5.10|926201|30|NC_017524|CRT matches to KR080205 (Mycobacterium phage Corofin, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
662. spacer 5.10|926201|30|NC_017524|CRT matches to MF472896 (Mycobacterium phage JoshKayV, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
cgggcgcggcggcgaagccggccggtaacg Protospacer
***** ********* ******* *. .
663. spacer 5.10|926201|30|NC_017524|CRT matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
664. spacer 5.10|926201|30|NC_017524|CRT matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttag Protospacer
*. ****** ********* ****** .
665. spacer 5.10|926201|30|NC_017524|CRT matches to KF493879 (Mycobacterium phage Bernardo, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttag Protospacer
*. ****** ********* ****** .
666. spacer 5.10|926201|30|NC_017524|CRT matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttag Protospacer
*. ****** ********* ****** .
667. spacer 5.10|926201|30|NC_017524|CRT matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
668. spacer 5.10|926201|30|NC_017524|CRT matches to NC_012027 (Mycobacterium phage Phlyer, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
669. spacer 5.10|926201|30|NC_017524|CRT matches to MN444873 (Mycobacterium phage Abinghost, complete genome) position: , mismatch: 8, identity: 0.733
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
ggatcccggccgcgacgccgccctgcttcg Protospacer
*. ****** ********* ******
670. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
671. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
672. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
673. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
674. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
675. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
676. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
677. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
678. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
679. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
680. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
681. spacer 10.3|2082118|30|NC_017524|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
682. spacer 10.3|2082118|30|NC_017524|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
683. spacer 15.7|3739509|31|NC_017524|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
684. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
685. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
686. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
687. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
688. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
689. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
690. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
691. spacer 15.7|3739509|31|NC_017524|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
692. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
693. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
694. spacer 15.7|3739509|31|NC_017524|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
695. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
696. spacer 15.7|3739509|31|NC_017524|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
697. spacer 15.7|3739509|31|NC_017524|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
698. spacer 15.7|3739509|31|NC_017524|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
699. spacer 1.13|334066|39|NC_017524|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag Protospacer
***. *. **************** *** *******
700. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
701. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
702. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
703. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
704. spacer 3.2|631000|30|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
705. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
706. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
707. spacer 4.1|691703|31|NC_017524|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
708. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 9, identity: 0.7
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgtcggcggcggcgacgccggccggctccg Protospacer
.* ***************** ***
709. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
agggcgcagcggcgacgccggcctatcttg Protospacer
**** *.****************...
710. spacer 5.10|926201|30|NC_017524|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 9, identity: 0.7
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
tgatggaggcggcgacgccggcctcctgcg Protospacer
.*. ***************** ***
711. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
712. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
713. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
714. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
715. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
716. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
717. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
718. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
719. spacer 15.5|3739368|34|NC_017524|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
720. spacer 15.5|3739368|34|NC_017524|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
721. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
722. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
723. spacer 2.6|369159|33|NC_017524|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
724. spacer 5.2|925838|39|NC_017524|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
725. spacer 5.5|925991|36|NC_017524|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
726. spacer 5.5|925991|36|NC_017524|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
727. spacer 5.5|925991|36|NC_017524|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
728. spacer 5.5|925991|36|NC_017524|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
729. spacer 5.5|925991|36|NC_017524|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
730. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667
cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gattgccggcggcgacgccggccagcacca Protospacer
. ****************** **
731. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
732. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
733. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
734. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
735. spacer 8.10|1571773|31|NC_017524|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
736. spacer 8.13|1572022|34|NC_017524|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
737. spacer 12.9|3114873|35|NC_017524|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
738. spacer 14.12|3119597|34|NC_017524|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
739. spacer 15.5|3739368|34|NC_017524|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
740. spacer 15.5|3739368|34|NC_017524|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
741. spacer 15.5|3739368|34|NC_017524|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
742. spacer 15.5|3739368|34|NC_017524|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
743. spacer 15.9|3739641|37|NC_017524|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.73
cttgccggcggtgccggcgaccgcggtgccgccggtg CRISPR spacer
ggagacggcggtgccggagaccgcggtgtcgctgccc Protospacer
* ************ **********.***.* .
744. spacer 15.5|3739368|34|NC_017524|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
745. spacer 5.10|926201|30|NC_017524|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.6
----cgggcccggcggcgacgccggcctgctggt CRISPR spacer
gtcagcatgccggcggcgccgccggtcggc---- Protospacer
. ********* ******.* **