Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017377 Helicobacter pylori Puno120 plasmid pHPPN120, complete sequence 0 crisprs NA 0 0 0 0
NC_017378 Helicobacter pylori Puno120, complete genome 2 crisprs cas2,csx1,RT,DEDDh 0 1 0 0

Results visualization

1. NC_017378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017378_1 339193-339305 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017378_2 922696-922784 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017378_2 2.1|922728|25|NC_017378|CRISPRCasFinder 922728-922752 25 NC_031922 Synechococcus phage S-CAM9 isolate 1109NB16, complete genome 27227-27251 3 0.88
NC_017378_2 2.1|922728|25|NC_017378|CRISPRCasFinder 922728-922752 25 KU686204 Synechococcus phage S-CAM9 isolate 0808SB05, complete genome 27227-27251 3 0.88
NC_017378_2 2.1|922728|25|NC_017378|CRISPRCasFinder 922728-922752 25 KU686205 Synechococcus phage S-CAM9 isolate 0908SB82, complete genome 27227-27251 3 0.88

1. spacer 2.1|922728|25|NC_017378|CRISPRCasFinder matches to NC_031922 (Synechococcus phage S-CAM9 isolate 1109NB16, complete genome) position: , mismatch: 3, identity: 0.88

tgtttttaacaacagcaatttcaac	CRISPR spacer
tgttatttacaacagcaatttcacc	Protospacer
**** ** *************** *

2. spacer 2.1|922728|25|NC_017378|CRISPRCasFinder matches to KU686204 (Synechococcus phage S-CAM9 isolate 0808SB05, complete genome) position: , mismatch: 3, identity: 0.88

tgtttttaacaacagcaatttcaac	CRISPR spacer
tgttatttacaacagcaatttcacc	Protospacer
**** ** *************** *

3. spacer 2.1|922728|25|NC_017378|CRISPRCasFinder matches to KU686205 (Synechococcus phage S-CAM9 isolate 0908SB82, complete genome) position: , mismatch: 3, identity: 0.88

tgtttttaacaacagcaatttcaac	CRISPR spacer
tgttatttacaacagcaatttcacc	Protospacer
**** ** *************** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage