Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015968 Enterobacter soli, complete sequence 1 crisprs RT,cas3,DEDDh,csa3,WYL,DinG 1 0 5 0
NC_015969 Enterobacter soli plasmid pENTAS02, complete sequence 0 crisprs NA 0 0 1 0
NC_015963 Enterobacter soli plasmid pENTAS01, complete sequence 1 crisprs NA 0 1 1 0

Results visualization

1. NC_015968
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015968_1 540230-540376 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_015968_1 1.1|540283|41|NC_015968|CRISPRCasFinder 540283-540323 41 NC_015968.1 452270-452310 0 1.0
NC_015968_1 1.1|540283|41|NC_015968|CRISPRCasFinder 540283-540323 41 NC_015968.1 3999547-3999587 1 0.976

1. spacer 1.1|540283|41|NC_015968|CRISPRCasFinder matches to position: 452270-452310, mismatch: 0, identity: 1.0

aaggtaaaagcaaaacggcaacctcggttgccgtttttagt	CRISPR spacer
aaggtaaaagcaaaacggcaacctcggttgccgtttttagt	Protospacer
*****************************************

2. spacer 1.1|540283|41|NC_015968|CRISPRCasFinder matches to position: 3999547-3999587, mismatch: 1, identity: 0.976

aaggtaaaagcaaaacggcaacctcggttgccgtttttagt	CRISPR spacer
aaggtaaatgcaaaacggcaacctcggttgccgtttttagt	Protospacer
******** ********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2146908 : 2155490 10 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_2 2863178 : 2911035 68 Cronobacter_phage(28.85%) integrase,head,tail,holin,terminase attL 2896643:2896658|attR 2916526:2916541
DBSCAN-SWA_3 2973526 : 2981334 7 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_4 3262336 : 3352527 97 Enterobacteria_phage(16.67%) tRNA,integrase,head,tail,holin,portal,terminase,protease,capsid attL 3307690:3307707|attR 3353246:3353263
DBSCAN-SWA_5 4190828 : 4293257 95 uncultured_Caudovirales_phage(50.0%) tRNA,integrase,head,tail,portal,terminase,protease,capsid attL 4213227:4213250|attR 4297686:4297709
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_015969
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 55 : 32350 39 Enterobacteria_phage(42.86%) head,integrase,terminase,plate,holin,tail,capsid,portal attL 6944:6955|attR 32369:32380
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_015963
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015963_1 145565-145694 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015963_1 1.1|145606|48|NC_015963|CRISPRCasFinder 145606-145653 48 NC_015963 UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS01, complete sequence 145606-145653 0 1.0

1. spacer 1.1|145606|48|NC_015963|CRISPRCasFinder matches to NC_015963 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS01, complete sequence) position: , mismatch: 0, identity: 1.0

gtacgacatctgcatcccagaccgaaacctcactgttctttgatgaga	CRISPR spacer
gtacgacatctgcatcccagaccgaaacctcactgttctttgatgaga	Protospacer
************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88327 : 130024 34 Escherichia_phage(57.14%) integrase,transposase,plate attL 119668:119681|attR 122020:122033
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage