Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_016010 Xanthomonas axonopodis pv. citrumelo F1, complete sequence 2 crisprs cas3,WYL,DEDDh,csa3,DinG 0 1 2 0

Results visualization

1. NC_016010
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016010_1 1563412-1563493 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016010_2 1708608-1708728 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_016010_2 2.2|1708678|35|NC_016010|PILER-CR 1708678-1708712 35 NZ_CP020333 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence 127336-127370 10 0.714

1. spacer 2.2|1708678|35|NC_016010|PILER-CR matches to NZ_CP020333 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence) position: , mismatch: 10, identity: 0.714

gtcggcgctcactgcggcggccccgttgatctgcg	CRISPR spacer
aagtttgctcacttcggcggccacgttgatctctg	Protospacer
.    .******* ******** ********* .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2406035 : 2444630 29 Enterobacteria_phage(20.0%) plate,transposase NA
DBSCAN-SWA_2 4055258 : 4063299 7 Enterobacteria_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage