1. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 4, identity: 0.867
gtcaccagggcgatgccgatcacccgcacg- CRISPR spacer
gtcagcagcgcgatgccgatca-ccgcaggc Protospacer
**** *** ************* ***** *
2. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gccgccgggaccggggcgcaggcgatc-tacaa CRISPR spacer
gccgccgaggccggggcgcaggcgatcatgct- Protospacer
*******.*.***************** *.*
3. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gccgccgggaccggggcgcaggcgatc-tacaa CRISPR spacer
gccgccgaggccggggcgcaggcgatcatgct- Protospacer
*******.*.***************** *.*
4. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 5, identity: 0.844
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
cgccgaccgcctgagccgcgaggcccaggggt Protospacer
.************** ********* *** *
5. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
tgccgaccgcctgaggcgcgaggc-cgaggtga CRISPR spacer
ggccgaccgcctgcggcgcgaggcgcgcgatg- Protospacer
************ ********** ** *.**
6. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to CP000664 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence) position: , mismatch: 5, identity: 0.833
ggctggcgctttcgaccggctacgtcatgg-- CRISPR spacer
cgctggcgctttcgaccgcctac--cagggcg Protospacer
***************** **** ** **
7. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 5, identity: 0.833
gtcaccagggcgatgccgatcacccgcacg- CRISPR spacer
ttcacccggccgatgccgatcaccc-cgcgc Protospacer
***** ** *************** *.**
8. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_042132 (Gordonia phage Sour, complete genome) position: , mismatch: 5, identity: 0.833
gtcaccagggcgatgccgatca---cccgcacg CRISPR spacer
gtcgccagggcgatgccgatcaacgcccac--- Protospacer
***.****************** ***.*
9. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 5, identity: 0.833
gtcaccagg-gcgatgccgatcacccgcacg CRISPR spacer
-tagccgggcgcgatgccgttcacccgcacg Protospacer
* .**.** ********* ***********
10. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MH744418 (Streptomyces phage JustBecause, complete genome) position: , mismatch: 5, identity: 0.844
ctggcccgcgccatggccggtggtg-gcgcgat CRISPR spacer
ctggcccgcgccatggacggaggggtgcgcgt- Protospacer
**************** *** ** * *****
11. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MT310898 (Streptomyces phage Kela, complete genome) position: , mismatch: 5, identity: 0.844
ctggcccgcgccatggccggtggtg-gcgcgat CRISPR spacer
ctggcccgcgccatggacggaggggtgcgcgt- Protospacer
**************** *** ** * *****
12. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 5, identity: 0.844
atcgccgacgccgccctggtcgaggctaaccg- CRISPR spacer
ttcgccgacgccggcctggccga-gctgaccgc Protospacer
************ *****.*** ***.****
13. spacer 11.8|1694538|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_007641 (Rhodospirillum rubrum ATCC 11170 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.857
ccaacccggacgtcgccgccgccgtcaaacgcggg- CRISPR spacer
ccaaccctgacgtcgccgccgccgt-gaccgccggc Protospacer
******* ***************** .* *** **
14. spacer 11.29|1695905|32|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.844
--ccccggctcggcgtcctccccccacccgttgg CRISPR spacer
tgacccg--tcggcgtcctccccccaccccttcg Protospacer
**** ******************** ** *
15. spacer 11.29|1695905|32|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.844
--ccccggctcggcgtcctccccccacccgttgg CRISPR spacer
tgacccg--tcggcgtcctccccccaccccttcg Protospacer
**** ******************** ** *
16. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.806
accaggatatcggggccgtggccgaggaggc CRISPR spacer
agcaggtcatcggggccgtggccgaggtcga Protospacer
* **** .******************* *
17. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.806
---accaggatatcggggccgtggccgaggaggc CRISPR spacer
tgaatcag---atcgtgcccgtggccgaggaggc Protospacer
*.*** **** * ****************
18. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
19. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
20. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
21. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
22. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
23. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
24. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
25. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
26. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
27. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
28. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
29. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
30. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
31. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
32. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
33. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
34. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
35. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
36. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
37. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
38. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
39. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
40. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
41. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
42. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
43. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
44. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
45. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
46. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
47. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
48. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
49. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
50. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
51. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
52. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
53. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
54. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
55. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
56. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
57. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
58. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
59. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
60. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
61. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
62. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
63. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
64. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
65. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
66. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
67. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
68. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
69. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
70. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
71. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
72. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
73. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
74. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
75. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgg---gtggatt CRISPR spacer
gcggccggcgcggacgagggccggtacgcgg--- Protospacer
** ***** *************** *.**
76. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
gctgccggggcggacgagggccgggtggatt- CRISPR spacer
tctgccggggcgggcgaggg-caggtggagag Protospacer
************.****** *.******
77. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
gcctcaacggccgcggcctcaagggccgcca Protospacer
. *.* ****** ************.*****
78. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 6, identity: 0.806
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
agatctccggcctcggcctcaaggggcgccc Protospacer
** .*. ****************** ****
79. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to MK411746 (Arthrobacter phage Sonali, complete genome) position: , mismatch: 6, identity: 0.806
----agccccacggcctcggcctcaagggtcgcca CRISPR spacer
cggtagc----tggcctcggccccaagggtcgcca Protospacer
*** .**********.************
80. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 6, identity: 0.806
agcccca-cggcctcggcctcaagggtcgcca CRISPR spacer
-gcgacattggcctcggcctccagggtcgccg Protospacer
** ** .************ *********.
81. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 6, identity: 0.806
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
agtccaacggcctcggcctcaagcgaggcga Protospacer
**.** ***************** * ** *
82. spacer 2.14|199501|31|NC_017584|CRISPRCasFinder matches to NC_028662 (Mycobacterium phage Phlei, complete genome) position: , mismatch: 6, identity: 0.806
ggcgccggtgaagtcggccttccagcctaag CRISPR spacer
ggtcgcggtgtagtcggccttccagcctcgg Protospacer
**. ***** ***************** .*
83. spacer 2.17|199684|31|NC_017584|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
ggggcagatgggcgacttcagggcgctgctg CRISPR spacer
gttgcagatgggcgccttcacggcgctggcg Protospacer
* *********** ***** ******* .*
84. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to MK411746 (Arthrobacter phage Sonali, complete genome) position: , mismatch: 6, identity: 0.812
----agccccacggcctcggcctcaagggtcgccat CRISPR spacer
cggtagc----tggcctcggccccaagggtcgccat Protospacer
*** .**********.*************
85. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
cgccgccgggaccggggcgcaggcgatc-tacaa CRISPR spacer
ggccgccgaggccggggcgcaggcgatcatgct- Protospacer
*******.*.***************** *.*
86. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
cgccgccgggaccggggcgcaggcgatc-tacaa CRISPR spacer
ggccgccgaggccggggcgcaggcgatcatgct- Protospacer
*******.*.***************** *.*
87. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN369755 (Mycobacterium phage Minnie, complete genome) position: , mismatch: 6, identity: 0.812
gcgcgggcatcatctgccccgcacaccatagc- CRISPR spacer
ccgcgggcatcatcggccccggac-tcacagca Protospacer
************* ****** ** .**.***
88. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MT897904 (Mycobacterium phage Royals2015, complete genome) position: , mismatch: 6, identity: 0.812
gcgcgggcatcatctgccccgcacaccatagc- CRISPR spacer
ccgcgggcatcatcggccccggac-tcacagca Protospacer
************* ****** ** .**.***
89. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KM101124 (Mycobacterium phage Squirty, complete genome) position: , mismatch: 6, identity: 0.812
gcgcgggcatcatctgccccgcacaccatagc- CRISPR spacer
ccgcgggcatcatcggccccggac-tcacagca Protospacer
************* ****** ** .**.***
90. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MH825707 (Mycobacterium phage MilleniumForce, complete genome) position: , mismatch: 6, identity: 0.812
gcgcgggcatcatctgccccgcacaccatagc- CRISPR spacer
ccgcgggcatcatcggccccggac-tcacagca Protospacer
************* ****** ** .**.***
91. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 6, identity: 0.812
gccgccgggaccggggcgcaggc--gatctacaa CRISPR spacer
gccgccggggccggggtgcaggcatgacctcc-- Protospacer
*********.******.****** **.** *
92. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.812
-gacatcgacacgcctccgccgacgacggccac CRISPR spacer
ccacaacg-cacgcctcggccgccgacggccaa Protospacer
*** ** ******** **** *********
93. spacer 5.45|421582|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 6, identity: 0.812
-acgatcgggtctttgcgccagttcggcgacca CRISPR spacer
cgcgat-gcttcgttgcgccagttcggcgccca Protospacer
.**** * ** **************** ***
94. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
tctcgcgcgcctgaggcaggaggccgaggtga Protospacer
* .** **********. *************
95. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP029987 (Sphingomonas sp. FARSPH plasmid p02, complete sequence) position: , mismatch: 6, identity: 0.812
tgccgaccgcctgaggcgcgaggccgaggtga-- CRISPR spacer
tgccgaccgcctgctgcgcgagg--aaggtgctt Protospacer
************* ******** .*****
96. spacer 5.65|421886|33|NC_017584|PILER-CR matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 6, identity: 0.818
ctgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
tcgccgaccgcctgagccgcgaggcccaggggt Protospacer
..************** ********* *** *
97. spacer 6.1|530092|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.8
cgtggcggcgaccaatgcggcattcgagct CRISPR spacer
tgcgccggcggccaatgcggcattcgtgcc Protospacer
.*.* *****.*************** **.
98. spacer 6.1|530092|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgtggcggcgaccaatgcggcattcgagct CRISPR spacer
tgcgccggcggccaatgcggcattcgtgcc Protospacer
.*.* *****.*************** **.
99. spacer 6.1|530092|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.8
cgtggcggcgaccaatgcggcattcgagct CRISPR spacer
tgcgccggcggccaatgcggcattcgtgcc Protospacer
.*.* *****.*************** **.
100. spacer 6.1|530092|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.8
cgtggcggcgaccaatgcggcattcgagct CRISPR spacer
tgcgccggcggccaatgcggcattcgtgcc Protospacer
.*.* *****.*************** **.
101. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
102. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
103. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
104. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
105. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
106. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
107. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
108. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
109. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
110. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
111. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.8
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatcg Protospacer
.* .* ************ ********* *
112. spacer 6.5|530356|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_009931 (Acaryochloris marina MBIC11017 plasmid pREB6, complete sequence) position: , mismatch: 6, identity: 0.8
catgaaaggaatgcccagatgagcaaatcc CRISPR spacer
aaggaaagaaatacccagatgagcaagttc Protospacer
* *****.***.*************.*.*
113. spacer 6.5|530356|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.8
catgaaaggaatgcccagatgagcaaatcc CRISPR spacer
cgggaaacgagtgcccagatgagcaagttc Protospacer
*. **** **.***************.*.*
114. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
--tgatccagtcatcgcccatcccggcctggg CRISPR spacer
aacgagc--gccagcgcccatcccggcctggg Protospacer
.** * *.** ******************
115. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.8
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gttcccacggcgatgccgatcacccccagc Protospacer
**. *** ***************** **
116. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
gtcaccag-ggcgatgccgatcacccgcacg CRISPR spacer
-cggccagcggcgatgccgatcaccggcacc Protospacer
. .**** **************** ****
117. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 6, identity: 0.8
gtcaccag-ggcgatgccgatcacccgcacg CRISPR spacer
-cggccagcggcgatgccgatcaccggcacc Protospacer
. .**** **************** ****
118. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 6, identity: 0.8
gtcaccagggcgatgccgatcac-ccgcacg CRISPR spacer
aacacccgggcgatgccgatcacagcgaac- Protospacer
. **** **************** ** **
119. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812
gcgtcgatc-gcgggcgcgggcgccttggccgg CRISPR spacer
-cgtggtccagcgggagcgggcgccctggccgg Protospacer
*** * .* ***** *********.*******
120. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.812
gcgtcgatc-gcgggcgcgggcgccttggccgg CRISPR spacer
-cgtggtccagcgggagcgggcgccctggccgg Protospacer
*** * .* ***** *********.*******
121. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021919 (Sagittula sp. P11 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.812
cttgcccgccccgcccgccaccacccatgggc- CRISPR spacer
gctgaccgccacgcccgccacca-ccatcggca Protospacer
.** ***** ************ **** ***
122. spacer 7.15|990337|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 6, identity: 0.824
-cgttctcggtctacatcgaccccgaggcggatac CRISPR spacer
acgacctc-ctctacatcgaccccgaggccgacac Protospacer
** .*** ******************* **.**
123. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.824
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
agacgacccccgagcccgaggccgaggaggagcc Protospacer
* ** ************** ********* **
124. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.812
atcgccgacgccgccctggtcgaggctaaccg- CRISPR spacer
atcgccgacgccgccctgctcga-gctggcgat Protospacer
****************** **** ***..* .
125. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.812
atcgccgacgccgccctggtcgaggctaaccg- CRISPR spacer
atcgccgacgccgcccttgtcga-gctggcgat Protospacer
***************** ***** ***..* .
126. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
atcgccgacgccgccctggtcgag--gctaaccg CRISPR spacer
ctcgccgacgacgccctggtcgagcagctctc-- Protospacer
********* ************* *** *
127. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 6, identity: 0.812
atcgccgac-gccgccctggtcgaggctaaccg CRISPR spacer
-gcgcaggcggccgccctggtcgtggcgaaccg Protospacer
*** *.* ************* *** *****
128. spacer 11.8|1694538|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.829
ccaacccggacgtcgccgccgccgtcaaacgcggg CRISPR spacer
ccaaccccgacgtcgccgccgccgtccgcaacggg Protospacer
******* ****************** . .****
129. spacer 11.8|1694538|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.829
ccaacccggacgtcgccgccgccgtcaaacgcggg CRISPR spacer
ccaaccccgacgtcgccgccgccgtccgcaacggg Protospacer
******* ****************** . .****
130. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
accaggatatcggggccgtggccgaggaggc CRISPR spacer
aagacgatatcgatgccgtggccgaggaagg Protospacer
* * *******. **************.*
131. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.774
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gccgagcgggcggacgaggcccgggtggagg Protospacer
**.* ************ *********
132. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 7, identity: 0.774
gctgccggggcggacgagggccgggtggatt CRISPR spacer
ggtgagcgggcggaccagggtcgggtggatc Protospacer
* ** ******** ****.*********.
133. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 7, identity: 0.774
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
acggcgatggcctcggcctcgagggccgcca Protospacer
* * *.************.****.*****
134. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 7, identity: 0.774
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
acggcgatggcctcggcctcgagggccgcca Protospacer
* * *.************.****.*****
135. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.774
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
acggcgatggcctcggcctcgagggccgcca Protospacer
* * *.************.****.*****
136. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to JQ010983 (Thermococcus prieurii virus 1, complete genome) position: , mismatch: 7, identity: 0.774
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
ctccacctggcctcggccacaagggccgcca Protospacer
** * .********** ******.*****
137. spacer 2.20|198707|32|NC_017584|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781
accaggatatcggggccgtggccgaggaggcc CRISPR spacer
agcaggtcatcggggccgtggccgaggtcgag Protospacer
* **** .******************* *
138. spacer 2.20|198707|32|NC_017584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
---accaggatatcggggccgtggccgaggaggcc CRISPR spacer
tgaatcag---atcgtgcccgtggccgaggaggcg Protospacer
*.*** **** * ****************
139. spacer 2.20|198707|32|NC_017584|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
accaggatatcggggccgtggccgaggaggcc CRISPR spacer
aagacgatatcgatgccgtggccgaggaaggc Protospacer
* * *******. **************.* *
140. spacer 2.20|198707|32|NC_017584|CRT matches to MN329674 (Mycobacterium phage JoieB, complete genome) position: , mismatch: 7, identity: 0.781
accaggatatcggggccgtggccgaggaggcc--- CRISPR spacer
aacaggatgtcggtgccgtggcc---gatgcccag Protospacer
* ******.**** ********* ** ***
141. spacer 2.20|198707|32|NC_017584|CRT matches to MH727562 (Mycobacterium phage VasuNzinga, complete genome) position: , mismatch: 7, identity: 0.781
accaggatatcggggccgtggccgaggaggcc--- CRISPR spacer
aacaggatgtcggtgccgtggcc---gatgcccag Protospacer
* ******.**** ********* ** ***
142. spacer 2.20|198707|32|NC_017584|CRT matches to MN428056 (Mycobacterium phage Pringar, complete genome) position: , mismatch: 7, identity: 0.781
accaggatatcggggccgtggccgaggaggcc--- CRISPR spacer
aacaggatgtcggtgccgtggcc---gatgcccag Protospacer
* ******.**** ********* ** ***
143. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
144. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
145. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
146. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
147. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
148. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
149. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
150. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
151. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
152. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
153. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
154. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
155. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
156. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
157. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
158. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
159. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
160. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
161. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
162. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
163. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
164. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
165. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
166. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
167. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
168. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
169. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
170. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
171. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
172. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
173. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
174. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
175. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
176. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
177. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
178. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
179. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
180. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
181. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
182. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
183. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
184. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
185. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
186. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
187. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
188. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
189. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
190. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
191. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
192. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
193. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
194. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
195. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
196. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
197. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
198. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
199. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
200. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgg---gtggatta CRISPR spacer
gcggccggcgcggacgagggccggtacgcggc--- Protospacer
** ***** *************** *.**
201. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 7, identity: 0.781
gctgccggggcggacgagggccgggtggatta CRISPR spacer
ggtgagcgggcggaccagggtcgggtggatca Protospacer
* ** ******** ****.*********.*
202. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
gcctcaacggccgcggcctcaagggccgccag Protospacer
. *.* ****** ************.*****
203. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.781
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
agatctccggcctcggcctcaaggggcgccca Protospacer
** .*. ****************** ****
204. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 7, identity: 0.781
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
agtccaacggcctcggcctcaagcgaggcgac Protospacer
**.** ***************** * ** *.
205. spacer 2.33|199501|32|NC_017584|CRT,PILER-CR matches to NC_028662 (Mycobacterium phage Phlei, complete genome) position: , mismatch: 7, identity: 0.781
ggcgccggtgaagtcggccttccagcctaagg CRISPR spacer
ggtcgcggtgtagtcggccttccagcctcgga Protospacer
**. ***** ***************** .*.
206. spacer 2.36|199684|32|NC_017584|CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ggggcagatgggcgacttcagggcgctgctgg CRISPR spacer
gttgcagatgggcgccttcacggcgctggcgc Protospacer
* *********** ***** ******* .*
207. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010625 (Phaeobacter inhibens strain P51 plasmid pP51_b, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
208. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010670 (Phaeobacter inhibens strain P57 plasmid pP57_b, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
209. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010597 (Phaeobacter inhibens strain P10 plasmid pP10_b, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
210. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010761 (Phaeobacter inhibens strain P80 plasmid pP80_e, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
211. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010604 (Phaeobacter inhibens strain P83 plasmid pP83_e, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
212. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010743 (Phaeobacter inhibens strain P59 plasmid pP59_b, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
213. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010620 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_c, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
214. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010731 (Phaeobacter inhibens strain P88 plasmid pP88_f, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
215. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP045377 (Sulfitobacter sp. THAF37 plasmid pTHAF37_e, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
caccgccgggaccggggcggaggtgacagccaa Protospacer
*.***************** ***.**. ***
216. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010653 (Phaeobacter inhibens strain P54 plasmid pP54_c, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
217. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010710 (Phaeobacter inhibens strain P66 plasmid pP66_e, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
218. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010701 (Phaeobacter inhibens strain P24 plasmid pP24_e, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
219. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010747 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_b, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
220. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP010738 (Phaeobacter inhibens strain P72 plasmid pP72_c, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
221. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa- CRISPR spacer
cgccgccgtgaccggggcgctggccg-ctgcatc Protospacer
******** *********** *** . **.**
222. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NC_018287 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_78, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
223. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP031954 (Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
224. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NC_018423 (Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
225. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP031950 (Phaeobacter inhibens strain BS107 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788
cgccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
cgccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************** ***** *** **.**
226. spacer 5.7|420727|33|NC_017584|PILER-CR matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
cctcggcaatgcgagggatcacgtcgccggagc---- CRISPR spacer
catcggcattgcgcgggatcacgtc----gagcgtca Protospacer
* ****** **** *********** ****
227. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP045377 (Sulfitobacter sp. THAF37 plasmid pTHAF37_e, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
accgccgggaccggggcggaggtgacagccaa Protospacer
.***************** ***.**. ***
228. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
ctcgacacgaccggggcgccggcgagctacaa Protospacer
.** *. *********** ***** ******
229. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010625 (Phaeobacter inhibens strain P51 plasmid pP51_b, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
230. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010670 (Phaeobacter inhibens strain P57 plasmid pP57_b, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
231. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa- CRISPR spacer
gccgccgtgaccggggcgctggccg-ctgcatc Protospacer
******* *********** *** . **.**
232. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010597 (Phaeobacter inhibens strain P10 plasmid pP10_b, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
233. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NC_018287 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_78, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
234. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP031954 (Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
235. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NC_018423 (Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
236. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010761 (Phaeobacter inhibens strain P80 plasmid pP80_e, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
237. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010604 (Phaeobacter inhibens strain P83 plasmid pP83_e, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
238. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP031950 (Phaeobacter inhibens strain BS107 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
239. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010743 (Phaeobacter inhibens strain P59 plasmid pP59_b, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
240. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010620 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_c, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
241. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010731 (Phaeobacter inhibens strain P88 plasmid pP88_f, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
242. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010653 (Phaeobacter inhibens strain P54 plasmid pP54_c, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
243. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010710 (Phaeobacter inhibens strain P66 plasmid pP66_e, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
244. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010701 (Phaeobacter inhibens strain P24 plasmid pP24_e, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
245. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010747 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_b, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
246. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP019310 (Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-3, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
247. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010738 (Phaeobacter inhibens strain P72 plasmid pP72_c, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgggaccggggcgcaggcgatctacaa--- CRISPR spacer
gccgccgggaccgtggcgctggc---ctgcatccc Protospacer
************* ***** *** **.**
248. spacer 5.31|420728|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ctcggcaatgcgagggatcacgtcgccggagc---- CRISPR spacer
atcggcattgcgcgggatcacgtc----gagcgtca Protospacer
****** **** *********** ****
249. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022081 (Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
tacatcgacacggcgccgccgacgtagaccgc Protospacer
*********** * ********* *.**.*
250. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP023519 (Burkholderia cepacia strain FDAARGOS_388 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
tacatcgacacggcgccgccgacgtagaccgc Protospacer
*********** * ********* *.**.*
251. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP007745 (Burkholderia cepacia ATCC 25416 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
tacatcgacacggcgccgccgacgtagaccgc Protospacer
*********** * ********* *.**.*
252. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP012984 (Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416) position: , mismatch: 7, identity: 0.781
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
tacatcgacacggcgccgccgacgtagaccgc Protospacer
*********** * ********* *.**.*
253. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP034556 (Burkholderia cepacia ATCC 25416 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
tacatcgacacggcgccgccgacgtagaccgc Protospacer
*********** * ********* *.**.*
254. spacer 5.45|421582|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 7, identity: 0.781
--acgatcgggtctttgcgccagttcggcgacca CRISPR spacer
tagcga--ggggctttgcgccagttcgacgacgg Protospacer
.*** *** ***************.**** .
255. spacer 5.47|421704|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ttgccgcgaatgcggcgcccccctggcggtcg CRISPR spacer
ctgccccgaatgcgacgcccccctcaccatcg Protospacer
.**** ********.********* .* .***
256. spacer 5.52|422009|32|NC_017584|CRISPRCasFinder,CRT matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 7, identity: 0.781
---catgtcgcccgcacagcgggaactggccgccc CRISPR spacer
ggacat---ggccgcacagatggaactggccgccg Protospacer
*** * ******** *************
257. spacer 5.53|422070|34|NC_017584|CRISPRCasFinder,CRT matches to KX961385 (Bordetella virus LK3, complete genome) position: , mismatch: 7, identity: 0.794
gagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
gaacggggcgaggcgcttggccaggcggctgcgg Protospacer
**.*. . *********** **.***********
258. spacer 5.53|422070|34|NC_017584|CRISPRCasFinder,CRT matches to KY000220 (Bordetella phage FP1, complete genome) position: , mismatch: 7, identity: 0.794
gagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
gaacggggcgaggcgcttggccaggcggctgcgg Protospacer
**.*. . *********** **.***********
259. spacer 5.53|422070|34|NC_017584|CRISPRCasFinder,CRT matches to KY000221 (Bordetella phage CN1, complete genome) position: , mismatch: 7, identity: 0.794
gagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
gaacggggcgaggcgcttggccaggcggctgcgg Protospacer
**.*. . *********** **.***********
260. spacer 5.53|422070|34|NC_017584|CRISPRCasFinder,CRT matches to NC_047879 (Bordetella phage MW2, complete genome) position: , mismatch: 7, identity: 0.794
gagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
gaacggggcgaggcgcttggccaggcggctgcgg Protospacer
**.*. . *********** **.***********
261. spacer 5.53|422070|34|NC_017584|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
gagcacaccgaggcgcttgcccgggcgg-ctgcgg CRISPR spacer
gccgacgccgtggcgcttgcccgggcggcctgcc- Protospacer
* **.*** ***************** ****
262. spacer 5.59|422438|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP039920 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626c, complete sequence) position: , mismatch: 7, identity: 0.781
--gttgctgttcgtcaggatcgcgccgagaagcg CRISPR spacer
gagaagcgg--cggcaggatcgcgccgagcagcg Protospacer
* ** * ** *************** ****
263. spacer 5.59|422438|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781
--gttgctgttcgtcaggatcgcgccgagaagcg CRISPR spacer
gagaagcgg--cggcaggatcgcgccgagcagcg Protospacer
* ** * ** *************** ****
264. spacer 5.59|422438|32|NC_017584|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781
gttgctgttcgtcaggatcgcgccgagaagcg CRISPR spacer
gtggcacgccgtcaggatcgcgccgtgaaacg Protospacer
** ** .**************** ***.**
265. spacer 5.65|421886|33|NC_017584|PILER-CR matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788
ctgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
atctcgcgcgcctgaggcaggaggccgaggtga Protospacer
* .** **********. *************
266. spacer 5.68|422069|35|NC_017584|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.8
cgagcacaccgaggcgcttgcccgggcgg-ctgcgg CRISPR spacer
cgccgacgccgtggcgcttgcccgggcggcctgcc- Protospacer
** **.*** ***************** ****
267. spacer 6.1|530092|30|NC_017584|CRISPRCasFinder,CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 7, identity: 0.767
cgtggcggcgaccaatgcggcattcgagct--- CRISPR spacer
tgtcgcggcgaccaatgcggcttt---gcctac Protospacer
.** ***************** ** **.
268. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
aggcgccgctttcgaccgtctacgtcatca Protospacer
.* .* ************ ********* .
269. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NC_009670 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT02, complete sequence) position: , mismatch: 7, identity: 0.767
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
tgctggcgctttcgtccggcgacgactttt Protospacer
************* ***** *** * *
270. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 7, identity: 0.767
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
acctttcgctttcgaccggcaatgtcatgt Protospacer
. ** ************** *.******
271. spacer 6.4|530290|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ggcgagccgtgcgcaccggtcctcccccca CRISPR spacer
accgagccgtccgcaccggtcctgaccgcg Protospacer
. ******** ************ ** *.
272. spacer 6.4|530290|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ggcgagccgtgcgcaccggtcctcccccca CRISPR spacer
accgagccgtccgcaccggtcctgaccgcg Protospacer
. ******** ************ ** *.
273. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
274. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
275. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
276. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
277. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
278. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
279. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
280. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
281. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
282. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
283. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
284. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
285. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
286. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
287. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
288. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
289. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
290. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
tgatcctgtcatcgccgatcccggtcgtca Protospacer
****** ********* *******.* .
291. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 7, identity: 0.767
--tgatccagtcatcgcccatcccggcctggg CRISPR spacer
aacgagc--accagcgcccatcccggcctggg Protospacer
.** * ..** ******************
292. spacer 6.6|530422|30|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015091 (Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence) position: , mismatch: 7, identity: 0.767
tgatccagtcatcgcccatcccggcctggg CRISPR spacer
gcagcgaggcatcgtccatcccggcctgga Protospacer
* * ** *****.**************.
293. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
294. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
295. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
296. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
297. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
298. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
299. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
300. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
301. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
302. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
303. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
304. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
305. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
306. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
307. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
308. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
309. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
310. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
311. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
312. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
313. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
314. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
315. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
316. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
317. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
318. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
319. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
320. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
321. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
322. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
323. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
324. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
325. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
326. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
327. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
328. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
329. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
330. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
331. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
332. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
333. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
334. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
335. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
336. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
337. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
338. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
339. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
340. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
341. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
342. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
343. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
344. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
345. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
346. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
347. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
348. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
349. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
350. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
351. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
352. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
353. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
354. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
355. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
356. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
357. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
358. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
359. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
360. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
361. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
362. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
363. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
364. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agcaccagggtgatgccgatcaccgcgccg Protospacer
. ********.************* **
365. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
ccgaccaggacgattccgatcacccgatcg Protospacer
. ******.**** *********** **
366. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
367. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
368. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
369. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
370. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
371. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
372. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
373. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
374. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
375. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
tcctccagggcgatgacgatctcccgccgg Protospacer
.* *********** ***** ***** *
376. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
377. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtgaccagggcgatgccgatgacgaactcc Protospacer
** ***************** ** .* *
378. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agccccatggcgatgccgatcaccagcgcc Protospacer
. * *** **************** **.*
379. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
380. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatctccttcatc Protospacer
.******** *********** **. **.
381. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
atcaccaggtcgatgccgatcgccttcatc Protospacer
.******** ***********.**. **.
382. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtgaccagggcgatgccgatgacgaactcc Protospacer
** ***************** ** .* *
383. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcgggcgccgcgggctcgggcgccgtggccgg Protospacer
*** ..******* ******** *******
384. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_023724 (Mycobacterium phage Larva, complete genome) position: , mismatch: 7, identity: 0.781
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcgtcgatcgccggcgctggcgccgacgtcgc Protospacer
*********** ***** ****** *.**
385. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MF185717 (Mycobacterium phage AlleyCat, complete genome) position: , mismatch: 7, identity: 0.781
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcgtcgatcgccggcgctggcgccgacgtcgc Protospacer
*********** ***** ****** *.**
386. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_028947 (Mycobacterium phage Kratio, complete genome) position: , mismatch: 7, identity: 0.781
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcgtcgatcgccggcgccggcgccgacgctgc Protospacer
*********** ***** ****** **.*
387. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
388. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
389. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
390. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
391. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
392. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
393. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
394. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
395. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
396. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcggcag-cgcgggcgcgggctcctgggccgc Protospacer
*** *.. ************* *** *****
397. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 7, identity: 0.781
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gccttcttggcgggagcggccgccttggccgg Protospacer
** *. * ***** **** ************
398. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 7, identity: 0.781
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gccttcttggcgggagcggccgccttggccgg Protospacer
** *. * ***** **** ************
399. spacer 7.4|989610|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MH976509 (Gordonia phage Bizzy, complete genome) position: , mismatch: 7, identity: 0.794
gggcacgacgccgttgatcgccttggccaccgcc-- CRISPR spacer
ccgcacgacgccgttcatcgcgttgg--accggcgt Protospacer
************* ***** **** **** *
400. spacer 7.4|989610|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MH651168 (Gordonia phage Ashertheman, complete genome) position: , mismatch: 7, identity: 0.794
gggcacgacgccgttgatcgccttggccaccgcc-- CRISPR spacer
ccgcacgacgccgttcatcgcgttgg--accggcgt Protospacer
************* ***** **** **** *
401. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggcccggcccgccaccacctcggcga Protospacer
****** **** *************. * *
402. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggcccggcccgccaccacctcggcga Protospacer
****** **** *************. * *
403. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cttgcccgccccgcccgccaccacccatgggc- CRISPR spacer
gctgtccggcccgcccgccacca-ccagggtcg Protospacer
.**.*** ************** *** ** *
404. spacer 7.14|990271|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
aaggcgtgctcgatgccgacgccggcggacagga CRISPR spacer
aaagcgtgctcgatgccgtcgccggcggcgccta Protospacer
**.*************** ********* *
405. spacer 7.14|990271|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.794
aaggcgtgctcgatgccgacgccggcggacagga CRISPR spacer
aaggcgtgctcgatgccgccgcctgccgtccagc Protospacer
****************** **** ** * * .*
406. spacer 7.23|990864|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_042345 (Phage Salvo, complete genome) position: , mismatch: 7, identity: 0.794
tggcgcagttgctctgcctcgaccgtcccggctt CRISPR spacer
tggcgcagttgttccgcctcgaccgccgcaccgt Protospacer
***********.**.**********.* *. * *
407. spacer 7.29|991256|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MF324915 (Mycobacterium phage Amgine, complete genome) position: , mismatch: 7, identity: 0.794
aagatcgatgttttcgacgagatccacgccgcgt- CRISPR spacer
tccctcggtgttttcgaccagatccacg-cgcgtc Protospacer
***.********** ********* *****
408. spacer 7.35|991650|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgagggcttgtcc---tcattgcacgccgaaaggccc CRISPR spacer
---gggattgccttcgtcattgcacgccgaacggccc Protospacer
*** ***.*. *************** *****
409. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgccgacgccgcgctggtcgaggacgtcct Protospacer
************* ********** .. **
410. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgagg--ctaaccg CRISPR spacer
atcgccgacgccgagctggtcgaggatctggt-- Protospacer
************* ********** **...
411. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgagg--ctaaccg CRISPR spacer
atcgccgacgccgagctggtcgaggatctggt-- Protospacer
************* ********** **...
412. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgagg--ctaaccg CRISPR spacer
atcgccgacgccgagctggtcgaggatctggt-- Protospacer
************* ********** **...
413. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgagg--ctaaccg CRISPR spacer
atcgccgacgccgagctggtcgaggatctggt-- Protospacer
************* ********** **...
414. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
cgcgccaacgccgccctggccgaggccaccgg Protospacer
****.************.******.* * *
415. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
accgccgccgccgccctggccgaggcccggcg Protospacer
*.***** ***********.******. . **
416. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gccgccgccgccgcccgggtcgaggccgtccg Protospacer
..***** ******** *********.. ***
417. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgag--gctaaccg CRISPR spacer
ttcgccgaagccgccatggtcgagccgctggc-- Protospacer
******* ****** ******** ***..*
418. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.781
atcgccgacgccgccctggtcgaggctaaccg- CRISPR spacer
atggccgaccccgccctggtcga-actggtcgt Protospacer
** ****** ************* .**...**
419. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.781
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
ttgtgaaggccgatcgccgcacccggatcgaa Protospacer
***.**************** **.*. **.*
420. spacer 10.9|1581108|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MT774411 (CrAssphage cr273_1, complete genome) position: , mismatch: 7, identity: 0.781
atttcgatttcagccgtcttcgttgcgtgaac CRISPR spacer
ttttcgatttcagccttcttcgttttgttgat Protospacer
************** ******** .** .*.
421. spacer 10.9|1581108|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MT774410 (CrAssphage cr272_1, complete genome) position: , mismatch: 7, identity: 0.781
atttcgatttcagccgtcttcgttgcgtgaac CRISPR spacer
ttttcgatttcagccttcttcgttttgttgat Protospacer
************** ******** .** .*.
422. spacer 10.16|1581535|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
tgcgcgcca----gtttgcgaggatgagggcgatca CRISPR spacer
----ggccacgatgtttgcgaggatgatggcgacca Protospacer
**** ************** *****.**
423. spacer 10.17|1581596|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 7, identity: 0.781
gacgccggcgagatgtccatgaaggactacgt CRISPR spacer
gtcgccgtcgagatggccatgaaggccgtcga Protospacer
* ***** ******* ********* * **
424. spacer 11.9|1694604|34|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 7, identity: 0.794
catacgccg-cgagctgcttggcttctcgcaggca CRISPR spacer
-ccgcgccgccgagcggcttggctgctcgcaggcc Protospacer
..***** ***** ******** *********
425. spacer 11.29|1695905|32|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.781
ccccggctcggcgtcctccccccacccgttgg-- CRISPR spacer
gtgcgtctcggcctcctccccccaccc--tggta Protospacer
. ** ****** ************** ***
426. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
accaggatatcggggccgtggccgaggaggc CRISPR spacer
tcgcgcgaatcggggcctttgccgaggaggc Protospacer
* * . ********* * ***********
427. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to MN329674 (Mycobacterium phage JoieB, complete genome) position: , mismatch: 8, identity: 0.742
accaggatatcggggccgtggccgaggaggc CRISPR spacer
aacaggatgtcggtgccgtggccgatgccca Protospacer
* ******.**** *********** *
428. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to MH727562 (Mycobacterium phage VasuNzinga, complete genome) position: , mismatch: 8, identity: 0.742
accaggatatcggggccgtggccgaggaggc CRISPR spacer
aacaggatgtcggtgccgtggccgatgccca Protospacer
* ******.**** *********** *
429. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to MN428056 (Mycobacterium phage Pringar, complete genome) position: , mismatch: 8, identity: 0.742
accaggatatcggggccgtggccgaggaggc CRISPR spacer
aacaggatgtcggtgccgtggccgatgccca Protospacer
* ******.**** *********** *
430. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
431. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtgttcggggcggatgagggccgggtgtaca Protospacer
*. .*********.************ *.
432. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
433. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
434. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
435. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
436. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
437. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
438. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
439. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
440. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
441. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
442. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
443. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
444. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
445. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
446. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
447. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtattcggggcggacgaggaccgggtgtaca Protospacer
*. .**************.******* *.
448. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 8, identity: 0.742
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gtcggcggcgcggacgagggccgggaggtga Protospacer
*..* *** **************** **
449. spacer 2.4|198890|31|NC_017584|CRISPRCasFinder matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 8, identity: 0.742
agatcggtccaggcccgactgcccagattga CRISPR spacer
cccttggtccaggtccggctgcccagattct Protospacer
*.********.***.***********
450. spacer 2.4|198890|31|NC_017584|CRISPRCasFinder matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 8, identity: 0.742
agatcggtccaggcccgactgcccagattga CRISPR spacer
cccttggtccaggtccggctgcccagattct Protospacer
*.********.***.***********
451. spacer 2.8|199134|32|NC_017584|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 8, identity: 0.75
accccaggccgtttgattttgctcgctgatct CRISPR spacer
accccaggcagtttgatttttctccccttcgt Protospacer
********* ********** *** *. . *
452. spacer 2.8|199134|32|NC_017584|CRISPRCasFinder matches to NZ_CP045090 (Burkholderia glumae strain GX plasmid pWSGX2, complete sequence) position: , mismatch: 8, identity: 0.75
accccaggccgtttgattttgctcgctgatct CRISPR spacer
accccaggcagtttgatttttctccccttcgt Protospacer
********* ********** *** *. . *
453. spacer 2.9|199196|31|NC_017584|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.742
tcccgccatcgcccccatgaccaagtcaagg CRISPR spacer
gcccgccatcgcccacatgaccgaggtctgc Protospacer
************* *******.** . *
454. spacer 2.9|199196|31|NC_017584|CRISPRCasFinder matches to NZ_CP032289 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.4, complete sequence) position: , mismatch: 8, identity: 0.742
tcccgccatcgcccccatgaccaagtcaagg CRISPR spacer
caccgccatcgcccccttgaccaaagatggg Protospacer
. ************** *******. .**
455. spacer 2.17|199684|31|NC_017584|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.742
ggggcagatgggcgacttcagggcgctgctg CRISPR spacer
ggggcagatgggcggcttcggggccggcgcg Protospacer
**************.****.**** .*
456. spacer 2.17|199684|31|NC_017584|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggggcagatgggcgacttcagggcgctgctg CRISPR spacer
ggggcagatgggcggcttcggggccggcgcg Protospacer
**************.****.**** .*
457. spacer 2.17|199684|31|NC_017584|CRISPRCasFinder matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 8, identity: 0.742
ggggcagatgggcgacttcagggcgctgctg CRISPR spacer
ccaggaactggtcgacttcatggcgctgctg Protospacer
.* *. *** ******** **********
458. spacer 2.18|199745|31|NC_017584|CRISPRCasFinder matches to MK494087 (Mycobacterium phage DBQu4n, complete genome) position: , mismatch: 8, identity: 0.742
aggtcgggctgtccgttgaggcgctgcagga CRISPR spacer
tgctgaagctgccccttgaggcgctgcaggg Protospacer
* * ..****.** ***************.
459. spacer 2.18|199745|31|NC_017584|CRISPRCasFinder matches to KX758538 (Mycobacterium phage Kerberos, complete genome) position: , mismatch: 8, identity: 0.742
aggtcgggctgtccgttgaggcgctgcagga CRISPR spacer
tgctgaagctgccccttgaggcgctgcaggg Protospacer
* * ..****.** ***************.
460. spacer 2.20|198707|32|NC_017584|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 8, identity: 0.75
--accaggatatcggggccgtggccgaggaggcc CRISPR spacer
tgatc--gtcgtcggcgccgtggacgaggaggcc Protospacer
*.* * ..**** ******* **********
461. spacer 2.20|198707|32|NC_017584|CRT matches to MK305892 (Mycobacterium phage RedRaider77, complete genome) position: , mismatch: 8, identity: 0.75
accaggatatcggggccgtggccgaggaggcc--- CRISPR spacer
aacaggatgtcggtgccgtggcc---gatacccag Protospacer
* ******.**** ********* ** .**
462. spacer 2.23|198890|32|NC_017584|CRT,PILER-CR matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 8, identity: 0.75
agatcggtccaggcccgactgcccagattgac CRISPR spacer
cccttggtccaggtccggctgcccagattctc Protospacer
*.********.***.*********** *
463. spacer 2.23|198890|32|NC_017584|CRT,PILER-CR matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 8, identity: 0.75
agatcggtccaggcccgactgcccagattgac CRISPR spacer
cccttggtccaggtccggctgcccagattctc Protospacer
*.********.***.*********** *
464. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 8, identity: 0.75
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
acggcgatggcctcggcctcgagggccgccac Protospacer
* * *.************.****.*****.
465. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 8, identity: 0.75
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
acggcgatggcctcggcctcgagggccgccac Protospacer
* * *.************.****.*****.
466. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.75
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
acggcgatggcctcggcctcgagggccgccac Protospacer
* * *.************.****.*****.
467. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to JQ010983 (Thermococcus prieurii virus 1, complete genome) position: , mismatch: 8, identity: 0.75
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
ctccacctggcctcggccacaagggccgccag Protospacer
** * .********** ******.*****
468. spacer 2.36|199684|32|NC_017584|CRT,PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75
ggggcagatgggcgacttcagggcgctgctgg CRISPR spacer
ggggcagatgggcggcttcggggccggcgcgg Protospacer
**************.****.**** .**
469. spacer 2.36|199684|32|NC_017584|CRT,PILER-CR matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 8, identity: 0.75
ggggcagatgggcgacttcagggcgctgctgg CRISPR spacer
ccaggaactggtcgacttcatggcgctgctgg Protospacer
.* *. *** ******** ***********
470. spacer 2.36|199684|32|NC_017584|CRT,PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75
ggggcagatgggcgacttcagggcgctgctgg CRISPR spacer
ggggcagatgggcggcttcggggccggcgcgg Protospacer
**************.****.**** .**
471. spacer 2.36|199684|32|NC_017584|CRT,PILER-CR matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
ggggcagatgggcgacttcagggcgctgctgg CRISPR spacer
cctgccgcagggcgccttcatggcgctgctgg Protospacer
** * ***** ***** ***********
472. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.758
cgccgccgggaccggggcgcaggc----gatctacaa CRISPR spacer
cgccgccggaaccgggccgcaggcctgagggct---- Protospacer
*********.****** ******* *. **
473. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.758
cgccgccgggaccggggcgcaggc----gatctacaa CRISPR spacer
cgccgccggaaccgggccgcaggcctgagggct---- Protospacer
*********.****** ******* *. **
474. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 8, identity: 0.758
cgccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
gctcgacacgaccggggcgccggcgagctacaa Protospacer
.** *. *********** ***** ******
475. spacer 5.10|420910|33|NC_017584|PILER-CR matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
caacagacgacagcgggatcatcctggcatcga CRISPR spacer
cgccgaccgacagcgggatcaccccggcatcca Protospacer
*. *.. **************.**.****** *
476. spacer 5.12|421032|33|NC_017584|PILER-CR matches to NZ_CP017887 (Pseudomonas frederiksbergensis strain ERDD5:01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
caagcc--cggggtttatggagagcataccatgac CRISPR spacer
--agtcggtggggtttatggagcgcttaccatgca Protospacer
**.* .************* ** *******
477. spacer 5.16|421276|33|NC_017584|PILER-CR matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
cgacatcgacacgcctccgccgacgacggccac CRISPR spacer
ccccgccagcacgccgccgcccacgacggccac Protospacer
* *..*..****** ***** ***********
478. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN369749 (Mycobacterium phage MinionDave, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
479. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
480. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MG962361 (Mycobacterium phage Alexphander, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
481. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KM597530 (Mycobacterium phage Bipolar, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
482. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MH590598 (Mycobacterium phage Krakatau, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
483. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MH669012 (Mycobacterium phage QuickMath, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
484. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MT684593 (Mycobacterium phage Moonbeam, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
485. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MK016496 (Mycobacterium phage IrishSherpFalk, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
486. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN735431 (Mycobacterium phage Hegedechwinu, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
487. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MH051257 (Mycobacterium phage OwlsT2W, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
488. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
489. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_041855 (Mycobacterium phage Dorothy, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
490. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KM101122 (Mycobacterium phage Hades, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
491. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MH669014 (Mycobacterium phage Spikelee, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
492. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_041986 (Mycobacterium phage Spartacus, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
493. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
494. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_041989 (Mycobacterium phage Shauna1, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
495. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MH077580 (Mycobacterium phage Melissauren88, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
496. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MT684595 (Mycobacterium phage Mova, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
497. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MK016494 (Mycobacterium phage Filuzino, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
498. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KM066034 (Mycobacterium phage Inventum, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
499. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MH632119 (Mycobacterium phage Harley, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
500. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MT310893 (Mycobacterium phage DRBy19, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
501. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KJ567041 (Mycobacterium phage Zapner, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
502. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_028792 (Mycobacterium phage Kimberlium, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
503. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
504. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_011288 (Mycobacterium phage Fruitloop, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
505. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KX576644 (Mycobacterium phage WillSterrel, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
506. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_013936 (Mycobacterium phage Ardmore, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
507. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN369752 (Mycobacterium phage Flathead, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
508. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MF919501 (Mycobacterium phage DaWorst, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
509. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN369751 (Mycobacterium phage TDanisky, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
510. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MF668270 (Mycobacterium phage Emma, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
511. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN310544 (Mycobacterium phage Doug, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
512. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_028654 (Mycobacterium phage Sparkdehlily, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
513. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MF668287 (Mycobacterium phage Wachhund, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
514. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN586001 (Mycobacterium phage Donkeykong, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
515. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KF114874 (Mycobacterium phage Bobi, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
516. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_022056 (Mycobacterium phage Hamulus, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
517. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KM652553 (Mycobacterium phage CaptainTrips, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
518. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to JN699012 (Mycobacterium phage SG4, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
519. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MN585987 (Mycobacterium phage Enby, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
520. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MH155871 (Mycobacterium phage Mattes, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
521. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
522. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KT281795 (Mycobacterium phage XFactor, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
523. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NC_022069 (Mycobacterium phage Jabbawokkie, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
524. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to JN398368 (Mycobacterium virus GUmbie, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
525. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KM347889 (Mycobacterium phage BuzzLyseyear, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
526. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to JF937093 (Mycobacterium virus DLane, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
527. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to KX808131 (Mycobacterium phage SuperGrey, complete genome) position: , mismatch: 8, identity: 0.75
gcgcgggcatcatctgccccg--cacaccatagc CRISPR spacer
ccgcgggcatcatcggccccggactcgccgca-- Protospacer
************* ****** * *.**..*
528. spacer 5.28|420545|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
gacgccgcgaacgtcctgaccgaagccctggc CRISPR spacer
gtcacgctgaacgtgctgaccgcagccctggt Protospacer
* *.* .****** ******* ********.
529. spacer 5.28|420545|32|NC_017584|CRISPRCasFinder,CRT matches to JQ692107 (Vibrio vulnificus phage SSP002, complete genome) position: , mismatch: 8, identity: 0.75
gacgccgcgaacgtcctgaccgaagccctggc CRISPR spacer
gccgccgccaacgtcctgatcgaagaaatgcg Protospacer
* ****** **********.***** **
530. spacer 5.28|420545|32|NC_017584|CRISPRCasFinder,CRT matches to MF754115 (Vibrio phage vB_VpaS_KF5, complete genome) position: , mismatch: 8, identity: 0.75
gacgccgcgaacgtcctgaccgaagccctggc CRISPR spacer
gccgccgccaacgtcctgatcgaagaaatgcg Protospacer
* ****** **********.***** **
531. spacer 5.29|420606|32|NC_017584|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75
tggcggcggcgtttcgcgctgaaggcgccctg CRISPR spacer
tcccggcggcgttccgcgccgaaggcaacgtt Protospacer
* **********.*****.******. * *
532. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
accgccgggaccgcgccgcaggcgaaagatga Protospacer
.************ * ********* *..*
533. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
accgccgggaccgcgccgcaggcgaaagatga Protospacer
.************ * ********* *..*
534. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP009155 (Burkholderia pseudomallei strain TSV202 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
gtcgccggtactggggcgcaggcgaacctctt Protospacer
*.****** **.************* *. *
535. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggcgatctacaa- CRISPR spacer
accgccggggccggtgcgcaggcgg-cggcgac Protospacer
.********.**** *********. * .*.*
536. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
acggccggcaccggggcacaggcgatgtcgac Protospacer
.* ***** ********.******** * *
537. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
gccgccgggctcggggcgcaggctgtcggaca Protospacer
********* .************ .** . *
538. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggc----gatctacaa CRISPR spacer
gccgccggaaccgggccgcaggcctgagggct---- Protospacer
********.****** ******* *. **
539. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggcgatctacaa- CRISPR spacer
accgccggggccggtgcgcaggcgg-cggcgac Protospacer
.********.**** *********. * .*.*
540. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggc----gatctacaa CRISPR spacer
gccgccggaaccgggccgcaggcctgagggct---- Protospacer
********.****** ******* *. **
541. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgggaccggggcgcaggcgatctacaa- CRISPR spacer
accgccggggccggtgcgcaggcgg-cggcgac Protospacer
.********.**** *********. * .*.*
542. spacer 5.31|420728|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctcggcaatgcgagggatcacgtcgccggagc CRISPR spacer
ctcggcaatgcgatgcatcacgtcatagggat Protospacer
************* * ********.. **...
543. spacer 5.31|420728|32|NC_017584|CRISPRCasFinder,CRT matches to NC_047862 (Klebsiella phage vB_KpnS_IME279, complete genome) position: , mismatch: 8, identity: 0.75
ctcggcaatgcgagggatcacgtcgccggagc CRISPR spacer
ccggaaagcgcgagggagaacgtcgccggagc Protospacer
*. *. *..******** *************
544. spacer 5.34|420911|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
aacagacgacagcgggatcatcctggcatcga CRISPR spacer
gccgaccgacagcgggatcaccccggcatcca Protospacer
. *.. **************.**.****** *
545. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
tccgccgacacgccgccgccgacgacgaccca Protospacer
*..********* ************.**
546. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
cccgccagcacgccgccgcccacgacggccac Protospacer
*..*..****** ***** ***********
547. spacer 5.44|421521|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP022418 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-3, complete sequence) position: , mismatch: 8, identity: 0.75
gtgcgcgacaacatggggtgggtgcgcgatca CRISPR spacer
ggccgcgacgaaatggggtgggtgcggcacct Protospacer
* ******.* ************** *.*
548. spacer 5.44|421521|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gtgcgcgacaacatggggtgggtgcgcgatca CRISPR spacer
ttccggctgaacacggggcgggtgcgcgatca Protospacer
* ** ****.****.*************
549. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to KM659097 (Paracoccus yeei plasmid pLM20P5, complete sequence) position: , mismatch: 8, identity: 0.75
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
gcgctgcgcgatcgatccgatctcggccacgg Protospacer
** *** ******** ********** ..*.
550. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to NC_015582 (Novosphingobium sp. PP1Y plasmid Spl, complete sequence) position: , mismatch: 8, identity: 0.75
gccgtgctcgatcgatgcgatctcggcagtga- CRISPR spacer
cacgtcctcgatcgctgcgatctc-gtggcgat Protospacer
*** ******** ********* *..*.**
551. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
cggcgaccgcctgcggcgcgaggccggcctcg Protospacer
.* ********** ************. * .
552. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
cgccgatcgcctgagccgcgaggccggtccgg Protospacer
.*****.******** **********. .*.
553. spacer 5.52|422009|32|NC_017584|CRISPRCasFinder,CRT matches to MG099950 (Arthrobacter phage Waltz, complete genome) position: , mismatch: 8, identity: 0.75
catgtcgcccgcacagcgggaactggccgccc CRISPR spacer
cccctaccccgcacgccgggaactggccgccg Protospacer
* . * *******. ***************
554. spacer 5.52|422009|32|NC_017584|CRISPRCasFinder,CRT matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 8, identity: 0.75
catgtcg-cccgcacagcgggaactggccgccc CRISPR spacer
-tcatcgccccgcacagctgggactggccgctg Protospacer
..*** ********** **.*********.
555. spacer 5.53|422070|34|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
gagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
caccgaagccaggcgcctgtccgggcggctgcgg Protospacer
* *. * * ******.**.**************
556. spacer 5.59|422438|32|NC_017584|CRISPRCasFinder,CRT matches to MH248947 (Streptomyces phage Yosif, complete genome) position: , mismatch: 8, identity: 0.75
gttgctgttcgtcaggatcgcgccgagaagcg CRISPR spacer
gggggcgagcgtctggatcgcgccgaggagcg Protospacer
* * .* **** *************.****
557. spacer 5.59|422438|32|NC_017584|CRISPRCasFinder,CRT matches to NC_048098 (Arthrobacter phage Andrew, complete genome) position: , mismatch: 8, identity: 0.75
----gttgctgttcgtcaggatcgcgccgagaagcg CRISPR spacer
gcgcgccgc----cgtcaggaacgcgccgaggagcg Protospacer
*..** ******** *********.****
558. spacer 5.68|422069|35|NC_017584|PILER-CR matches to KX961385 (Bordetella virus LK3, complete genome) position: , mismatch: 8, identity: 0.771
cgagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
ggaacggggcgaggcgcttggccaggcggctgcgg Protospacer
**.*. . *********** **.***********
559. spacer 5.68|422069|35|NC_017584|PILER-CR matches to KY000220 (Bordetella phage FP1, complete genome) position: , mismatch: 8, identity: 0.771
cgagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
ggaacggggcgaggcgcttggccaggcggctgcgg Protospacer
**.*. . *********** **.***********
560. spacer 5.68|422069|35|NC_017584|PILER-CR matches to KY000221 (Bordetella phage CN1, complete genome) position: , mismatch: 8, identity: 0.771
cgagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
ggaacggggcgaggcgcttggccaggcggctgcgg Protospacer
**.*. . *********** **.***********
561. spacer 5.68|422069|35|NC_017584|PILER-CR matches to NC_047879 (Bordetella phage MW2, complete genome) position: , mismatch: 8, identity: 0.771
cgagcacaccgaggcgcttgcccgggcggctgcgg CRISPR spacer
ggaacggggcgaggcgcttggccaggcggctgcgg Protospacer
**.*. . *********** **.***********
562. spacer 6.1|530092|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.733
cgtggcggcgaccaatgcggcattcgagct CRISPR spacer
tatcccggcggccaatgcggccttcgagaa Protospacer
..* *****.********** ******
563. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtcagcagggcgatgccgatcatcaatcga Protospacer
**** *****************.* .. .
564. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
aggaacagggcgctgccgatcacccccatc Protospacer
. * ******* ************ **.
565. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agctccagggcgatgccgacaacccgctga Protospacer
. * ***************. ****** .
566. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agctccagggcgatgccgagaacccgctga Protospacer
. * *************** ****** .
567. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to MT740731 (Ralstonia phage Claudette, complete genome) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agctccagggcgatgccgagaacccgctga Protospacer
. * *************** ****** .
568. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtcaccacggcgatgccgatcgtcgtcgaa Protospacer
******* *************..* *. .
569. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtcaccagcgcgatgccgaccacgaagaac Protospacer
******** **********.*** . *
570. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtcaccagcgcgatgccgaccacgaagaac Protospacer
******** **********.*** . *
571. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
aggaacagggcgctgccgatcacccccatc Protospacer
. * ******* ************ **.
572. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtcacgagggcgatgccgatcgtcgtcgaa Protospacer
***** ***************..* *. .
573. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtcagcagggcgatgccgatcgtcaatcgg Protospacer
**** ****************..* .. *
574. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to MT740739 (Ralstonia phage Gerry, complete genome) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agctccagggcgatgccgagaacccgctga Protospacer
. * *************** ****** .
575. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agctccagggcgatgccgacaacccgctga Protospacer
. * ***************. ****** .
576. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to MT740727 (Ralstonia phage Alix, complete genome) position: , mismatch: 8, identity: 0.733
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
agctccagggcgatgccgagaacccgctga Protospacer
. * *************** ****** .
577. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75
-gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
aacggtg-cagcgggcgcgggcggcttgggcgg Protospacer
.** .* . ************* ***** ***
578. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gagaacagcgcgggcgcggggcccttggccgt Protospacer
* * * ************ *********
579. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MF185719 (Mycobacterium phage Edugator, complete genome) position: , mismatch: 8, identity: 0.75
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcgtcgatcgccggcgctggcgctgacgtcgc Protospacer
*********** ***** *****. *.**
580. spacer 7.4|989610|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021525 (Acetobacter ascendens strain SRCM101447 plasmid pAP1447-1) position: , mismatch: 8, identity: 0.765
gggcacgacgccgttgatcgccttggccaccgcc CRISPR spacer
tgcctcaatgccgttgatcgctttgtccaccgct Protospacer
* * *.*.************.*** *******.
581. spacer 7.4|989610|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.765
gggcacgacgccgttgatcgccttggccaccgcc CRISPR spacer
cggcacgacgcggttggtcgccttgccgctcggc Protospacer
********** ****.******** * .** *
582. spacer 7.4|989610|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.765
gggcacgacgccgttgatcgccttggccaccgcc CRISPR spacer
cggcacgacgcggttcatcgccttgccgctcggc Protospacer
********** *** ********* * .** *
583. spacer 7.6|989743|35|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to LT635659 (Aeromonas veronii plasmid 9716_6_27, strain 9716_6_27) position: , mismatch: 8, identity: 0.771
cataccgagttggcggagggcttcgggcaccacga---- CRISPR spacer
cataccaagttggcgtagggcttcgg----cataaccct Protospacer
******.******** ********** **..*
584. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 8, identity: 0.75
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gtttcccgccctgcccgccaccaccccgcagg Protospacer
** *******.************** .*
585. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
tgagaccaccccgcccgccatcacccattcgc Protospacer
. * **.************.******* **
586. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027026 (Streptomyces sp. WAC00288 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
tgagaccaccccgcccgccatcacccattcgc Protospacer
. * **.************.******* **
587. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cctgaccgccccgcccgccaccgccgccctgc Protospacer
*.** *****************.** . **
588. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cggccaccacccgcccgccaccacccaccggc Protospacer
* * * ******************. ***
589. spacer 7.19|990602|35|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.771
cggccccgccctcctcccctccccggcgcggtgct CRISPR spacer
gcgtccctccctcctcccctccccggggcgccgcc Protospacer
*.*** ****************** *** .**.
590. spacer 7.20|990669|33|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758
catccgctggatgatcgtggccttcatcggcat CRISPR spacer
cggcaactggatgatcgtggcctgcatctgcgg Protospacer
*. * .***************** **** **.
591. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 8, identity: 0.75
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
accgcccgcgccatgtccggtgctggcgagca Protospacer
. ************ ****** ***** *
592. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
accgcccgcgccatgtccggtgctggcgagca Protospacer
. ************ ****** ***** *
593. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MT498041 (Mycobacterium phage KingCyrus, complete genome) position: , mismatch: 8, identity: 0.75
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
ccagcccccggcatggccggtggtggcttcag Protospacer
*..**** ** **************** . *
594. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KU985095 (Mycobacterium phage ChipMunk, complete genome) position: , mismatch: 8, identity: 0.75
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
ccagcccccggcatggccggtggtggcttcag Protospacer
*..**** ** **************** . *
595. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KU985093 (Mycobacterium phage EvilGenius, complete genome) position: , mismatch: 8, identity: 0.75
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
ccagcccccggcatggccggtggtggcttcag Protospacer
*..**** ** **************** . *
596. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
gacgccgcggccatagccggtggaggcgcgat Protospacer
*** *****.******** ********
597. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
598. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
599. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
600. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
601. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
602. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
603. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
604. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
605. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
606. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
607. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
608. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
609. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
610. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
611. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
612. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
613. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
614. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
615. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
616. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
617. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
618. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
619. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
620. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
621. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cgccgccgcccgagcccgagcccgagccgcccga Protospacer
******* ****************** * ..
622. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.765
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
acctgcccgccgagcccgatcccgaggacggccc Protospacer
*.**** ********** ******** * .**
623. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
atcgccgacgccgagctggtcgaggatttggt Protospacer
************* ********** *
624. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
atcgccgacaccgccctggtcgcggacgcgtg Protospacer
*********.************ ** .. .*
625. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
aacctgatcgccgccgtggtcgaggcgaaccg Protospacer
* * . . ******* ********** *****
626. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gtcgccggcgccgcgctggtcgaggtcgagca Protospacer
.******.****** **********...* *.
627. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_005307 (Gordonia westfalica strain DSM44215T plasmid pKB1 complete genome) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gccgccgacgccgccctgctcgaagccatcgt Protospacer
..**************** ****.**.* *
628. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgag-----gctaaccg CRISPR spacer
atcgccgacgccgccctgctggagcgggtgcc----- Protospacer
****************** * *** **.
629. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgag-----gctaaccg CRISPR spacer
atcgccgacgccgccctgctggagcgggtgcc----- Protospacer
****************** * *** **.
630. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
atcgccgacggcgccctgggcgagctgcgcgg Protospacer
********** ******** **** . .* *
631. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgag-----gctaaccg CRISPR spacer
atcgccgacgccgccctgctggagcgggtgcc----- Protospacer
****************** * *** **.
632. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgag-----gctaaccg CRISPR spacer
atcgccgacgccgccctgctggagcgggtgcc----- Protospacer
****************** * *** **.
633. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgag-----gctaaccg CRISPR spacer
atcgccgacgccgccctgctggagcgggtgcc----- Protospacer
****************** * *** **.
634. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KY092483 (Streptomyces phage Bioscum, complete genome) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gccgtccacgccgccctggtcgaggccgacgt Protospacer
..**.* *******************..**
635. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MK305888 (Streptomyces phage Austintatious, complete genome) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gccgtccacgccgccctggtcgaggccgacgt Protospacer
..**.* *******************..**
636. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_047792 (Streptomyces phage Ididsumtinwong, complete genome) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gccgtccacgccgccctggtcgaggccgacgt Protospacer
..**.* *******************..**
637. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KY092481 (Streptomyces phage PapayaSalad, complete genome) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gccgtccacgccgccctggtcgaggccgacgt Protospacer
..**.* *******************..**
638. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047181 (Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gacgctctcgccgcgctggtcgaggcgaaccc Protospacer
. ***. ****** *********** ****
639. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gacgctctcgccgcgctggtcgaggcgaaccc Protospacer
. ***. ****** *********** ****
640. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gacgctctcgccgcgctggtcgaggcgaaccc Protospacer
. ***. ****** *********** ****
641. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 8, identity: 0.75
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
ggacgagggccgatcgccgcagccagcgccga Protospacer
. ...*.******************* ** **
642. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
aggtcgtcgccgagcgccgccgccagggcggc Protospacer
* ** . ***** ****** **********
643. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_048046 (Caulobacter phage CcrPW, complete genome) position: , mismatch: 8, identity: 0.75
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
gcgtcattgccgatcgccgcagccagttcggc Protospacer
..** * ****************** ***
644. spacer 10.11|1581230|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgctcggcacgggggcgggggcgggttgtag CRISPR spacer
cccatcgggacgggggcggcggcgggttcatc Protospacer
** **** ********** ********
645. spacer 10.19|1581718|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 8, identity: 0.75
ggtcgcgcagcgtgatgaggtcagtcatgatc CRISPR spacer
cgatggccagcgtgatgaggtctgtcatgaaa Protospacer
* .* *************** *******
646. spacer 10.19|1581718|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 8, identity: 0.75
ggtcgcgc-agcgtgatgaggtcagtcatgatc CRISPR spacer
-tcaacgcaagggtgatgatgtcagtcatgatg Protospacer
. .*** ** ******* ************
647. spacer 10.21|1581840|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gttcgctgggcaggccatgatgggggattgga CRISPR spacer
ctgggctgggcaggccatgatggtggagggcg Protospacer
* ******************* *** * .
648. spacer 11.1|1694084|33|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
gaccagcaggccggcctgcatcagca----cataaag CRISPR spacer
gtccagcaggccgtcctgcaccagcagcgccgt---- Protospacer
* *********** ******.***** *.*
649. spacer 11.8|1694538|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.771
ccaacccggacgtcgccgccgccgtcaaacgcggg CRISPR spacer
ccaacgcggatgtcgccgccgccgtccatgtcagt Protospacer
***** ****.*************** * *.*
650. spacer 11.9|1694604|34|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU140623 (Sinorhizobium sp. M14 plasmid pSinB, complete sequence) position: , mismatch: 8, identity: 0.765
-catacgccgcgagctgcttggcttctcgcaggca CRISPR spacer
gctcacg-cgcgaactgcttgggttctcgcagcat Protospacer
* .*** *****.******** *********
651. spacer 11.21|1695386|33|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.758
accaaggcttgcgccaagcccccggcccggtcg CRISPR spacer
gcatcggtctgcgccacgcgcccggcccggtcg Protospacer
.* **..******* ** *************
652. spacer 11.25|1695647|33|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
gcaggacgtggcccgggtgcgccggtaccgcca- CRISPR spacer
gcaggacgtggcgcgggtgggcc-gcatcgtggg Protospacer
************ ****** *** *.*.**. .
653. spacer 11.28|1695840|34|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to MK443266 (UNVERIFIED: Pseudomonas phage RSP, complete genome) position: , mismatch: 8, identity: 0.765
gttgggtgcccgtagaagaggccgcaatcgccgc CRISPR spacer
tctggaagggcgtagaaaaagccgcaatcgccgc Protospacer
.***. * *******.*.**************
654. spacer 11.28|1695840|34|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to AB910392 (Pseudomonas phage KPP23 DNA, complete sequence) position: , mismatch: 8, identity: 0.765
gttgggtgcccgtagaagaggccgcaatcgccgc CRISPR spacer
tctggaagggcgtagaaaaagccgcaatcgccgc Protospacer
.***. * *******.*.**************
655. spacer 11.28|1695840|34|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to MK803322 (Pseudomonas phage RSP, complete genome) position: , mismatch: 8, identity: 0.765
gttgggtgcccgtagaagaggccgcaatcgccgc CRISPR spacer
tctggaagggcgtagaaaaagccgcaatcgccgc Protospacer
.***. * *******.*.**************
656. spacer 11.29|1695905|32|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggctcggcgtcctccccccacccgttgg CRISPR spacer
gtgcgtctcggcctcctccccccacccctggt Protospacer
. ** ****** ************** * *
657. spacer 11.29|1695905|32|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggctcggcgtcctccccccacccgttgg CRISPR spacer
gtgcgtctcggcctcctccccccacccctggt Protospacer
. ** ****** ************** * *
658. spacer 11.29|1695905|32|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggctcggcgtcctccccccacccgttgg CRISPR spacer
gtgcgtctcggcctcctccccccacccctggt Protospacer
. ** ****** ************** * *
659. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 9, identity: 0.71
accaggatatcggggccgtggccgaggaggc CRISPR spacer
catcgacgatcggggccgtggccgcggcggc Protospacer
. *. **************** ** ***
660. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to MK305892 (Mycobacterium phage RedRaider77, complete genome) position: , mismatch: 9, identity: 0.71
accaggatatcggggccgtggccgaggaggc CRISPR spacer
aacaggatgtcggtgccgtggccgataccca Protospacer
* ******.**** *********** .
661. spacer 2.1|198707|31|NC_017584|CRISPRCasFinder matches to HQ332136 (Dunaliella viridis virus SI2 genomic sequence) position: , mismatch: 9, identity: 0.71
accaggatatcggggccgtggccgaggaggc CRISPR spacer
ggactgagatcggcgccgtggccgaggatgt Protospacer
. ** ***** ************** *.
662. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.71
gctgccggggcggacgagggccgggtggatt CRISPR spacer
tgagccggggcggacgcgggccgggtcagcg Protospacer
************* ********* ...
663. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_CP015369 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p2, complete sequence) position: , mismatch: 9, identity: 0.71
gctgccggggcggacgagggccgggtggatt CRISPR spacer
agctccggtgcggaggagggccgggtgaaac Protospacer
. . **** ***** ************.* .
664. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NZ_JX627582 (Methylobacterium oryzae CBMB20 plasmid pMOC3, complete sequence) position: , mismatch: 9, identity: 0.71
gctgccggggcggacgagggccgggtggatt CRISPR spacer
agctccggtgcggaggagggccgggtgaaac Protospacer
. . **** ***** ************.* .
665. spacer 2.3|198829|31|NC_017584|CRISPRCasFinder matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 9, identity: 0.71
gctgccggggcggacgagggccgggtggatt CRISPR spacer
gatgcgggggcggaccagggccgggaccccg Protospacer
* *** ********* ********* .
666. spacer 2.8|199134|32|NC_017584|CRISPRCasFinder matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 9, identity: 0.719
accccaggccgtttgattttgctcgctgatct CRISPR spacer
ggccaccaccgtttgattcagctcgctgatcg Protospacer
. ** .**********. ***********
667. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NC_015377 (Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence) position: , mismatch: 9, identity: 0.71
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
agcaccacggcctcggcctcgagcacgacgc Protospacer
*** ****************.** .. .*
668. spacer 2.10|199257|31|NC_017584|CRISPRCasFinder matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
agccccacggcctcggcctcaagggtcgcca CRISPR spacer
agcaccacggcctcggcctcgagcacgacgc Protospacer
*** ****************.** .. .*
669. spacer 2.14|199501|31|NC_017584|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.71
ggcgccggtgaagtcggccttccagcctaag CRISPR spacer
ggagccggtgaagccggccttcccctgcgtg Protospacer
** **********.********* . .. *
670. spacer 2.16|199623|31|NC_017584|CRISPRCasFinder matches to NC_008459 (Bordetella pertussis plasmid pBP136 DNA, complete sequence) position: , mismatch: 9, identity: 0.71
cgggcccaggatgacggcggagcgctggagg CRISPR spacer
ttcgtccaggatgatggcggagggctggcct Protospacer
. *.*********.******* *****
671. spacer 2.18|199745|31|NC_017584|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.71
aggtcgggctgtccgttgaggcgctgcagga CRISPR spacer
ggcacgggctggacgttgaggcgctgcgttc Protospacer
.* ******* **************.
672. spacer 2.18|199745|31|NC_017584|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.71
aggtcgggctgtccgttgaggcgctgcagga CRISPR spacer
ggcacgggctggacgttgaggcgctgcgttc Protospacer
.* ******* **************.
673. spacer 2.18|199745|31|NC_017584|CRISPRCasFinder matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 9, identity: 0.71
aggtcgggctgtccgttgaggcgctgcagga CRISPR spacer
tcatcgggctgtccgtgggggcgctggtcgg Protospacer
.************* *.******* *.
674. spacer 2.20|198707|32|NC_017584|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719
accaggatatcggggccgtggccgaggaggcc CRISPR spacer
tcgcgcgaatcggggcctttgccgaggaggcg Protospacer
* * . ********* * ***********
675. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 9, identity: 0.719
gctgccggggcggacgagggccgggtggatta CRISPR spacer
gtcggcggcgcggacgagggccgggaggtgag Protospacer
*..* *** **************** ** .
676. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
gctgccggggcggacgagggccgggtggatta CRISPR spacer
tctgccggggcgggcgagggcaggtggagaga Protospacer
************.******* ** *.. *
677. spacer 2.24|198951|32|NC_017584|CRT,PILER-CR matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcaccctggaatatttgcgcatgggggcg CRISPR spacer
gcgccccgatggaatatttgcgcatggcgccg Protospacer
..* * ****************** * **
678. spacer 2.24|198951|32|NC_017584|CRT,PILER-CR matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcaccctggaatatttgcgcatgggggcg CRISPR spacer
gcgccccgatggaatatttgcgcatggcgccg Protospacer
..* * ****************** * **
679. spacer 2.24|198951|32|NC_017584|CRT,PILER-CR matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcaccctggaatatttgcgcatgggggcg CRISPR spacer
gcgccccgatggaatatttgcgcatggcgccg Protospacer
..* * ****************** * **
680. spacer 2.27|199134|33|NC_017584|CRT,PILER-CR matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 9, identity: 0.727
accccaggccgtttgattttgctcgctgatctg CRISPR spacer
accccaggcagtttgatttttctccccttcgtt Protospacer
********* ********** *** *. . *
681. spacer 2.27|199134|33|NC_017584|CRT,PILER-CR matches to NZ_CP045090 (Burkholderia glumae strain GX plasmid pWSGX2, complete sequence) position: , mismatch: 9, identity: 0.727
accccaggccgtttgattttgctcgctgatctg CRISPR spacer
accccaggcagtttgatttttctccccttcgtt Protospacer
********* ********** *** *. . *
682. spacer 2.28|199196|32|NC_017584|CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719
tcccgccatcgcccccatgaccaagtcaaggg CRISPR spacer
gcccgccatcgcccacatgaccgaggtctgca Protospacer
************* *******.** . * .
683. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to NC_015377 (Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence) position: , mismatch: 9, identity: 0.719
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
agcaccacggcctcggcctcgagcacgacgct Protospacer
*** ****************.** .. .* *
684. spacer 2.29|199257|32|NC_017584|CRT,PILER-CR matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
agccccacggcctcggcctcaagggtcgccat CRISPR spacer
agcaccacggcctcggcctcgagcacgacgct Protospacer
*** ****************.** .. .* *
685. spacer 2.33|199501|32|NC_017584|CRT,PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgccggtgaagtcggccttccagcctaagg CRISPR spacer
ggagccggtgaagccggccttcccctgcgtgg Protospacer
** **********.********* . .. **
686. spacer 2.36|199684|32|NC_017584|CRT,PILER-CR matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 9, identity: 0.719
ggggcagatgggcgacttcagggcgctgctgg CRISPR spacer
cggtaccgcgggcgacctcggggcgctgctgg Protospacer
** ..*******.**.************
687. spacer 2.37|199745|32|NC_017584|CRT,PILER-CR matches to MK494087 (Mycobacterium phage DBQu4n, complete genome) position: , mismatch: 9, identity: 0.719
aggtcgggctgtccgttgaggcgctgcaggaa CRISPR spacer
tgctgaagctgccccttgaggcgctgcagggg Protospacer
* * ..****.** ***************..
688. spacer 2.37|199745|32|NC_017584|CRT,PILER-CR matches to KX758538 (Mycobacterium phage Kerberos, complete genome) position: , mismatch: 9, identity: 0.719
aggtcgggctgtccgttgaggcgctgcaggaa CRISPR spacer
tgctgaagctgccccttgaggcgctgcagggg Protospacer
* * ..****.** ***************..
689. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 9, identity: 0.727
cgccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
cgccgccggggccgggccgcaggcttccgcctg Protospacer
**********.***** ******* .* * .
690. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.727
cgccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
cgcggccgggaccggggcgcgggcctcgaccag Protospacer
*** ****************.*** . **.
691. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 9, identity: 0.727
cgccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
taccgccgggaccgcgccgcaggcgaaagatga Protospacer
..************ * ********* *..*
692. spacer 5.6|420666|33|NC_017584|PILER-CR matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 9, identity: 0.727
cgccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
taccgccgggaccgcgccgcaggcgaaagatga Protospacer
..************ * ********* *..*
693. spacer 5.7|420727|33|NC_017584|PILER-CR matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
cctcggcaatgcgagggatcacgtcgccggagc CRISPR spacer
tctcggcaatgcgatgcatcacgtcatagggat Protospacer
.************* * ********.. **...
694. spacer 5.16|421276|33|NC_017584|PILER-CR matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
cgacatcgacacgcctccgccgacgacggccac CRISPR spacer
ttccgccgacacgccgccgccgacgacgaccca Protospacer
. *..********* ************.**
695. spacer 5.29|420606|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
tggcggcggcgtttcgcgctgaaggcgccctg CRISPR spacer
tccggccggcgtttggcgatgaaggcgccgac Protospacer
* * ******** *** **********
696. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
gccgccgcgaccgtggcgcaggcgacaccggg Protospacer
******* ***** ***********. . ..
697. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
gccgccggggccgggccgcaggcttccgcctg Protospacer
*********.***** ******* .* * .
698. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
cccgccgggcccggggcacaggcgcccggctc Protospacer
******** *******.****** .* .*
699. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
gcggccgggaccggggcgcgggcctcgaccag Protospacer
** ****************.*** . **.
700. spacer 5.31|420728|32|NC_017584|CRISPRCasFinder,CRT matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 9, identity: 0.719
ctcggcaatgcgagggatcacg-----tcgccggagc CRISPR spacer
ggcggcaatgcgaaggatcacgacggttcgct----- Protospacer
***********.******** ****.
701. spacer 5.31|420728|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.719
ctcggcaatgcgagggatcacgtcgccggagc CRISPR spacer
ttcggcaatgcgatgcatcacgtcatagggat Protospacer
.************ * ********.. **...
702. spacer 5.37|421094|32|NC_017584|CRISPRCasFinder,CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.719
cccggacgccttttggtggacgacgccgcaaa CRISPR spacer
caggatcgcctttgggtggtcgacgccgccgc Protospacer
* *. ******* ***** ********* .
703. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 9, identity: 0.719
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
aacccgcacaagcctccgccgacgatggccgt Protospacer
.** . *** **************.****..
704. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 9, identity: 0.719
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
tacatcgacacgccaccgtcgacgggcaggac Protospacer
************* ***.*****. . **
705. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
ctcatcgacacgccggcgccgacgaagaggat Protospacer
************ ********* *. *.
706. spacer 5.40|421277|32|NC_017584|CRISPRCasFinder,CRT matches to NC_013779 (Nocardiopsis sp. 90127 plasmid pSQ10, complete sequence) position: , mismatch: 9, identity: 0.719
gacatcgacacgcctccgccgacgacggccac CRISPR spacer
accaggaccacgccgccgacgacgacggccag Protospacer
. ** . ****** *** ************
707. spacer 5.47|421704|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719
ttgccgcgaatgcggcgcccccctggcggtcg CRISPR spacer
atcccgcgactgcggcgccaccctggccagtt Protospacer
* ****** ********* ******* . .
708. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 9, identity: 0.719
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
gctcgaccaccagaggcgcgaggccgagcgac Protospacer
.*****.** **************** .
709. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 9, identity: 0.719
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
cccgggatgcctgaggcgcgaggcggtggtgt Protospacer
. * *. .**************** * ****
710. spacer 5.52|422009|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
catgtcgcccgcacagcgggaactggccgccc CRISPR spacer
tcagacggccgcacagcgggaactgcccttgc Protospacer
. * ** ***************** ** . *
711. spacer 5.57|422316|32|NC_017584|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.719
cttcaaaaacccgcgatttccgccgcgattgc CRISPR spacer
aggcccaggcccgcgattgccgccgcgatcgc Protospacer
* *..********* **********.**
712. spacer 5.65|421886|33|NC_017584|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.727
ctgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
gcgccgatcgcctgagccgcgaggccggtccgg Protospacer
.*****.******** **********. .*.
713. spacer 5.67|422008|33|NC_017584|PILER-CR matches to MG099950 (Arthrobacter phage Waltz, complete genome) position: , mismatch: 9, identity: 0.727
ccatgtcgcccgcacagcgggaactggccgccc CRISPR spacer
acccctaccccgcacgccgggaactggccgccg Protospacer
* . * *******. ***************
714. spacer 6.2|530158|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 9, identity: 0.7
ggctggcgctttcgaccggctacgtcatgg CRISPR spacer
atagcgcgcgttcgaccggctacggcatca Protospacer
. **** ************** *** .
715. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP049030 (Fluviibacterium aquatile strain SC52 plasmid pSC52_2, complete sequence) position: , mismatch: 9, identity: 0.7
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gagcttgaagcgatgcagatcacccgcacg Protospacer
* .....******* *************
716. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 9, identity: 0.7
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
ctcaccagggcgttgccgatcatgctgtga Protospacer
*********** *********. * .
717. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 9, identity: 0.7
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
tagcccagcgcgatgcccatcacccgctgc Protospacer
**** ******** *********
718. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.7
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
ccggccagcgcgatgccgatcagccgcggc Protospacer
. .**** ************* ****.
719. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026974 (Achromobacter insolitus strain FDAARGOS_88 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
tcgtcgatggcgggcgagggcgcctcctcgat Protospacer
******* ******* ********. * .
720. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
atcgaaaccgcgggcgcgggcaccatggccgg Protospacer
.. .*.*************.** *******
721. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_014642 (Achromobacter xylosoxidans A8 plasmid pA82, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
tcgtcgatggcgggcgagggcgcctcctcgat Protospacer
******* ******* ********. * .
722. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020333 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
tgatcgatggcgggcgcgggcgcattgatcct Protospacer
.***** ************** ***..*
723. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
tcgtcgaccgcgggcgagggcgcctcttcgat Protospacer
******.******** ********. * .
724. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggacacttcgcgcgcgcgggcgccctggccga Protospacer
* .. ***** ***********.******.
725. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ctccagaatgcgggcgcgggtgccctggccgg Protospacer
. . ** .***********.***.*******
726. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
aaggaaaccgcgggctcgggcgccttgggcga Protospacer
. * .*.******* ************ **.
727. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_009453 (Arthrobacter sp. Rue61a plasmid pAL1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gagatcgacgcgcgcgcgggggccttggccgc Protospacer
* * . . **** ******* **********
728. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggcgggtgagcgggcgcgggcgcagtggccgg Protospacer
* * ************** *******
729. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MF373843 (Mycobacterium phage StevieRay, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
730. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MK814758 (Mycobacterium phage FirstPlacePfu, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
731. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MN694313 (Marine virus AFVG_250M1015, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcga-tcgcgggcgcgggcgccttggccgg CRISPR spacer
-cgcaagctctcggacgcgggcgccttggccca Protospacer
**. .. ** ***.**************** .
732. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MK494122 (Mycobacterium phage GreaseLightnin, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
733. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MN010757 (Mycobacterium phage HUHilltop, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
734. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MK524508 (Mycobacterium phage Zilizebeth, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
735. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MK820639 (Mycobacterium phage Phineas, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
736. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MT498061 (Mycobacterium phage Jung, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
737. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MF140399 (Mycobacterium phage Bartholomew, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
738. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MH230879 (Mycobacterium phage Xavia, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
739. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MK937604 (Mycobacterium phage Necropolis, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
740. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KC691256 (Mycobacterium phage Fishburne, complete genome) position: , mismatch: 9, identity: 0.719
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
gcctcgatcgcgggctcgggcgcaccttcgga Protospacer
** ************ ******* .. * *.
741. spacer 7.3|989544|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045412 (Roseovarius sp. THAF8 plasmid pTHAF8_b, complete sequence) position: , mismatch: 9, identity: 0.735
atccaggggccagtcgcgcgagacctcccggcgt CRISPR spacer
gcacctgcgccagtcgcgcgagatcacccggcat Protospacer
.. * * ***************.* ******.*
742. spacer 7.3|989544|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045406 (Roseovarius sp. THAF9 plasmid pTHAF9_b, complete sequence) position: , mismatch: 9, identity: 0.735
atccaggggccagtcgcgcgagacctcccggcgt CRISPR spacer
gcacctgcgccagtcgcgcgagatcacccggcat Protospacer
.. * * ***************.* ******.*
743. spacer 7.4|989610|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MH509442 (Mycobacterium phage Aminay, complete genome) position: , mismatch: 9, identity: 0.735
gggcacgacgccgttgatcgccttggccaccgcc CRISPR spacer
gttggtgccgccgttgatcgccttggtcacggcg Protospacer
* ..* ******************.*** **
744. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cgcgcccgccgcccccgccaccacccccgcca Protospacer
* .******* * ************* .*
745. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cgcgcccgccgcccccgccaccacccccgcca Protospacer
* .******* * ************* .*
746. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
747. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
748. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
749. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
750. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
751. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
752. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
753. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
754. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
755. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
756. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
757. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
758. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
759. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
760. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
761. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
762. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
763. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gatgcccgccccgccggccagcaccatgtcgc Protospacer
************* **** **** **
764. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
765. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
766. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
767. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
768. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
769. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
770. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gatgcccgccccgccggccagcaccatgtcgc Protospacer
************* **** **** **
771. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
772. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
773. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
774. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
775. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
776. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
777. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
778. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
779. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
780. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
781. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
782. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
783. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
784. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
785. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
786. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
787. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
788. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
789. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
790. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
791. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
792. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
793. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
794. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
795. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
796. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
797. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
798. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
799. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
800. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
801. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
802. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
803. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
804. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
805. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
806. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
807. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
808. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
809. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
810. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
811. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
812. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
813. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
814. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
815. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
816. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
817. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
818. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
819. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
820. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
821. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cttgccggccccggccgccaccacgttgctgt Protospacer
****** ****** ********** . *.
822. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gctgcccgcccagcccggcaccaccgtcgaac Protospacer
.********* ***** ******* .*..*
823. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
ggtgcccgccccggccgccaccgccggcttgc Protospacer
*********** ********.** .. **
824. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
ttcccccgccccgtcctccaccacccaggcct Protospacer
.*. *********.** ********** * .
825. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.719
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cccgcgcgccccgcccgcctccacccggtcgg Protospacer
*..** ************* ******. *
826. spacer 7.14|990271|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_015377 (Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence) position: , mismatch: 9, identity: 0.735
aaggcgtgctcgatgccgacgccggcggacagga CRISPR spacer
cgcgcgtgcttgatgccgacggcggcgaagtggc Protospacer
. *******.********** *****.* **
827. spacer 7.14|990271|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 9, identity: 0.735
aaggcgtgctcgatgccgacgccggcggacagga CRISPR spacer
acaccgagcccgatgccgacgccggcggcctgcc Protospacer
* . ** **.****************** * *
828. spacer 7.14|990271|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.735
aaggcgtgctcgatgccgacgccggcggacagga CRISPR spacer
gacgcgagctcgatcccgacgccggcgtcgctga Protospacer
.* *** ******* ************ **
829. spacer 7.14|990271|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.735
aaggcgtgctcgatgccgacgccggcggacagga CRISPR spacer
accgcgcgctcgatgccgccgccggcgaggcggc Protospacer
* ***.*********** ********.. **
830. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
tttgcccgcgccaaggccggtgatggtccatc Protospacer
.* ********** ********.***. *. .
831. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to CP053919 (Serratia marcescens strain LY1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggcccg---cgccatggccggtggtggcgcgat CRISPR spacer
---gttcaatttgccgtggccggtggtggcacgat Protospacer
*..*. .***.**************.****
832. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
ctcatgggcgccatggccggttttggcgcgta Protospacer
** .. ************** *******
833. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_030912 (Gordonia phage McGonagall, complete genome) position: , mismatch: 9, identity: 0.719
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
ggcggccgcgccgtggccggtggtgtcgtcgt Protospacer
* *******.************ **. .*
834. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KU998256 (Gordonia phage Jeanie, complete genome) position: , mismatch: 9, identity: 0.719
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
ggcggccgcgccgtggccggtggtgtcgtcgt Protospacer
* *******.************ **. .*
835. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to MK875791 (Gordonia phage Yakult, complete genome) position: , mismatch: 9, identity: 0.735
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aggccgcccccgagccggagcccgaggaggacgt Protospacer
* * ********** ************* . .
836. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
cgccgccccccgagcccgagcccgaggaggttcc----- CRISPR spacer
cgccggcccccgagccggagccc-----ggccccgcggc Protospacer
***** ********** ****** **..**
837. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP031600 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_02, complete sequence) position: , mismatch: 9, identity: 0.735
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
tcctgccaccagagcccgagcccgaggatgatgg Protospacer
. *.*** ** ***************** * *
838. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP049815 (Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
tcctgccaccagagcccgagcccgaggatgatgg Protospacer
. *.*** ** ***************** * *
839. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP010861 (Marinovum algicola DG 898 plasmid pMaD6, complete sequence) position: , mismatch: 9, identity: 0.735
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
tcctgccaccagagcccgagcccgaggatgatgg Protospacer
. *.*** ** ***************** * *
840. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
tccgccggcggcgccctggtcgaggcctgcgt Protospacer
.*****.** ***************. .*
841. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
cgcgccgccgccgccctggtcgacgcggccaa Protospacer
***** *************** ** . * .
842. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgccgacgacgcccaggtcgaggtcacgga Protospacer
********* ***** ********..* .
843. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
cgcgccgccgccgccctggtcgatgccgccaa Protospacer
***** *************** **.. * .
844. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgccgacgccgcgctggccgagatacggcg Protospacer
************* ****.****.. . **
845. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029362 (Streptomyces globisporus strain TFH56 plasmid pTFSG1, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ggcgggctggccgccctggccgaggcgaaccg Protospacer
. ** **********.****** *****
846. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgccgacgccgcgctggccgagatacggcg Protospacer
************* ****.****.. . **
847. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgccgacgccgcgctggccgagatacggcg Protospacer
************* ****.****.. . **
848. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
aacctgattgccgccgtggtcgaggcgaaccg Protospacer
* * . . .****** ********** *****
849. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gtccccgacaccgccctggtcgagcgatggcg Protospacer
.** *****.************** . **
850. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gtcgccgaagccggcctggtcgagatcgagag Protospacer
.******* **** **********....* *
851. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg-- CRISPR spacer
ggcgacgacgccgccctggtcgcgg--aggtggt Protospacer
. ** ***************** ** *. .*
852. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgacgatgccgccctggtcgagcgggcgcg Protospacer
*** ***.*************** . **
853. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KC292029 (Halovirus HCTV-1, complete genome) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
agcgccgacgccgcccgtgtcgaggtcttcgt Protospacer
* ************** *******.. *
854. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KC117377 (Halovirus HVTV-1, complete genome) position: , mismatch: 9, identity: 0.719
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ttcgccgacgccgccctgaccgagagtacgat Protospacer
*****************..****. **
855. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
agcgccaggccgatcgccgctggcagggcgcc Protospacer
* ************** * *******
856. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
agcgccaggccgatcgccgcgggcagggcgcc Protospacer
* **************.* *******
857. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
agcgccaggccgatcgccgctggcagggcgcc Protospacer
* ************** * *******
858. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
---atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
cgcgcct---ggccgaacgccgcagccaggtcggc Protospacer
.. * ****** ************* ***
859. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
agcgccaggccgatcgccgctggcagggcgcc Protospacer
* ************** * *******
860. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
agtaggtgcccgaccaccgcagccagggcgga Protospacer
* .. * ****.*.****************
861. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039920 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626c, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
aggctcgggccgagcgccgcagccagcgcgat Protospacer
* *. .****** ************ ***.
862. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
cggtgcttgccgatcgccgcagccagcacggc Protospacer
**. ****************** .***
863. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014803 (Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
aggaccgcgccgatcgccgcggtcagggcggt Protospacer
* * . ************.*.********
864. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
aagatcaggccgatcgccgccgccagcgcacc Protospacer
* * ************** ***** **.
865. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.719
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
acgctttcgccgatcgcctccgccagggcggc Protospacer
*.*. ********** * **********
866. spacer 10.4|1580803|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccagcggcaaacaccacatcacgcaagc CRISPR spacer
ccggcaggcggccaacaccagatcacgcaaca Protospacer
. ** .***** ******* *********
867. spacer 10.4|1580803|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 9, identity: 0.719
atcgccagcggcaaacaccacatcacgcaagc CRISPR spacer
ccggcaggcggccaacaccagatcacgcaaca Protospacer
. ** .***** ******* *********
868. spacer 10.11|1581230|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030372 (Salinibacter ruber strain RM158 plasmid pSR67, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcggcacgggggcgggggcgggttgtag CRISPR spacer
acgcccggcacgtgggcgggggcgagcttgcc Protospacer
***.******* ***********.*.*
869. spacer 10.11|1581230|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcggcacgggggcgggggcgggttgtag CRISPR spacer
ggtctcggcgcgggtgcgggggcgggaggcgg Protospacer
******.**** *********** *..*
870. spacer 10.11|1581230|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030365 (Salinibacter ruber strain M1 plasmid pSR116, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcggcacgggggcgggggcgggttgtag CRISPR spacer
acgcccggcacgtgggcgggggcgagcttgcc Protospacer
***.******* ***********.*.*
871. spacer 10.16|1581535|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 9, identity: 0.719
tgcgcgccagtttgcgaggatgagggcgatca CRISPR spacer
ggtgcgccagcttgagaggatgagggacaggg Protospacer
*.*******.*** *********** * .
872. spacer 10.19|1581718|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN082782 (Pseudomonas aeruginosa strain 2047 plasmid pPA2047, complete sequence) position: , mismatch: 9, identity: 0.719
ggtcgcgcagcgtgatgaggtcagtcatgatc CRISPR spacer
agggccgcagcttgatgaggtcagccattcgc Protospacer
.* ****** ************.*** *
873. spacer 11.1|1694084|33|NC_017584|CRISPRCasFinder,CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 9, identity: 0.727
gaccagcaggccggcctgcatcagcacataaag CRISPR spacer
caccagcaggccgccctgcatctgcgtggcgag Protospacer
************ ******** **... .**
874. spacer 11.1|1694084|33|NC_017584|CRISPRCasFinder,CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 9, identity: 0.727
gaccagcaggccggcctgcatcagcacataaag CRISPR spacer
attcagcaggccgacctgcaccagcaccgaagc Protospacer
. .**********.******.****** **.
875. spacer 11.1|1694084|33|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
gaccagcaggccggcctgcatcagca----cataaag CRISPR spacer
ggccagcaggccggccagcaccagcagcgccgc---- Protospacer
*.************** ***.***** *..
876. spacer 11.5|1694343|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcggcggtcgacgatctgttgcgcgcgcaccgt CRISPR spacer
cggcggcggtcgccgatctggtgcgcgccctgggg Protospacer
********** ******* ******* * *
877. spacer 11.5|1694343|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcggcggtcgacgatctgttgcgcgcgcaccgt CRISPR spacer
cggcggcggtcgccgatctggtgcgcgccctgggg Protospacer
********** ******* ******* * *
878. spacer 11.5|1694343|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcggcggtcgacgatctgttgcgcgcgcaccgt CRISPR spacer
cggcggcggtcgccgatctggtgcgcgccctgggg Protospacer
********** ******* ******* * *
879. spacer 11.5|1694343|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcggcggtcgacgatctgttgcgcgcgcaccgt CRISPR spacer
cggcggcggtcgccgatctggtgcgcgccctgggg Protospacer
********** ******* ******* * *
880. spacer 11.5|1694343|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcggcggtcgacgatctgttgcgcgcgcaccgt CRISPR spacer
cggcggcggtcgccgatctggtgcgcgccctgggg Protospacer
********** ******* ******* * *
881. spacer 11.5|1694343|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcggcggtcgacgatctgttgcgcgcgcaccgt CRISPR spacer
cggcggcggtcgccgatctggtgcgcgccctgggg Protospacer
********** ******* ******* * *
882. spacer 11.5|1694343|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.743
gcgcggcggtcgacgatctgttgcgcgcgcaccgt CRISPR spacer
cggcggcggtcgccgatctggtgcgcgccctgggg Protospacer
********** ******* ******* * *
883. spacer 11.8|1694538|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 9, identity: 0.743
ccaacccggacgtcgccgccgccgtcaaacgcggg CRISPR spacer
ccaaccccgatgtcgccgccgccgtccgcaacaag Protospacer
******* **.*************** . .*..*
884. spacer 11.14|1694930|33|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to MG592452 (Vibrio phage 1.076.O._10N.286.51.B7, partial genome) position: , mismatch: 9, identity: 0.727
aacagcctcttcaagcatccgagcttgaccgct CRISPR spacer
ctccgcctcttcaagcatcggatcttgaaacat Protospacer
* *************** ** ***** *
885. spacer 11.25|1695647|33|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 9, identity: 0.727
gcaggacgtggcccgggtgcgccggtaccgcca CRISPR spacer
gcaggtcgcggcccgggtgcgccgggtcgaggg Protospacer
***** **.**************** * . .
886. spacer 11.29|1695905|32|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 9, identity: 0.719
ccccggctcggcgtcctccccccacccgttgg CRISPR spacer
gatcgcaacggcgtcctccccagacccgttgt Protospacer
.** ************* ********
887. spacer 2.20|198707|32|NC_017584|CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 10, identity: 0.688
accaggatatcggggccgtggccgaggaggcc CRISPR spacer
catcgacgatcggggccgtggccgcggcggca Protospacer
. *. **************** ** ***
888. spacer 2.20|198707|32|NC_017584|CRT matches to HQ332136 (Dunaliella viridis virus SI2 genomic sequence) position: , mismatch: 10, identity: 0.688
accaggatatcggggccgtggccgaggaggcc CRISPR spacer
ggactgagatcggcgccgtggccgaggatgtt Protospacer
. ** ***** ************** *..
889. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 10, identity: 0.688
gctgccggggcggacgagggccgggtggatta CRISPR spacer
tgagccggggcggacgcgggccgggtcagcgc Protospacer
************* ********* ...
890. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_JX627582 (Methylobacterium oryzae CBMB20 plasmid pMOC3, complete sequence) position: , mismatch: 10, identity: 0.688
gctgccggggcggacgagggccgggtggatta CRISPR spacer
agctccggtgcggaggagggccgggtgaaacc Protospacer
. . **** ***** ************.* .
891. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NZ_CP015369 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p2, complete sequence) position: , mismatch: 10, identity: 0.688
gctgccggggcggacgagggccgggtggatta CRISPR spacer
agctccggtgcggaggagggccgggtgaaacc Protospacer
. . **** ***** ************.* .
892. spacer 2.22|198829|32|NC_017584|CRT,PILER-CR matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 10, identity: 0.688
gctgccggggcggacgagggccgggtggatta CRISPR spacer
gatgcgggggcggaccagggccgggaccccgt Protospacer
* *** ********* ********* .
893. spacer 2.35|199623|32|NC_017584|CRT,PILER-CR matches to NC_008459 (Bordetella pertussis plasmid pBP136 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
cgggcccaggatgacggcggagcgctggaggc CRISPR spacer
ttcgtccaggatgatggcggagggctggcctt Protospacer
. *.*********.******* ***** .
894. spacer 2.37|199745|32|NC_017584|CRT,PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 10, identity: 0.688
aggtcgggctgtccgttgaggcgctgcaggaa CRISPR spacer
ggcacgggctggacgttgaggcgctgcgttcg Protospacer
.* ******* **************. .
895. spacer 2.37|199745|32|NC_017584|CRT,PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 10, identity: 0.688
aggtcgggctgtccgttgaggcgctgcaggaa CRISPR spacer
ggcacgggctggacgttgaggcgctgcgttcg Protospacer
.* ******* **************. .
896. spacer 2.37|199745|32|NC_017584|CRT,PILER-CR matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 10, identity: 0.688
aggtcgggctgtccgttgaggcgctgcaggaa CRISPR spacer
tcatcgggctgtccgtgggggcgctggtcggc Protospacer
.************* *.******* *.
897. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 10, identity: 0.697
cgccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
agccgccgcgaccgtggcgcaggcgacaccggg Protospacer
******* ***** ***********. . ..
898. spacer 5.6|420666|33|NC_017584|PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 10, identity: 0.697
cgccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
cgccgacgggaccggggagcaggcaccgctcgg Protospacer
***** *********** ******. . . *..
899. spacer 5.10|420910|33|NC_017584|PILER-CR matches to NZ_CP019438 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
caacagacgacagcgggatcatcctggcatcga CRISPR spacer
cgttcctcggcaccgggatcatcctggcatccg Protospacer
*. . **.** ****************** .
900. spacer 5.21|421581|33|NC_017584|PILER-CR matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 10, identity: 0.697
cacgatcgggtctttgcgccagttcggcgacca CRISPR spacer
ttagcgaggggctttgcgccagttcgacgacgg Protospacer
. * *** ***************.**** .
901. spacer 5.23|421703|33|NC_017584|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.697
cttgccgcgaatgcggcgcccccctggcggtcg CRISPR spacer
gatcccgcgactgcggcgccaccctggccagtt Protospacer
* ****** ********* ******* . .
902. spacer 5.26|420423|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688
gcgcgggcatcatctgccccgcacaccatagc CRISPR spacer
tcgcgggcatcatcggcgccgcaccggccgac Protospacer
************* ** ****** ...*
903. spacer 5.28|420545|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 10, identity: 0.688
gacgccgcgaacgtcctgaccgaagccctggc CRISPR spacer
gtcgccgccaaggtcctgaccgaagggtccaa Protospacer
* ****** ** ************* .. .
904. spacer 5.28|420545|32|NC_017584|CRISPRCasFinder,CRT matches to MN096362 (Arthrobacter phage Vibaki, complete genome) position: , mismatch: 10, identity: 0.688
gacgccgcgaacgtcctgaccgaagccctggc CRISPR spacer
cgatccgcgaccgtcctgatcgaagccgcccc Protospacer
. ****** ********.******* . *
905. spacer 5.30|420667|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 10, identity: 0.688
gccgccgggaccggggcgcaggcgatctacaa CRISPR spacer
gccgacgggaccggggagcaggcaccgctcgg Protospacer
**** *********** ******. . . *..
906. spacer 5.34|420911|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP019438 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aacagacgacagcgggatcatcctggcatcga CRISPR spacer
gttcctcggcaccgggatcatcctggcatccg Protospacer
. . **.** ****************** .
907. spacer 5.36|421033|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP017887 (Pseudomonas frederiksbergensis strain ERDD5:01 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aagcccggggtttatggagagcataccatgac CRISPR spacer
gtcggtggggtttatggagcgcttaccatgca Protospacer
. .************* ** *******
908. spacer 5.42|421399|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
cggccgaatgttgcccgcccctccccctgtcc CRISPR spacer
tacatagatattggccgcccctccccctgtgc Protospacer
.. ...**.*** **************** *
909. spacer 5.45|421582|32|NC_017584|CRISPRCasFinder,CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 10, identity: 0.688
acgatcgggtctttgcgccagttcggcgacca CRISPR spacer
ggcacatattctttgttccagttcggcgacca Protospacer
. *. . ******. ***************
910. spacer 5.45|421582|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP044330 (Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
acgatcgggtctttgcgccagttcggcgacca CRISPR spacer
gggatcggggctttgcgccggttcgatcatgc Protospacer
. ******* *********.*****.. *.
911. spacer 5.45|421582|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 10, identity: 0.688
acgatcgggtctttgcgccagttcggcgacca CRISPR spacer
gggatcggggctttgcgccggttcgatcatgc Protospacer
. ******* *********.*****.. *.
912. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to KY290956 (Aeromonas phage L9-6, complete genome) position: , mismatch: 10, identity: 0.688
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
tttatgctcgatcgatgggatatcggcggcag Protospacer
...************* *** *****.*...
913. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to KY290951 (Aeromonas phage 31.2, complete genome) position: , mismatch: 10, identity: 0.688
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
tttatgctcgatcgatgggatatcggcggcag Protospacer
...************* *** *****.*...
914. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to NC_005135 (Aeromonas phage 44RR2.8t, complete genome) position: , mismatch: 10, identity: 0.688
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
tttatgctcgatcgatgggatatcggcggcag Protospacer
...************* *** *****.*...
915. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to AY962392 (Aeromonas phage 31, complete genome) position: , mismatch: 10, identity: 0.688
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
tttatgctcgatcgatgggatatcggcggcag Protospacer
...************* *** *****.*...
916. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to KY290958 (Aeromonas phage SW69-9, complete genome) position: , mismatch: 10, identity: 0.688
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
tttatgctcgatcgatgggatatcggcggcag Protospacer
...************* *** *****.*...
917. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to AY375531 (Bacteriophage 44RR2.8t, complete genome) position: , mismatch: 10, identity: 0.688
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
tttatgctcgatcgatgggatatcggcggcag Protospacer
...************* *** *****.*...
918. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to KY290948 (Aeromonas phage 44RR2.8t.2, complete genome) position: , mismatch: 10, identity: 0.688
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
tttatgctcgatcgatgggatatcggcggcag Protospacer
...************* *** *****.*...
919. spacer 5.49|421826|32|NC_017584|CRISPRCasFinder,CRT matches to KY290957 (Aeromonas phage Riv-10, complete genome) position: , mismatch: 10, identity: 0.688
gccgtgctcgatcgatgcgatctcggcagtga CRISPR spacer
tttatgctcgatcgatgggatatcggcggcag Protospacer
...************* *** *****.*...
920. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
gcgtggccggctgcggcgcgaggccgaggctg Protospacer
.*.*** *** ***************. .
921. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 10, identity: 0.688
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
gcacatccgcctgctgcgcgaggccgaggacc Protospacer
*. ******* **************
922. spacer 5.57|422316|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688
cttcaaaaacccgcgatttccgccgcgattgc CRISPR spacer
cagtcaaaatccgcggtttccgccgcgacgag Protospacer
* . ****.*****.************. .
923. spacer 5.64|422743|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP015630 (Borrelia turicatae strain BTE5EL plasmid lp159) position: , mismatch: 10, identity: 0.688
tcggcgggaagttcatttcgtgcattgcgatt CRISPR spacer
attgtgggaagttcaattggtgcattgcttac Protospacer
. *.********** ** ********* .
924. spacer 5.65|421886|33|NC_017584|PILER-CR matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 10, identity: 0.697
ctgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
tgctcgaccaccagaggcgcgaggccgagcgac Protospacer
. .*****.** **************** .
925. spacer 6.7|530488|30|NC_017584|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 10, identity: 0.667
gtcaccagggcgatgccgatcacccgcacg CRISPR spacer
gtcaccacggcgatgccgatcgtggttgaa Protospacer
******* *************.. .. .
926. spacer 7.1|989414|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to CP009912 (Borreliella chilensis strain VA1 plasmid lp54, complete sequence) position: , mismatch: 10, identity: 0.706
agctaaatacaataacgataaaagaaatacggat CRISPR spacer
atctaaatacaataaccatagaagaatataatgt Protospacer
* ************** ***.***** . .*
927. spacer 7.1|989414|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015595 (Acinetobacter sp. NCu2D-2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
agctaaatacaataacgataaaagaaatacggat CRISPR spacer
taatatatacaataactataaaagaaacaaagca Protospacer
. ** ********** **********.* .*
928. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023551 (Rhodobacter sp. CZR27 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ggccgcgccgcgggcgccggcgccatggccgt Protospacer
* . ..********* ****** ******
929. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ccgtcgatcgcggccgcgagcgccgcatcgat Protospacer
************ ****.***** .. * .
930. spacer 7.4|989610|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041156 (Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gggcacgacgccgttgatcgccttggccaccgcc CRISPR spacer
cctgtcggtgccgctgatcgcctcggccaccgca Protospacer
**..****.*********.*********
931. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
ggtgcccgccccgcgcggcaccaccggcaccc Protospacer
************ ** ******* ... *
932. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gttgcccgccccgcccaccagcacgtcgcgct Protospacer
***************.*** *** . * .
933. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gttgcccgccccgcccaccagcacgtcgcgct Protospacer
***************.*** *** . * .
934. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
cgcgcgcgccacgcccgccaccaccccgacat Protospacer
* .** **** *************** . ..
935. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gttgcccgccccgcccaccagcacgtcgcgct Protospacer
***************.*** *** . * .
936. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gttgcccgccccgcccaccagcacgtcgcgct Protospacer
***************.*** *** . * .
937. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gttgcccgccccgcccaccagcacgtcgcgct Protospacer
***************.*** *** . * .
938. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gttgcccgccccgcccaccagcacgtcgcgct Protospacer
***************.*** *** . * .
939. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gttgcccgccccgcccaccagcacgtcgcgct Protospacer
***************.*** *** . * .
940. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040824 (Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
ttcgcccgcccgggccgccaccaccccgccct Protospacer
.*.******** * ************ .
941. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
gttgcccgccccgcccaccagcacgtcgcgct Protospacer
***************.*** *** . * .
942. spacer 7.10|990008|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcccgccccgcccgccaccacccatgggc CRISPR spacer
ggcgcccgccacgcccgcccccacccggcgcg Protospacer
.******* ******** ******. *
943. spacer 7.15|990337|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014519 (Sinomonas atrocyanea strain KCTC 3377 plasmid pSA01, complete sequence) position: , mismatch: 10, identity: 0.706
cgttctcggtctacatcgaccccgaggcggatac CRISPR spacer
cgttcccgctctacatcgaccccgacttcaccaa Protospacer
*****.** **************** . . .*
944. spacer 7.19|990602|35|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 10, identity: 0.714
cggccccgccctcctcccctccccggcgcggtgct CRISPR spacer
cggccccgccctcctccccatcccgatcctcgaca Protospacer
******************* .****.. * .*
945. spacer 7.26|991060|33|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_005919 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326B, complete sequence) position: , mismatch: 10, identity: 0.697
gatcaacaaaggcgatcgtcaagtatgtctcaa CRISPR spacer
atccgtaaagggccatcgtcaagtatgtctctt Protospacer
. .*. **.*** *****************
946. spacer 7.26|991060|33|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047263 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326B, complete sequence) position: , mismatch: 10, identity: 0.697
gatcaacaaaggcgatcgtcaagtatgtctcaa CRISPR spacer
atccgtaaagggccatcgtcaagtatgtctctt Protospacer
. .*. **.*** *****************
947. spacer 7.29|991256|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026928 (Agrobacterium tumefaciens strain 1D1609 plasmid pAt1D1609b, complete sequence) position: , mismatch: 10, identity: 0.706
aagatcgatgttttcgacgagatccacgccgcgt CRISPR spacer
aggatcgattttttcggcgagatccataaggacc Protospacer
*.******* ******.*********.. * .
948. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MK977705 (Gordonia Phage Mollymur, complete genome) position: , mismatch: 10, identity: 0.688
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
tccgagagcgcaatgaccggtggtggcgcgcc Protospacer
.. * **** ***.************** .
949. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
950. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
951. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NC_023316 (Streptomyces sp. 14R-10 plasmid pZL1, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
ttgaggccaccgagccggagcccgaggaggagcg Protospacer
. * ** ******* ************* *
952. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
953. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
ctccgccgcccgagcctgagcccgagccgcccga Protospacer
* ***** ********.********* * ..
954. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cagaagccgccgagcccgatcccgaggaggacac Protospacer
*. . ** ********** ********** . *
955. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
956. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
957. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
958. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
959. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
960. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
961. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
962. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
963. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
964. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
965. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
966. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
967. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
968. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
969. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
970. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
971. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
972. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
cagaagcgcccgagcccgagcccgaagtggttga Protospacer
*. . * *****************.* ****
973. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
974. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
aagaagcccccgagaccgaggccgaggaggattc Protospacer
. . ******** ***** ********* *.*
975. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgccgacgccgtcctggtccagcgtctgga Protospacer
************.******* ** * .
976. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
cttgcggacgccgtcctggtcgaggcagcgaa Protospacer
*.** *******.************ . .
977. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
cgcgcctacaccgccctggtcgagggccgcac Protospacer
**** **.*************** . .*
978. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgccgacgccgtcctggtccagcgtctgga Protospacer
************.******* ** * .
979. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gacgtcgccgccgccctggtcgaggaacgcgt Protospacer
. **.** ***************** .*
980. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
cacgacgtcgccgccctggtcgaggagtggct Protospacer
** ** ***************** . *
981. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ggcgccgatgccggcctggtcgagggcggcgc Protospacer
. ******.**** *********** ...*
982. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ctcgccgacgccgtcctggtccagcgtctgga Protospacer
************.******* ** * .
983. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
ggtgtggaccccgccctggtggaggctaataa Protospacer
. .*. *** ********** ********. .
984. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MH834619 (Arthrobacter phage Maureen, complete genome) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gccgcccacgccgcgctggtcgaggacgtcgc Protospacer
..**** ******* ********** .. *
985. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_048115 (Arthrobacter phage Liebe, complete genome) position: , mismatch: 10, identity: 0.688
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gccgcccacgccgcgctggtcgaggacgtcgc Protospacer
..**** ******* ********** .. *
986. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041156 (Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
accgtggccccgatcgccgccgcctgggcgga Protospacer
*. .. *********** *** *******
987. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
tcatccgcgccgatcgccgcagcgcgggcggt Protospacer
..* . *************** ******
988. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032928 (Agrobacterium tumefaciens strain 1D1460 plasmid pAt1D1460, complete sequence) position: , mismatch: 10, identity: 0.688
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
cttgcgtcgccgatcgcggcaaccagggcggt Protospacer
* . ********* ***.*********
989. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016290 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
tcatccgcgccgatcgccgcagcgcgggcggt Protospacer
..* . *************** ******
990. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010837 (Sphingomonas hengshuiensis strain WHSC-8 isolate soil of Hengshui Lake plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
cggtaaatgccgatcgcggcagccaataggat Protospacer
***** ********* *******. . *.
991. spacer 10.11|1581230|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688
ccgctcggcacgggggcgggggcgggttgtag CRISPR spacer
gggctggccacgggggcgggggcgggggccgt Protospacer
*** * ****************** ..
992. spacer 10.11|1581230|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.688
ccgctcggcacgggggcgggggcgggttgtag CRISPR spacer
gcgctcggcacgggggtgggtgcgcagcaagg Protospacer
***************.*** *** . .. .*
993. spacer 10.11|1581230|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688
ccgctcggcacgggggcgggggcgggttgtag CRISPR spacer
gcactcggcgcgggtgcgggggcgggcatcgc Protospacer
*.******.**** ***********. ..
994. spacer 10.15|1581474|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032703 (Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tccccattggcgatgcagagggcgcacaatgg CRISPR spacer
ttgtgattggcgatgcggagcgcgcacaggac Protospacer
*. . ***********.*** *******. .
995. spacer 10.19|1581718|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 10, identity: 0.688
ggtcgcgcagcgtgatgaggtcagtcatgatc CRISPR spacer
gcgtgcgcagcgcgatgaggtcggtcaactcg Protospacer
* .********.*********.**** .
996. spacer 10.20|1581779|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NC_008758 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence) position: , mismatch: 10, identity: 0.688
gcgcgtcggcggaccaagccagcagagacgag CRISPR spacer
aagcggcgccggaccaagccagcaggcccagc Protospacer
. *** ** ****************. *..
997. spacer 11.27|1695775|34|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gccgttcgtggctgcgcagatcgcctacattcgg CRISPR spacer
ggagttcgaggcggcgcagatcgcctatcgcgag Protospacer
* ***** *** **************. . .*
998. spacer 11.27|1695775|34|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.706
gccgttcgtggctgcgcagatcgcctacattcgg CRISPR spacer
ggagttcgaggcggcgcagatcgcctatcgcgag Protospacer
* ***** *** **************. . .*
999. spacer 11.27|1695775|34|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.706
gccgttcgtggctgcgcagatcgcctacattcgg CRISPR spacer
ggaattcgaggcggcgcagatcgcctaccgcgag Protospacer
* .**** *** *************** . .*
1000. spacer 13.15|2669203|37|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 10, identity: 0.73
tcggaggtaacgccattgtcggcgccgtcgtcttcgg CRISPR spacer
gcgctttcatcgccattgtcggcgccggcatcttcgt Protospacer
** .* ***************** *.******
1001. spacer 5.50|421887|32|NC_017584|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
tgccgaccgcctgaggcgcgaggccgaggtga CRISPR spacer
cctgcgccgcgtgacgcgcgaggccgagggcc Protospacer
. . .**** *** **************
1002. spacer 7.1|989414|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to HQ906666 (Wolbachia endosymbiont wVitB of Nasonia vitripennis phage WOVitB segment 2, partial genome) position: , mismatch: 11, identity: 0.676
agctaaatacaataacgataaaagaaatacggat CRISPR spacer
cagaagataaagtaacgataaaagaaatacctgc Protospacer
. *.*** *.****************** ..
1003. spacer 7.1|989414|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to HQ906662 (Wolbachia endosymbiont wVitA of Nasonia vitripennis phage WOVitA1, complete sequence) position: , mismatch: 11, identity: 0.676
agctaaatacaataacgataaaagaaatacggat CRISPR spacer
cagaagataaagtaacgataaaagaaatacctgc Protospacer
. *.*** *.****************** ..
1004. spacer 7.1|989414|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to KX522565 (Wolbachia phage WO, complete genome) position: , mismatch: 11, identity: 0.676
agctaaatacaataacgataaaagaaatacggat CRISPR spacer
cagaagataaagtaacgataaaagaaatacctgc Protospacer
. *.*** *.****************** ..
1005. spacer 7.2|989480|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 11, identity: 0.656
gcgtcgatcgcgggcgcgggcgccttggccgg CRISPR spacer
ctcctcctcgcgggcgccggcgcctcggccat Protospacer
. .. ********** *******.****.
1006. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1007. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1008. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1009. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1010. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1011. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1012. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1013. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1014. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1015. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1016. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1017. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1018. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1019. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1020. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1021. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1022. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1023. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1024. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1025. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1026. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1027. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1028. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1029. spacer 7.27|991125|34|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tccgtcggccaagacgaaatgtcgtttcggcgcc CRISPR spacer
agaaatgctcaagccgaaaagtcgtttcggcgca Protospacer
. .* .**** ***** *************
1030. spacer 7.30|991322|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 11, identity: 0.656
ctggcccgcgccatggccggtggtggcgcgat CRISPR spacer
gcccgccgcgccttggccggtgctggcggccg Protospacer
. ******* ********* *****
1031. spacer 8.2|1281920|34|NC_017584|CRISPRCasFinder matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 11, identity: 0.676
cgccgccccccgagcccgagcccgaggaggttcc CRISPR spacer
gtccggcgcccgagcccgagcccgagcgtccggc Protospacer
*** * ****************** . . *
1032. spacer 10.1|1580620|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MH513981 (Microbacterium phage Papafritta, complete genome) position: , mismatch: 11, identity: 0.656
atcgccgacgccgccctggtcgaggctaaccg CRISPR spacer
gatgccgacgccgacctgggcgaggcggcgaa Protospacer
. .********** ***** ****** . .
1033. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
gccagcgcgccggtcggcgcagccagggcggc Protospacer
.. . . ****.*** **************
1034. spacer 10.3|1580742|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
atgtaaaggccgatcgccgcagccagggcgga CRISPR spacer
gccaggcgggccatcgccgcagccagggcgcg Protospacer
.. .. ** * ****************** .
1035. spacer 10.11|1581230|32|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 11, identity: 0.656
ccgctcggcacgggggcgggggcgggttgtag CRISPR spacer
tcgcccggcaccggggcgggggcgaagaaggc Protospacer
.***.****** ************.. . .
1036. spacer 11.5|1694343|35|NC_017584|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.686
gcgcggcggtcgacgatctgttgcgcgcgcaccgt CRISPR spacer
acgcggcggtcgccgatctggtgcgcacctgggag Protospacer
.*********** ******* *****.* .. .
1037. spacer 13.15|2669203|37|NC_017584|PILER-CR,CRISPRCasFinder,CRT matches to MN617843 (Mycobacterium phage Quesadilla, complete genome) position: , mismatch: 11, identity: 0.703
tcggaggtaacgccattgtcggcgccgtcgtcttcgg CRISPR spacer
gccaggtgcccgccattgtcggcggcgtcgtcctcgt Protospacer
* ..* ************** *******.***
