Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017195 Bacillus subtilis subsp. subtilis str. RO-NN-1, complete sequence 3 crisprs csa3,cas3,DEDDh,WYL,DinG 0 1 10 0

Results visualization

1. NC_017195
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017195_1 917213-917322 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017195_2 2963027-2963134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017195_3 3506909-3507016 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NZ_CP024037 Bacillus aryabhattai strain K13 plasmid unnamed2 10417-10476 7 0.883
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NZ_CP026740 Bacillus megaterium strain YC4-R4 plasmid unnamed4 70764-70823 7 0.883
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NC_017139 Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence 1318-1377 7 0.883
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NZ_CP010587 Bacillus megaterium Q3 plasmid p1, complete sequence 838-897 7 0.883
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NZ_CP023319 Bacillus megaterium strain A plasmid p2, complete sequence 75825-75884 7 0.883
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NC_020451 Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence 1960-2019 9 0.85
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NZ_CP015440 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence 64773-64832 12 0.8
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 483791-483850 13 0.783
NC_017195_2 2.1|2963051|60|NC_017195|CRISPRCasFinder 2963051-2963110 60 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 57361-57420 14 0.767

1. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

2. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

3. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

4. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

5. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

6. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NC_020451 (Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence) position: , mismatch: 9, identity: 0.85

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcattttagttatggcccggg	Protospacer
****************************************** ***   * ***  **. 

7. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NZ_CP015440 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence) position: , mismatch: 12, identity: 0.8

cagcttggaaggctgaggttttaccactaaactacacccgca-------atttttatttg	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcataataatatataccattg	Protospacer
******************************************       ** * .  ***

8. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.783

cagcttggaaggctgaggttttaccactaaactacacccgc--------aatttttattt	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatggttaaaagttttgcca	Protospacer
*****************************************        ** ****... 

9. spacer 2.1|2963051|60|NC_017195|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 14, identity: 0.767

cagcttggaaggctgaggttttaccactaaactacacccgc---------aatttttatt	CRISPR spacer
cagcttggaaggctgtagttttaccactaaactacacccgcatagtaagtagttcttagt	Protospacer
*************** .************************         *.**.*** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 676372 : 684738 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1180902 : 1224244 48 Planktothrix_phage(25.0%) tRNA,protease,coat NA
DBSCAN-SWA_3 1291438 : 1325077 46 Bacillus_phage(29.41%) plate,tail,holin,portal,terminase NA
DBSCAN-SWA_4 1843109 : 1849681 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_5 2050181 : 2058876 8 Bacillus_phage(85.71%) NA NA
DBSCAN-SWA_6 2270370 : 2276667 8 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_7 2632971 : 2685026 55 uncultured_Mediterranean_phage(14.29%) tRNA,protease,coat NA
DBSCAN-SWA_8 3260603 : 3267173 8 Organic_Lake_phycodnavirus(100.0%) holin NA
DBSCAN-SWA_9 3636866 : 3656903 21 Staphylococcus_phage(50.0%) tRNA,protease,bacteriocin NA
DBSCAN-SWA_10 3689535 : 3735351 45 Bacillus_phage(40.0%) holin,protease,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage