Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_019898 Thermobacillus composti KWC4 plasmid pTHECO01, complete sequence 0 crisprs DinG 0 0 0 0
NC_019897 Thermobacillus composti KWC4, complete genome 13 crisprs WYL,csa3,RT,DEDDh,cas3,DinG,csm3gr7,csx19,cas10,csx1,cas2,cas1,cas4,cas5,cas7b,cas8b1,cas6,cas8c,cas7 0 19 10 0

Results visualization

1. NC_019897
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_1 385704-385777 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_2 1029953-1030027 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_3 3124012-3124097 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_4 3270708-3271074 TypeIII NA
5 spacers
csx1,cas10,csm3gr7,csx19,cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_5 3272406-3273787 TypeIII NA
20 spacers
csx1,cas10,csm3gr7,csx19,cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_6 3275311-3277541 TypeIII NA
33 spacers
csx1,cas10,csm3gr7,csx19,cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_7 3279131-3280155 TypeIII NA
15 spacers
csx1,cas10,csm3gr7,csx19,cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_8 3281745-3282977 TypeIII NA
18 spacers
csx1,cas10,csm3gr7,csx19,cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_9 3284570-3285001 TypeIII NA
6 spacers
csx1,cas10,csm3gr7,csx19,cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_10 3298557-3299057 TypeI-B NA
7 spacers
cas6,cas8b1,cas7b,cas5,cas3,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_11 3300647-3300944 TypeI-B NA
4 spacers
cas6,cas8b1,cas7b,cas5,cas3,cas4,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_12 3302535-3302761 TypeI-B NA
3 spacers
cas6,cas8b1,cas7b,cas5,cas3,cas4,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019897_13 3418362-3421103 TypeI NA
40 spacers
cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019897_2 2.1|1029977|27|NC_019897|CRISPRCasFinder 1029977-1030003 27 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1139782-1139808 4 0.852
NC_019897_7 7.1|3279161|37|NC_019897|CRISPRCasFinder,CRT 3279161-3279197 37 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 330832-330868 4 0.892
NC_019897_2 2.1|1029977|27|NC_019897|CRISPRCasFinder 1029977-1030003 27 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1702279-1702305 5 0.815
NC_019897_2 2.1|1029977|27|NC_019897|CRISPRCasFinder 1029977-1030003 27 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 709808-709834 5 0.815
NC_019897_2 2.1|1029977|27|NC_019897|CRISPRCasFinder 1029977-1030003 27 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1412234-1412260 5 0.815
NC_019897_13 13.40|3421038|34|NC_019897|CRISPRCasFinder 3421038-3421071 34 NC_010408 Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence 78221-78254 5 0.853
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 113049-113076 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 130314-130341 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 73883-73910 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 104812-104839 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 83886-83913 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 93621-93648 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 85824-85851 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 77561-77588 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 801-828 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_020086 Escherichia coli plasmid pE66An, complete sequence 2580-2607 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 20154-20181 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 18493-18520 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 6512-6539 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 70939-70966 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 122267-122294 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 166933-166960 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 714-741 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 91813-91840 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 23308-23335 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 97494-97521 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 43132-43159 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 60790-60817 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 78776-78803 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 6566-6593 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 6566-6593 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052160 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence 36646-36673 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 77915-77942 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 72844-72871 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 250088-250115 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 19788-19815 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 166251-166278 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 264252-264279 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_KJ187751 Klebsiella pneumoniae strain 1301 plasmid pTR1, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 146142-146169 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 302116-302143 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 714-741 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_AP023150 Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence 19781-19808 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 13318-13345 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 116928-116955 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 40735-40762 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 144466-144493 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 HG969996 Klebsiella pneumoniae plasmid pIT-12C47, complete sequence 4606-4633 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 169741-169768 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 26543-26570 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 38820-38847 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 70078-70105 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 110908-110935 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 20443-20470 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 145768-145795 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN891680 Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence 9709-9736 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 96997-97024 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 239371-239398 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_LR134255 Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence 74108-74135 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 80838-80865 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 45553-45580 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 111185-111212 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 226303-226330 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 20906-20933 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 166933-166960 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 10313-10340 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 37326-37353 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018818 Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence 71141-71168 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 86405-86432 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 108903-108930 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 99069-99096 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 38081-38108 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 4697-4724 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 117459-117486 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 125037-125064 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 198207-198234 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 99829-99856 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 72535-72562 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 107770-107797 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 37334-37361 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 110693-110720 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 40190-40217 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 270771-270798 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 57311-57338 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 44611-44638 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 91961-91988 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 39208-39235 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 7188-7215 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 129550-129577 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 139436-139463 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 164474-164501 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 80308-80335 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 266849-266876 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP007736 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence 79871-79898 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 126897-126924 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 39245-39272 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 105667-105694 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 49310-49337 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP031581 Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence 6917-6944 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 13313-13340 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 53805-53832 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 133962-133989 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 300485-300512 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 105961-105988 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 126816-126843 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 89359-89386 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 11546-11573 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 173205-173232 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 19797-19824 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 161384-161411 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 53585-53612 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 18700-18727 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP006663 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence 26270-26297 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 86209-86236 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 19781-19808 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 90859-90886 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 77747-77774 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020065 Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence 43097-43124 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 99318-99345 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 121941-121968 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 129481-129508 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 77915-77942 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 63403-63430 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP050168 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence 49443-49470 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 2093-2120 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP034132 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_81.9Kb, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP034679 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence 60078-60105 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 191862-191889 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 26558-26585 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 126227-126254 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 108829-108856 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 254765-254792 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 24321-24348 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 171888-171915 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 141792-141819 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026148 Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence 69156-69183 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026151 Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence 138489-138516 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 78608-78635 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 188725-188752 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP020904 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence 49516-49543 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026139 Klebsiella pneumoniae strain F77 plasmid pF77_3, complete sequence 78258-78285 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 102426-102453 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP034140 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 50553-50580 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 70749-70776 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 152499-152526 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN824001 Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence 1348-1375 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 1359-1386 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 1368-1395 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 77915-77942 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 157974-158001 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 109328-109355 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 25141-25168 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 112789-112816 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 42899-42926 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 65175-65202 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 43371-43398 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 128197-128224 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 177509-177536 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 65941-65968 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 91265-91292 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 714-741 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 208721-208748 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP011577 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence 27533-27560 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP027161 Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence 174900-174927 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 97633-97660 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 126118-126145 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 123358-123385 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052437 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence 714-741 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 75359-75386 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 54469-54496 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP031884 Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 86655-86682 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052353 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence 714-741 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 3600-3627 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_016846 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence 38258-38285 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP028543 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence 101034-101061 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 41730-41757 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP045692 Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence 91675-91702 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 21179-21206 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP054265 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence 23596-23623 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 193371-193398 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 61054-61081 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 94370-94397 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 75323-75350 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052477 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence 122602-122629 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 15252-15279 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 53381-53408 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026716 Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence 55309-55336 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026717 Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence 27790-27817 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 19797-19824 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 171568-171595 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 28543-28570 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 122087-122114 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 40114-40141 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052469 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence 137165-137192 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 186494-186521 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 110022-110049 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP015395 Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence 50781-50808 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP015396 Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence 1360-1387 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 178375-178402 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 50650-50677 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP047635 Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence 67596-67623 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 158993-159020 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 714-741 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 795-822 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 1366-1393 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 19773-19800 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 94683-94710 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 1360-1387 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 801-828 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 145909-145936 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MK248692 Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence 39395-39422 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 116197-116224 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 132058-132085 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 90014-90041 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 204388-204415 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 204716-204743 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 83653-83680 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 130110-130137 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN823997 Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence 1360-1387 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 131513-131540 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 126090-126117 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 160731-160758 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 1291-1318 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 67083-67110 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 79867-79894 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 38189-38216 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 MT108210 Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence 38277-38304 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP033774 Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence 6824-6851 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 36884-36911 6 0.786
NC_019897_1 1.1|385727|28|NC_019897|CRISPRCasFinder 385727-385754 28 NZ_CP054304 Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence 39840-39867 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP015071 Escherichia coli strain Ecol_743 plasmid pEC743_OXA48, complete sequence 1848-1875 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KM406488 Salmonella enterica subsp. enterica serovar Paratyphi B strain R69 plasmid R69, complete sequence 64566-64593 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KP975075 Citrobacter freundii strain MRSN12115 plasmid pMRVIM1012, complete sequence 71140-71167 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018443 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-2, complete sequence 31515-31542 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP034202 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L_2, complete sequence 67989-68016 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP029447 Serratia marcescens strain CAV1761 plasmid pCAV1761-73, complete sequence 30880-30907 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018717 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-3, complete sequence 30965-30992 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018723 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-3, complete sequence 28071-28098 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018706 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-3, complete sequence 44650-44677 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018694 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-2, complete sequence 9417-9444 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP031566 Enterobacter hormaechei strain 2013_1a plasmid pIncLM-1301491, complete sequence 35308-35335 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_025134 Klebsiella pneumoniae plasmid pFOX-7a, complete sequence 89236-89263 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP019841 Enterobacter roggenkampii strain R11 plasmid pASM2, complete sequence 63571-63598 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP010365 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-70.092kb, complete sequence 56526-56553 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018669 Klebsiella pneumoniae strain CAV1042 plasmid pKPC_CAV1042-89, complete sequence 37316-37343 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP016927 Klebsiella pneumoniae isolate 23 plasmid pIncL_M_DHQP1400954, complete sequence 60231-60258 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018315 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-3, complete sequence 50712-50739 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP027148 Klebsiella pneumoniae strain AR_0363 plasmid unnamed5 9747-9774 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP015075 Escherichia coli strain Ecol_745 plasmid pEC745_OXA48, complete sequence 26557-26584 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018690 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-3, complete sequence 29557-29584 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP031374 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvOXA-48, complete sequence 17350-17377 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MN187903 Citrobacter freundii strain Cf164 plasmid pCf164_CTX-M-8, complete sequence 8591-8618 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP032170 Klebsiella pneumoniae strain AR_0076 plasmid unnamed3, complete sequence 4172-4199 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018342 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-5, complete sequence 44657-44684 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 CP020502 Serratia marcescens strain BWH-23 plasmid unnamed, complete sequence 46430-46457 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP033880 Escherichia coli strain 50579417 plasmid p50579417_3_OXA-48, complete sequence 42528-42555 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP029720 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed2, complete sequence 7165-7192 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018712 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-3, complete sequence 34183-34210 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP021742 Klebsiella pneumoniae strain AR_0126 plasmid tig00000002jNODE_23, complete sequence 71741-71768 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KY215945 Klebsiella pneumoniae subsp. pneumoniae strain Kp1210 plasmid pOXA-519, complete sequence 58791-58818 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KY200950 Klebsiella pneumoniae subsp. pneumoniae strain Kp1219 plasmid pOXA-517, complete sequence 29304-29331 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KY781949 Klebsiella pneumoniae isolate Kp41 plasmid pKp41M, complete sequence 3605-3632 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KY213890 Klebsiella pneumoniae strain 38_wz plasmid pOXA48_wz, complete sequence 4127-4154 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LT838202 Escherichia coli isolate WI2 isolate plasmid pWI2-OXA48, complete sequence 58501-58528 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LN864821 Raoultella planticola plasmid pRA35, complete sequence, strain RA35 61550-61577 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP014072 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed1 48253-48280 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP050846 Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-1, complete sequence 24058-24085 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KX524525 Klebsiella pneumoniae strain RAY plasmid pRAY, complete sequence 19698-19725 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KX523901 Klebsiella pneumoniae strain Kpn-30715/15 plasmid pOXA-48_30715, complete sequence 63604-63631 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KX523900 Klebsiella pneumoniae strain Kpn-04963/15 plasmid pOXA-48_4963, complete sequence 61682-61709 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KX523902 Klebsiella pneumoniae strain Kpn-30891/15 plasmid pOXA-48_30891, complete sequence 64175-64202 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KX636096 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-2, complete sequence 27514-27541 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KT935445 Klebsiella pneumoniae strain Kp6411 plasmid 6411TF, complete sequence 8548-8575 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KM406491 Klebsiella pneumoniae strain Kpn-E1.Nr7 plasmid pKpn-E1.Nr7, complete sequence 35933-35960 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KP659188 Klebsiella pneumoniae strain 153877-1 plasmid pOXA-48E1, complete sequence 4207-4234 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KP025948 Proteus mirabilis strain Pm-Oxa48 plasmid pOXA48-Pm, complete sequence 4128-4155 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KP061858 Enterobacter cloacae strain INSRA17313-1 plasmid pUR17313-1, complete sequence 58995-59022 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP034041 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p2, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP011599 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-83, complete sequence 63163-63190 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP044032 Klebsiella pneumoniae strain FDAARGOS_631 plasmid unnamed1, complete sequence 1210-1237 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP048353 Raoultella ornithinolytica strain 23 plasmid p23_D-OXA48, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP034283 Klebsiella pneumoniae strain I72 plasmid p72_LM_OXA48, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP037737 Citrobacter freundii strain CAV1857 plasmid pKPC_CAV1857-85, complete sequence 18317-18344 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP023419 Klebsiella pneumoniae strain 1050 plasmid pKp1050-3, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MK249855 Enterobacter cloacae strain 105 plasmid unnamed, complete sequence 59994-60021 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MK249856 Klebsiella pneumoniae strain 91 plasmid unnamed, complete sequence 59994-60021 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MK249858 Escherichia coli strain 46 plasmid unnamed, complete sequence 59994-60021 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_021488 Klebsiella pneumoniae plasmid pKPoxa-48N1, complete sequence 28745-28772 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 28745-28772 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP027039 Klebsiella pneumoniae strain 16_GR_13 plasmid IncLM, complete sequence 35999-36026 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP020530 Enterobacter cloacae strain 174 plasmid unnamed2, complete sequence 28767-28794 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP020844 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-3, complete sequence 1699-1726 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP020844 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-3, complete sequence 63445-63472 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_019154 Klebsiella pneumoniae plasmid pOXA-48, complete sequence 59994-60021 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP041085 Klebsiella pneumoniae strain Kp202 plasmid pKp202_3, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP023251 Klebsiella pneumoniae strain CCUG 70742 plasmid pKpn70742_2 36840-36867 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MK966141 Enterobacter cloacae strain GHZ8R11B plasmid pHNGDR11, complete sequence 58900-58927 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MK966142 Klebsiella pneumoniae strain GHP8R3B plasmid pHNGDR03, complete sequence 57507-57534 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP029138 Klebsiella pneumoniae strain AR376 plasmid unnamed3, complete sequence 21573-21600 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP031805 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed5, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP040036 Klebsiella pneumoniae strain KPC160117 plasmid pOXA48-L117, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP022153 Citrobacter freundii strain 705SK3 plasmid p705SK3_2, complete sequence 3613-3640 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP029599 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-77, complete sequence 46466-46493 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP022150 Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_2, complete sequence 3613-3640 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LR025105 Escherichia coli isolate EC-1639 plasmid pOXA-48_1639, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP022826 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-3, complete sequence 15603-15630 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_AP019667 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63632, complete sequence 28768-28795 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP011614 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-92, complete sequence 52717-52744 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP017932 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-76, complete sequence 43500-43527 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MN792918 Klebsiella aerogenes strain ST143 plasmid pLAU_KAM9_OXA48, complete sequence 39594-39621 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP017936 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-76, complete sequence 58465-58492 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP040031 Klebsiella pneumoniae strain KPC160121 plasmid pOXA48-L121, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018461 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-2, complete sequence 41215-41242 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP011640 Serratia marcescens strain CAV1492 plasmid pCAV1492-73, complete sequence 28215-28242 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP032174 Klebsiella pneumoniae strain AR_0160 plasmid unnamed2, complete sequence 9253-9280 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LR025095 Klebsiella pneumoniae isolate KP9201 plasmid pOXA-48_920, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP045017 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-2, complete sequence 3605-3632 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP053283 Escherichia coli strain SCU-308 plasmid pSCU-308-2, complete sequence 7046-7073 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC545849 Escherichia coli Ec-MW04 plasmid pEc-MW04_OXA DNA, complete sequence 8978-9005 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC545850 Klebsiella variicola Kv-MW05 plasmid pKv-MW05_OXA DNA, complete sequence 8978-9005 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP011632 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-84, complete sequence 64147-64174 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP014698 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS2, complete sequence 9762-9789 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP011593 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-69, complete sequence 62951-62978 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP011656 Citrobacter freundii strain CAV1741 plasmid pKPC_CAV1741, complete sequence 63638-63665 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 KU159085 Klebsiella pneumoniae plasmid pOXAAPSS1, complete sequence 57440-57467 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP011609 Citrobacter freundii strain CAV1321 plasmid pCAV1321-71, complete sequence 28566-28593 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_023027 Klebsiella pneumoniae strain E71T plasmid, complete sequence 62151-62178 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LN864819 Klebsiella pneumoniae plasmid pKP112, complete sequence, strain KP112 82368-82395 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LN864820 Citrobacter freundii plasmid pCF29, complete sequence, strain CF29 47267-47294 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LR025091 Klebsiella pneumoniae isolate KP980 plasmid pOXA-48_980, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_019346 Enterobacter cloacae plasmid pNE1280, complete sequence 38896-38923 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018700 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-3, complete sequence 18830-18857 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LR745044 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pOXA48_Kpn154 59877-59904 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_021078 Klebsiella pneumoniae strain Kp002 plasmid pJEG011, complete sequence 69562-69589 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP027699 Klebsiella pneumoniae strain KP30835 plasmid unnamed4, complete sequence 15492-15519 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LT985279 Escherichia coli strain 676 plasmid RCS60_p, complete sequence 59311-59338 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_MK088079 Klebsiella pneumoniae strain 19 plasmid unnamed, complete sequence 39831-39858 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_MK370728 Klebsiella pneumoniae strain 69G1 plasmid pLimOXA-48, complete sequence 3601-3628 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_MF156266 Escherichia coli strain 24-S11 plasmid pCESC2, complete sequence 12306-12333 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP030135 Klebsiella pneumoniae strain 160111 plasmid pOXA48_L111, complete sequence 36040-36067 6 0.786
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018736 Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-2 6078-6105 6 0.786
NC_019897_13 13.40|3421038|34|NC_019897|CRISPRCasFinder 3421038-3421071 34 NZ_CP042827 Ruania sp. HY168 plasmid unnamed, complete sequence 15659-15692 6 0.824
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KX783441 Klebsiella pneumoniae strain KP4368 plasmid pKP4368, complete sequence 57753-57780 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KM406490 Salmonella enterica subsp. enterica serovar Typhimurium strain 202 plasmid pSEM, complete sequence 1854-1881 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KM406489 Serratia marcescens strain R471 plasmid R471, complete sequence 32659-32686 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 CP048042 Serratia liquefaciens strain JL02 plasmid unnamed1, complete sequence 65474-65501 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP035217 Klebsiella michiganensis strain M82255 plasmid pKOCBH-C, complete sequence 27448-27475 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556214 Escherichia coli CEX24 plasmid pCEX24 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556215 Escherichia coli CEX25 plasmid pCEX25 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556216 Escherichia coli CEX14 plasmid pCEX14 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556217 Escherichia coli CEX3 plasmid pCEX3 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556218 Enterobacter cloacae CEX5 plasmid pCEX5 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556219 Enterobacter cloacae CEX6 plasmid pCEX6 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556220 Enterobacter cloacae CEX4 plasmid pCEX4 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556221 Klebsiella pneumoniae CEX18 plasmid pCEX18 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC556222 Klebsiella pneumoniae CEX23 plasmid pCEX23 DNA, complete sequence 64028-64055 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_024997 Klebsiella oxytoca plasmid pACM1, complete sequence 38004-38031 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 35115-35142 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LT985387 Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI 3647-3674 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP007733 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-068, complete sequence 49249-49276 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP017853 Klebsiella variicola strain GJ2 plasmid pKPGJ-2d, complete sequence 27564-27591 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP009852 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-e56, complete sequence 19447-19474 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP026395 Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-edb7, complete sequence 9466-9493 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP026142 Klebsiella pneumoniae strain F127 plasmid pF127_2, complete sequence 8466-8493 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC536683 Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence 17399-17426 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP026210 Citrobacter sp. CFNIH10 plasmid pKPC-2fe2, complete sequence 32870-32897 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 KU159086 Klebsiella pneumoniae plasmid pOXAAPSS2, complete sequence 61755-61782 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042490 Enterobacter hormaechei strain C15 plasmid pC15_002 57893-57920 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LT985241 Escherichia coli strain 721 plasmid RCS40_p, complete sequence 26085-26112 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KX009507 Escherichia coli strain 06K2206 plasmid LM6771, complete sequence 37573-37600 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_019368 Enterobacter cloacae plasmid pEl1573, complete sequence 83587-83614 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KM877517 Enterobacter cloacae strain CRE623 plasmid pIMP-HB623, complete sequence 77745-77772 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KP294351 Escherichia coli strain CZD1527 plasmid pIGT15, complete sequence 3901-3928 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_KU315015 Serratia marcescens strain NCTC 50331 plasmid R1215, complete sequence 4132-4159 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 AP018454 Klebsiella pneumoniae plasmid pMRY13-133KPN_2 DNA, complete genome, strain: MRY13-133 23837-23864 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 AP018455 Klebsiella aerogenes plasmid pMRY13-134EAE_1 DNA, complete genome, strain: MRY13-134 32855-32882 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_004464 Citrobacter freundii plasmid pCTX-M3, complete sequence 85324-85351 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042501 Enterobacter sp. E76 plasmid pE76_002, complete sequence 40532-40559 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP048339 Escherichia coli strain 142 plasmid p142_B, complete sequence 4603-4630 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042509 Leclercia adecarboxylata strain E1 plasmid pE1_004, complete sequence 26001-26028 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP026194 Enterobacteriaceae bacterium ENNIH1 plasmid pKPC-825d, complete sequence 27320-27347 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LT994838 Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence 45861-45888 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP024878 Klebsiella pneumoniae strain NH25 plasmid pNH25.4, complete sequence 17970-17997 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_005246 Erwinia amylovora LebB66 plasmid pEL60, complete sequence 56001-56028 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042514 Serratia marcescens strain E28 plasmid pE28_002, complete sequence 31722-31749 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC508263 Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence 82053-82080 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP017288 Klebsiella variicola strain GJ3 plasmid pKPGJ-3d, complete sequence 41886-41913 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_019063 Escherichia coli plasmid pNDM-HK, complete sequence 32583-32610 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MG516907 Klebsiella aerogenes plasmid pEa1631, complete sequence 81345-81372 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP009857 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-d0d, complete sequence 17538-17565 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042532 Klebsiella aerogenes strain C9 plasmid pC9_002, complete sequence 31722-31749 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP026385 Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence 75282-75309 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP017282 Klebsiella variicola strain GJ1 plasmid pKPGJ-1c, complete sequence 38275-38302 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LT994833 Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence 44799-44826 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP031235 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence 57968-57995 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 KP294350 Uncultured bacterium plasmid pARM26, complete sequence 3901-3928 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP018974 Escherichia coli strain Ecol_545 plasmid pEC545_KPC, complete sequence 44337-44364 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP048418 Citrobacter freundii strain CitB plasmid pB_CitB, complete sequence 3604-3631 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042574 Enterobacter hormaechei strain E5 plasmid pE5_003, complete sequence 30395-30422 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042542 Enterobacter hormaechei strain C4 plasmid pC4_002, complete sequence 31722-31749 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP014298 Klebsiella pneumoniae strain KP38731 plasmid unnamed2, complete sequence 66200-66227 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042580 Enterobacter kobei strain C16 plasmid pC16_002, complete sequence 26001-26028 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP032193 Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence 19195-19222 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP026497 Klebsiella pneumoniae strain 616 plasmid pKp616_2, complete sequence 3605-3632 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP026188 Enterobacteriaceae bacterium ENNIH2 plasmid pKPC-ddab, complete sequence 28987-29014 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP044337 Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence 60372-60399 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP031216 Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence 81034-81061 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP038457 Escherichia coli strain EC-129 plasmid pEC129_4, complete sequence 3602-3629 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_011641 Klebsiella pneumoniae plasmid pCTXM360, complete sequence 34275-34302 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_019344 Serratia marcescens plasmid R830b, complete sequence 10613-10640 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042526 Citrobacter freundii strain E11 plasmid pE11_002, complete sequence 31722-31749 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 197234-197261 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP031322 Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence 26567-26594 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 CP052472 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-4, complete sequence 3602-3629 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_LT985264 Escherichia coli strain 717 plasmid RCS51TR717_p, complete sequence 83072-83099 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC505604 Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence 82053-82080 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 LC508722 Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence 82053-82080 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NC_019889 Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence 69254-69281 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 MT193824 Escherichia coli strain 19-AB01443 plasmid pOX-48-EC1443, complete sequence 35956-35983 7 0.75
NC_019897_3 3.1|3124041|28|NC_019897|CRISPRCasFinder 3124041-3124068 28 NZ_CP042568 Enterobacter hormaechei strain C44 plasmid pC44_002, complete sequence 31722-31749 7 0.75
NC_019897_6 6.23|3276801|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3276801-3276835 35 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 237004-237038 8 0.771
NC_019897_6 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3277141-3277175 35 MK305891 Streptomyces phage Gibson, complete genome 47973-48007 8 0.771
NC_019897_7 7.4|3279363|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3279363-3279398 36 MH779504 Gordonia phage Getalong, complete genome 42126-42161 8 0.778
NC_019897_7 7.4|3279363|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3279363-3279398 36 MK376961 Gordonia phage Asapag, complete genome 39748-39783 8 0.778
NC_019897_13 13.36|3420771|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT 3420771-3420804 34 NZ_CP021119 Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence 95961-95994 8 0.765
NC_019897_6 6.5|3275603|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3275603-3275637 35 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2393954-2393988 9 0.743
NC_019897_7 7.9|3279696|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3279696-3279730 35 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 155947-155981 9 0.743
NC_019897_8 8.3|3281910|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3281910-3281945 36 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 265734-265769 9 0.75
NC_019897_13 13.36|3420771|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT 3420771-3420804 34 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2198829-2198862 9 0.735
NC_019897_6 6.13|3276137|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3276137-3276171 35 CP041517 Bacillus aryabhattai strain KNU10 plasmid unnamed1, complete sequence 102885-102919 10 0.714
NC_019897_6 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3277141-3277175 35 MT498053 Streptomyces phage PHTowN, complete genome 47810-47844 10 0.714
NC_019897_6 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3277141-3277175 35 MT897908 Streptomyces phage ShakeNBake, complete genome 47837-47871 10 0.714
NC_019897_13 13.5|3418666|37|NC_019897|PILER-CR,CRISPRCasFinder,CRT 3418666-3418702 37 NZ_CP010024 Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence 107966-108002 10 0.73
NC_019897_13 13.14|3419279|39|NC_019897|PILER-CR,CRISPRCasFinder,CRT 3419279-3419317 39 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 130004-130042 10 0.744
NC_019897_13 13.18|3419560|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT 3419560-3419593 34 NC_014389 Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence 267624-267657 10 0.706
NC_019897_13 13.35|3420705|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT 3420705-3420738 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1422965-1422998 10 0.706
NC_019897_13 13.38|3420904|35|NC_019897|PILER-CR,CRISPRCasFinder,CRT 3420904-3420938 35 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 40121-40155 11 0.686
NC_019897_13 13.39|3420971|35|NC_019897|PILER-CR,CRISPRCasFinder,CRT 3420971-3421005 35 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 40121-40155 11 0.686
NC_019897_7 7.9|3279696|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR 3279696-3279730 35 MN095772 Stenotrophomonas phage Moby, complete genome 113765-113799 12 0.657

1. spacer 2.1|1029977|27|NC_019897|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 4, identity: 0.852

gcttcgtttcgagtccggtggatgcgt	CRISPR spacer
gcttcgtttcgactgcggtggatgccc	Protospacer
************ * ********** .

2. spacer 7.1|3279161|37|NC_019897|CRISPRCasFinder,CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 4, identity: 0.892

catcagcg-cgccgacaacggcgcccacgtcgacaccg	CRISPR spacer
-ttcagcgccgccgacaacggcacccacgtctacaccg	Protospacer
  ****** *************.******** ******

3. spacer 2.1|1029977|27|NC_019897|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

gcttcgtttcgagtccggtggatgcgt	CRISPR spacer
tcttcgtttcgattcccgtggatgact	Protospacer
 *********** *** *******  *

4. spacer 2.1|1029977|27|NC_019897|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.815

gcttcgtttcgagtccggtggatgcgt	CRISPR spacer
tcttcgtttcgattcccgtggatgact	Protospacer
 *********** *** *******  *

5. spacer 2.1|1029977|27|NC_019897|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

gcttcgtttcgagtccggtggatgcgt	CRISPR spacer
gtctcgtgtcgaatccggtggatgcgg	Protospacer
*..**** ****.************* 

6. spacer 13.40|3421038|34|NC_019897|CRISPRCasFinder matches to NC_010408 (Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence) position: , mismatch: 5, identity: 0.853

accgccga-gacgctcaccgggcgcaagcggacgg	CRISPR spacer
-ccttcgatgacgctcaccaggcgcaagcggccgg	Protospacer
 ** .*** **********.*********** ***

7. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

8. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

9. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

10. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

11. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

12. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

13. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

14. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

15. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

16. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

17. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

18. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

19. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

20. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

21. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

22. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

23. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

24. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

25. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

26. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

27. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

28. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

29. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

30. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

31. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

32. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

33. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

34. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052160 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

35. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

36. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

37. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

38. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

39. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

40. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

41. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

42. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KJ187751 (Klebsiella pneumoniae strain 1301 plasmid pTR1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

43. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

44. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

45. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

46. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

47. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

48. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

49. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

50. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

51. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

52. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

53. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

54. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

55. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

56. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

57. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

58. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

59. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

60. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

61. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN891680 (Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

62. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

63. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

64. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

65. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

66. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

67. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

68. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

69. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

70. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

71. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

72. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

73. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

74. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

75. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

76. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

77. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

78. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

79. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

80. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

81. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

82. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

83. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

84. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

85. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

86. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

87. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

88. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

89. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

90. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

91. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

92. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

93. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

94. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

95. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

96. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

97. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

98. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

99. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

100. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

101. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

102. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

103. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

104. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

105. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

106. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031581 (Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

107. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

108. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

109. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

110. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

111. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

112. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

113. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

114. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

115. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

116. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

117. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

118. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

119. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

120. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

121. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

122. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

123. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

124. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

125. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

126. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

127. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

128. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

129. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

130. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

131. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

132. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

133. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

134. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

135. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

136. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

137. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034132 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_81.9Kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

138. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034679 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

139. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

140. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

141. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

142. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

143. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

144. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

145. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

146. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

147. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026148 (Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

148. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

149. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

150. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

151. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

152. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026139 (Klebsiella pneumoniae strain F77 plasmid pF77_3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

153. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

154. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034140 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

155. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

156. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

157. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

158. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

159. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

160. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

161. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

162. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

163. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

164. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

165. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

166. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

167. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

168. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

169. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

170. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

171. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

172. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

173. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

174. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

175. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

176. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

177. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

178. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

179. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

180. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

181. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

182. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

183. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052437 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

184. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

185. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

186. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

187. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

188. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

189. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052353 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

190. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

191. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

192. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

193. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

194. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

195. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP045692 (Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

196. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

197. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

198. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

199. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

200. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

201. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

202. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

203. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

204. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

205. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

206. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

207. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026717 (Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

208. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

209. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

210. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

211. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

212. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

213. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052469 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

214. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

215. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

216. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

217. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

218. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

219. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

220. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

221. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

222. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

223. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

224. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

225. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

226. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

227. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

228. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

229. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

230. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

231. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK248692 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

232. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

233. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

234. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

235. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

236. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

237. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

238. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

239. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

240. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

241. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

242. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

243. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

244. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

245. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

246. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

247. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

248. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP033774 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

249. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

250. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 6, identity: 0.786

cccgcgctacagcagcatgcgaagcctc	CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc	Protospacer
******* *************   *. *

251. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP015071 (Escherichia coli strain Ecol_743 plasmid pEC743_OXA48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

252. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM406488 (Salmonella enterica subsp. enterica serovar Paratyphi B strain R69 plasmid R69, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

253. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP975075 (Citrobacter freundii strain MRSN12115 plasmid pMRVIM1012, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

254. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018443 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

255. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP034202 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L_2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

256. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP029447 (Serratia marcescens strain CAV1761 plasmid pCAV1761-73, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

257. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018717 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

258. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018723 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

259. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018706 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

260. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018694 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

261. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031566 (Enterobacter hormaechei strain 2013_1a plasmid pIncLM-1301491, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

262. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_025134 (Klebsiella pneumoniae plasmid pFOX-7a, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

263. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP019841 (Enterobacter roggenkampii strain R11 plasmid pASM2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

264. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP010365 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-70.092kb, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

265. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018669 (Klebsiella pneumoniae strain CAV1042 plasmid pKPC_CAV1042-89, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

266. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP016927 (Klebsiella pneumoniae isolate 23 plasmid pIncL_M_DHQP1400954, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

267. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018315 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

268. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP027148 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed5) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

269. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP015075 (Escherichia coli strain Ecol_745 plasmid pEC745_OXA48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

270. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018690 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

271. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031374 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvOXA-48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

272. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MN187903 (Citrobacter freundii strain Cf164 plasmid pCf164_CTX-M-8, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

273. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP032170 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

274. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018342 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-5, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

275. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to CP020502 (Serratia marcescens strain BWH-23 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

276. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP033880 (Escherichia coli strain 50579417 plasmid p50579417_3_OXA-48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

277. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP029720 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

278. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018712 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

279. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP021742 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000002jNODE_23, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

280. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KY215945 (Klebsiella pneumoniae subsp. pneumoniae strain Kp1210 plasmid pOXA-519, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

281. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KY200950 (Klebsiella pneumoniae subsp. pneumoniae strain Kp1219 plasmid pOXA-517, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

282. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KY781949 (Klebsiella pneumoniae isolate Kp41 plasmid pKp41M, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

283. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KY213890 (Klebsiella pneumoniae strain 38_wz plasmid pOXA48_wz, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

284. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT838202 (Escherichia coli isolate WI2 isolate plasmid pWI2-OXA48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

285. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LN864821 (Raoultella planticola plasmid pRA35, complete sequence, strain RA35) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

286. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP014072 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed1) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

287. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP050846 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-1, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

288. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX524525 (Klebsiella pneumoniae strain RAY plasmid pRAY, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

289. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX523901 (Klebsiella pneumoniae strain Kpn-30715/15 plasmid pOXA-48_30715, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

290. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX523900 (Klebsiella pneumoniae strain Kpn-04963/15 plasmid pOXA-48_4963, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

291. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX523902 (Klebsiella pneumoniae strain Kpn-30891/15 plasmid pOXA-48_30891, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

292. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX636096 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

293. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KT935445 (Klebsiella pneumoniae strain Kp6411 plasmid 6411TF, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

294. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM406491 (Klebsiella pneumoniae strain Kpn-E1.Nr7 plasmid pKpn-E1.Nr7, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

295. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP659188 (Klebsiella pneumoniae strain 153877-1 plasmid pOXA-48E1, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

296. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP025948 (Proteus mirabilis strain Pm-Oxa48 plasmid pOXA48-Pm, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

297. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP061858 (Enterobacter cloacae strain INSRA17313-1 plasmid pUR17313-1, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

298. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP034041 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

299. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011599 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-83, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

300. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP044032 (Klebsiella pneumoniae strain FDAARGOS_631 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

301. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP048353 (Raoultella ornithinolytica strain 23 plasmid p23_D-OXA48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

302. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP034283 (Klebsiella pneumoniae strain I72 plasmid p72_LM_OXA48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

303. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP037737 (Citrobacter freundii strain CAV1857 plasmid pKPC_CAV1857-85, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

304. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP023419 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

305. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK249855 (Enterobacter cloacae strain 105 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

306. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK249856 (Klebsiella pneumoniae strain 91 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

307. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK249858 (Escherichia coli strain 46 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

308. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_021488 (Klebsiella pneumoniae plasmid pKPoxa-48N1, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

309. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

310. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP027039 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncLM, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

311. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP020530 (Enterobacter cloacae strain 174 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

312. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP020844 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

313. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP020844 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

314. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019154 (Klebsiella pneumoniae plasmid pOXA-48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

315. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP041085 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

316. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP023251 (Klebsiella pneumoniae strain CCUG 70742 plasmid pKpn70742_2) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

317. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK966141 (Enterobacter cloacae strain GHZ8R11B plasmid pHNGDR11, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

318. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK966142 (Klebsiella pneumoniae strain GHP8R3B plasmid pHNGDR03, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

319. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP029138 (Klebsiella pneumoniae strain AR376 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

320. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031805 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

321. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP040036 (Klebsiella pneumoniae strain KPC160117 plasmid pOXA48-L117, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

322. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP022153 (Citrobacter freundii strain 705SK3 plasmid p705SK3_2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

323. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP029599 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-77, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

324. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP022150 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

325. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LR025105 (Escherichia coli isolate EC-1639 plasmid pOXA-48_1639, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

326. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP022826 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

327. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_AP019667 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63632, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

328. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011614 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-92, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

329. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017932 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-76, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

330. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MN792918 (Klebsiella aerogenes strain ST143 plasmid pLAU_KAM9_OXA48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

331. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017936 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-76, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

332. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP040031 (Klebsiella pneumoniae strain KPC160121 plasmid pOXA48-L121, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

333. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018461 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

334. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011640 (Serratia marcescens strain CAV1492 plasmid pCAV1492-73, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

335. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP032174 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

336. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LR025095 (Klebsiella pneumoniae isolate KP9201 plasmid pOXA-48_920, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

337. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP045017 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

338. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP053283 (Escherichia coli strain SCU-308 plasmid pSCU-308-2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

339. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC545849 (Escherichia coli Ec-MW04 plasmid pEc-MW04_OXA DNA, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

340. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC545850 (Klebsiella variicola Kv-MW05 plasmid pKv-MW05_OXA DNA, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

341. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011632 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-84, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

342. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP014698 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

343. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011593 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-69, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

344. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011656 (Citrobacter freundii strain CAV1741 plasmid pKPC_CAV1741, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

345. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to KU159085 (Klebsiella pneumoniae plasmid pOXAAPSS1, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

346. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011609 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-71, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

347. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_023027 (Klebsiella pneumoniae strain E71T plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

348. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LN864819 (Klebsiella pneumoniae plasmid pKP112, complete sequence, strain KP112) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

349. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LN864820 (Citrobacter freundii plasmid pCF29, complete sequence, strain CF29) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

350. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LR025091 (Klebsiella pneumoniae isolate KP980 plasmid pOXA-48_980, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

351. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019346 (Enterobacter cloacae plasmid pNE1280, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

352. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018700 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-3, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

353. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LR745044 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pOXA48_Kpn154) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

354. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_021078 (Klebsiella pneumoniae strain Kp002 plasmid pJEG011, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

355. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP027699 (Klebsiella pneumoniae strain KP30835 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

356. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT985279 (Escherichia coli strain 676 plasmid RCS60_p, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

357. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_MK088079 (Klebsiella pneumoniae strain 19 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

358. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_MK370728 (Klebsiella pneumoniae strain 69G1 plasmid pLimOXA-48, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

359. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_MF156266 (Escherichia coli strain 24-S11 plasmid pCESC2, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

360. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP030135 (Klebsiella pneumoniae strain 160111 plasmid pOXA48_L111, complete sequence) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

361. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018736 (Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-2) position: , mismatch: 6, identity: 0.786

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
ggaggcaaagaaaaacggctggcacagc	Protospacer
* ***** *************** *.  

362. spacer 13.40|3421038|34|NC_019897|CRISPRCasFinder matches to NZ_CP042827 (Ruania sp. HY168 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

accgccgagacgctcaccgggcgcaa-gcggacgg	CRISPR spacer
atcgcagagaagctcaccgggcgcaacgccgatg-	Protospacer
*.*** **** *************** ** **.* 

363. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX783441 (Klebsiella pneumoniae strain KP4368 plasmid pKP4368, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

364. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM406490 (Salmonella enterica subsp. enterica serovar Typhimurium strain 202 plasmid pSEM, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

365. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM406489 (Serratia marcescens strain R471 plasmid R471, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

366. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to CP048042 (Serratia liquefaciens strain JL02 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

367. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP035217 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-C, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

368. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556214 (Escherichia coli CEX24 plasmid pCEX24 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

369. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556215 (Escherichia coli CEX25 plasmid pCEX25 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

370. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556216 (Escherichia coli CEX14 plasmid pCEX14 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

371. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556217 (Escherichia coli CEX3 plasmid pCEX3 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

372. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556218 (Enterobacter cloacae CEX5 plasmid pCEX5 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

373. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556219 (Enterobacter cloacae CEX6 plasmid pCEX6 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

374. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556220 (Enterobacter cloacae CEX4 plasmid pCEX4 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

375. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556221 (Klebsiella pneumoniae CEX18 plasmid pCEX18 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

376. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556222 (Klebsiella pneumoniae CEX23 plasmid pCEX23 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

377. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_024997 (Klebsiella oxytoca plasmid pACM1, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

378. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

379. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT985387 (Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

380. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP007733 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-068, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

381. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017853 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2d, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

382. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP009852 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-e56, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

383. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026395 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-edb7, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

384. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026142 (Klebsiella pneumoniae strain F127 plasmid pF127_2, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

385. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC536683 (Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

386. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026210 (Citrobacter sp. CFNIH10 plasmid pKPC-2fe2, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

387. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to KU159086 (Klebsiella pneumoniae plasmid pOXAAPSS2, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

388. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042490 (Enterobacter hormaechei strain C15 plasmid pC15_002) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

389. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT985241 (Escherichia coli strain 721 plasmid RCS40_p, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

390. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX009507 (Escherichia coli strain 06K2206 plasmid LM6771, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

391. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019368 (Enterobacter cloacae plasmid pEl1573, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

392. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM877517 (Enterobacter cloacae strain CRE623 plasmid pIMP-HB623, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

393. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP294351 (Escherichia coli strain CZD1527 plasmid pIGT15, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

394. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KU315015 (Serratia marcescens strain NCTC 50331 plasmid R1215, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

395. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to AP018454 (Klebsiella pneumoniae plasmid pMRY13-133KPN_2 DNA, complete genome, strain: MRY13-133) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

396. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to AP018455 (Klebsiella aerogenes plasmid pMRY13-134EAE_1 DNA, complete genome, strain: MRY13-134) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

397. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_004464 (Citrobacter freundii plasmid pCTX-M3, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

398. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042501 (Enterobacter sp. E76 plasmid pE76_002, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

399. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP048339 (Escherichia coli strain 142 plasmid p142_B, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

400. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042509 (Leclercia adecarboxylata strain E1 plasmid pE1_004, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

401. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026194 (Enterobacteriaceae bacterium ENNIH1 plasmid pKPC-825d, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

402. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT994838 (Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

403. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP024878 (Klebsiella pneumoniae strain NH25 plasmid pNH25.4, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

404. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_005246 (Erwinia amylovora LebB66 plasmid pEL60, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

405. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042514 (Serratia marcescens strain E28 plasmid pE28_002, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

406. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC508263 (Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

407. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017288 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3d, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

408. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019063 (Escherichia coli plasmid pNDM-HK, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

409. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MG516907 (Klebsiella aerogenes plasmid pEa1631, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

410. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP009857 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-d0d, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

411. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042532 (Klebsiella aerogenes strain C9 plasmid pC9_002, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

412. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026385 (Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

413. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017282 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1c, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

414. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT994833 (Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

415. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031235 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

416. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to KP294350 (Uncultured bacterium plasmid pARM26, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

417. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018974 (Escherichia coli strain Ecol_545 plasmid pEC545_KPC, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

418. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP048418 (Citrobacter freundii strain CitB plasmid pB_CitB, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

419. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042574 (Enterobacter hormaechei strain E5 plasmid pE5_003, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

420. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042542 (Enterobacter hormaechei strain C4 plasmid pC4_002, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

421. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP014298 (Klebsiella pneumoniae strain KP38731 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

422. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042580 (Enterobacter kobei strain C16 plasmid pC16_002, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

423. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP032193 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

424. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026497 (Klebsiella pneumoniae strain 616 plasmid pKp616_2, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

425. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026188 (Enterobacteriaceae bacterium ENNIH2 plasmid pKPC-ddab, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

426. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

427. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031216 (Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

428. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP038457 (Escherichia coli strain EC-129 plasmid pEC129_4, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

429. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_011641 (Klebsiella pneumoniae plasmid pCTXM360, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

430. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019344 (Serratia marcescens plasmid R830b, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

431. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042526 (Citrobacter freundii strain E11 plasmid pE11_002, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

432. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

433. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031322 (Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

434. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to CP052472 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-4, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

435. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT985264 (Escherichia coli strain 717 plasmid RCS51TR717_p, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

436. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC505604 (Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

437. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC508722 (Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

438. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019889 (Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

439. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MT193824 (Escherichia coli strain 19-AB01443 plasmid pOX-48-EC1443, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

440. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042568 (Enterobacter hormaechei strain C44 plasmid pC44_002, complete sequence) position: , mismatch: 7, identity: 0.75

gcaggcatagaaaaacggctggcccgca	CRISPR spacer
tgaggcaaagaaaaacggctggcacagc	Protospacer
  ***** *************** *.  

441. spacer 6.23|3276801|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.771

---aatggtcacagcgtccccccgcgcctccgtcgctc	CRISPR spacer
ccgcacgg---cagcgtccccgcgcgcctccatcgctt	Protospacer
    *.**   ********** *********.*****.

442. spacer 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MK305891 (Streptomyces phage Gibson, complete genome) position: , mismatch: 8, identity: 0.771

cgagcagagcgcggcggccgagaagac--attccagc	CRISPR spacer
cgagaagcgcgcggcggccgagaaggcggaggccg--	Protospacer
**** ** *****************.*  *  **.  

443. spacer 7.4|3279363|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MH779504 (Gordonia phage Getalong, complete genome) position: , mismatch: 8, identity: 0.778

acccgtgcgcaggcagcggttccaccttgagggcgg	CRISPR spacer
acccgttcgcaggcagcggctccaccctcgtcgccg	Protospacer
****** ************.******.* .  ** *

444. spacer 7.4|3279363|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MK376961 (Gordonia phage Asapag, complete genome) position: , mismatch: 8, identity: 0.778

acccgtgcgcaggcagcggttccaccttgagggcgg	CRISPR spacer
acccgttcgcaggcagcggctccaccctcgtcgccg	Protospacer
****** ************.******.* .  ** *

445. spacer 13.36|3420771|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

cagcgcggcgagatcagcgaagggcagtaccggg	CRISPR spacer
ctgcggcagcagatcagcgaagggcggtacaggg	Protospacer
* ***  .  ***************.**** ***

446. spacer 6.5|3275603|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.743

acggtcggcgcgatcacttcggcattcgctgacgt	CRISPR spacer
ttggtcggcgagatcacttcggcaatctcgcagtt	Protospacer
 .******** ************* ** *  *  *

447. spacer 7.9|3279696|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743

acgcgattcttccagcgcgacagcacgaaggccaa	CRISPR spacer
ctcagatccttcgagcgcgacagcacgaagcgaaa	Protospacer
 .  ***.**** *****************   **

448. spacer 8.3|3281910|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.75

acggcggcttcggtgccggattctgcggcgtatcct	CRISPR spacer
gtggcggcttcggtgcctgcttctgcggcgggcgcg	Protospacer
..*************** * ********** .. * 

449. spacer 13.36|3420771|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735

cagcgcggcgagatcagcgaagggcagtaccggg	CRISPR spacer
aagaagggcgcgatcagcgaagagcagtacaagc	Protospacer
 ** . **** ***********.******* .* 

450. spacer 6.13|3276137|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to CP041517 (Bacillus aryabhattai strain KNU10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

gtagcttccagcgaattttgcttttcttgatttga	CRISPR spacer
tcctcaaccaacgaattttggttttcttgatttat	Protospacer
 .  *  ***.********* ************. 

451. spacer 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MT498053 (Streptomyces phage PHTowN, complete genome) position: , mismatch: 10, identity: 0.714

cgagcagagcgcggcggccgagaagacattccagc	CRISPR spacer
cgagaagcgcgcggcggccgagaaggcggaggcgg	Protospacer
**** ** *****************.*.     * 

452. spacer 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MT897908 (Streptomyces phage ShakeNBake, complete genome) position: , mismatch: 10, identity: 0.714

cgagcagagcgcggcggccgagaagacattccagc	CRISPR spacer
cgagaagcgcgcggcggccgagaaggcggaggcgg	Protospacer
**** ** *****************.*.     * 

453. spacer 13.5|3418666|37|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010024 (Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence) position: , mismatch: 10, identity: 0.73

atctcccgcagccgttgcgtccatgccgccgacacgt	CRISPR spacer
accctatgcaggcgttgcgtccatgccgtcgacatcc	Protospacer
*.*.. .**** ****************.*****. .

454. spacer 13.14|3419279|39|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 10, identity: 0.744

atcttattcgcacgctaccccgtcgccatctcgatccaa	CRISPR spacer
gccagcctcgcacgcaacgccgtcgccatctcgatcgag	Protospacer
..*   .******** ** ***************** *.

455. spacer 13.18|3419560|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 10, identity: 0.706

ctccttctgcatttcaagtttgatatcacttaaa	CRISPR spacer
ttccttctgctttgcaagtttgatagtaggaatg	Protospacer
.********* ** *********** .*   * .

456. spacer 13.35|3420705|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706

gcgcgggatttcgaacggctcgacgacgtgaatg	CRISPR spacer
acctgggagttcgaaccgctcgacgacgaggtgt	Protospacer
.* .**** ******* *********** *.   

457. spacer 13.38|3420904|35|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 11, identity: 0.686

tcattaacgcccgttgttcttcctgcaggcgcttg	CRISPR spacer
gggccatgcgccgctgttcttcctgctggcgcttg	Protospacer
  ...*    ***.************ ********

458. spacer 13.39|3420971|35|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 11, identity: 0.686

tcattaacgcccgttgttcttcctgcaggcgcttg	CRISPR spacer
gggccatgcgccgctgttcttcctgctggcgcttg	Protospacer
  ...*    ***.************ ********

459. spacer 7.9|3279696|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MN095772 (Stenotrophomonas phage Moby, complete genome) position: , mismatch: 12, identity: 0.657

acgcgattcttccagcgcgacagcacgaaggccaa	CRISPR spacer
ttcaacttcttcgagcgcgacagcccgaaggagtc	Protospacer
 .  . ****** *********** ******    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 77202 : 90253 13 Bacillus_phage(100.0%) transposase,integrase attL 78510:78523|attR 94231:94244
DBSCAN-SWA_2 652049 : 720638 57 Synechococcus_phage(16.67%) protease,transposase NA
DBSCAN-SWA_3 1813594 : 1821105 8 Clostridioides_phage(16.67%) NA NA
DBSCAN-SWA_4 1967297 : 2012517 42 Bacillus_phage(18.75%) protease,transposase NA
DBSCAN-SWA_5 2640079 : 2710695 57 Klosneuvirus(18.18%) protease,transposase,tRNA NA
DBSCAN-SWA_6 3234444 : 3243347 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_7 3256257 : 3281678 12 Wolbachia_phage(100.0%) transposase NA
DBSCAN-SWA_8 3489136 : 3500201 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_9 3620485 : 3686485 60 Bacillus_phage(23.08%) protease,transposase NA
DBSCAN-SWA_10 3961516 : 4025193 57 Streptococcus_phage(23.08%) protease,transposase,tRNA,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage