1. spacer 2.1|1029977|27|NC_019897|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 4, identity: 0.852
gcttcgtttcgagtccggtggatgcgt CRISPR spacer
gcttcgtttcgactgcggtggatgccc Protospacer
************ * ********** .
2. spacer 7.1|3279161|37|NC_019897|CRISPRCasFinder,CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 4, identity: 0.892
catcagcg-cgccgacaacggcgcccacgtcgacaccg CRISPR spacer
-ttcagcgccgccgacaacggcacccacgtctacaccg Protospacer
****** *************.******** ******
3. spacer 2.1|1029977|27|NC_019897|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815
gcttcgtttcgagtccggtggatgcgt CRISPR spacer
tcttcgtttcgattcccgtggatgact Protospacer
*********** *** ******* *
4. spacer 2.1|1029977|27|NC_019897|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.815
gcttcgtttcgagtccggtggatgcgt CRISPR spacer
tcttcgtttcgattcccgtggatgact Protospacer
*********** *** ******* *
5. spacer 2.1|1029977|27|NC_019897|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
gcttcgtttcgagtccggtggatgcgt CRISPR spacer
gtctcgtgtcgaatccggtggatgcgg Protospacer
*..**** ****.*************
6. spacer 13.40|3421038|34|NC_019897|CRISPRCasFinder matches to NC_010408 (Clavibacter michiganensis subsp. sepedonicus plasmid pCSL1, complete sequence) position: , mismatch: 5, identity: 0.853
accgccga-gacgctcaccgggcgcaagcggacgg CRISPR spacer
-ccttcgatgacgctcaccaggcgcaagcggccgg Protospacer
** .*** **********.*********** ***
7. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
8. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
9. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
10. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
11. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
12. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
13. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
14. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
15. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
16. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
17. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
18. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
19. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
20. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
21. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
22. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
23. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
24. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
25. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
26. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
27. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
28. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
29. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
30. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
31. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
32. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
33. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
34. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052160 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
35. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
36. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
37. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
38. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
39. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
40. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
41. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
42. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_KJ187751 (Klebsiella pneumoniae strain 1301 plasmid pTR1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
43. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
44. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
45. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
46. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
47. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
48. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
49. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
50. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
51. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
52. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
53. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
54. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
55. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
56. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
57. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
58. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
59. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
60. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
61. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN891680 (Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
62. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
63. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
64. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
65. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
66. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
67. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
68. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
69. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
70. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
71. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
72. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
73. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
74. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
75. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
76. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
77. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
78. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
79. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
80. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
81. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
82. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
83. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
84. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
85. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
86. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
87. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
88. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
89. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
90. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
91. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
92. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
93. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
94. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
95. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
96. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
97. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
98. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
99. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
100. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
101. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
102. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
103. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
104. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
105. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
106. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031581 (Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
107. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
108. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
109. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
110. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
111. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
112. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
113. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
114. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
115. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
116. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
117. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
118. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
119. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
120. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
121. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
122. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
123. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
124. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
125. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
126. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
127. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
128. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
129. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
130. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
131. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
132. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
133. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
134. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
135. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
136. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
137. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034132 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_81.9Kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
138. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034679 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
139. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
140. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
141. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
142. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
143. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
144. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
145. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
146. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
147. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026148 (Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
148. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
149. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
150. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
151. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
152. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026139 (Klebsiella pneumoniae strain F77 plasmid pF77_3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
153. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
154. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034140 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
155. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
156. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
157. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
158. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
159. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
160. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
161. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
162. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
163. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
164. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
165. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
166. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
167. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
168. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
169. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
170. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
171. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
172. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
173. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
174. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
175. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
176. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
177. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
178. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
179. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
180. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
181. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
182. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
183. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052437 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
184. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
185. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
186. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
187. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
188. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
189. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052353 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
190. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
191. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
192. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
193. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
194. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
195. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP045692 (Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
196. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
197. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
198. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
199. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
200. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
201. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
202. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
203. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
204. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
205. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
206. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
207. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026717 (Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
208. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
209. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
210. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
211. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
212. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
213. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052469 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
214. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
215. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
216. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
217. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
218. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
219. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
220. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
221. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
222. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
223. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
224. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
225. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
226. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
227. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
228. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
229. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
230. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
231. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK248692 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
232. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
233. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
234. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
235. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
236. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
237. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
238. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
239. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
240. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
241. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
242. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
243. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
244. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
245. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
246. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
247. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
248. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP033774 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
249. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
250. spacer 1.1|385727|28|NC_019897|CRISPRCasFinder matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 6, identity: 0.786
cccgcgctacagcagcatgcgaagcctc CRISPR spacer
cccgcgcgacagcagcatgcgctcctgc Protospacer
******* ************* *. *
251. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP015071 (Escherichia coli strain Ecol_743 plasmid pEC743_OXA48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
252. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM406488 (Salmonella enterica subsp. enterica serovar Paratyphi B strain R69 plasmid R69, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
253. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP975075 (Citrobacter freundii strain MRSN12115 plasmid pMRVIM1012, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
254. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018443 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
255. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP034202 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L_2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
256. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP029447 (Serratia marcescens strain CAV1761 plasmid pCAV1761-73, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
257. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018717 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
258. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018723 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
259. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018706 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
260. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018694 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
261. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031566 (Enterobacter hormaechei strain 2013_1a plasmid pIncLM-1301491, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
262. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_025134 (Klebsiella pneumoniae plasmid pFOX-7a, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
263. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP019841 (Enterobacter roggenkampii strain R11 plasmid pASM2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
264. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP010365 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-70.092kb, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
265. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018669 (Klebsiella pneumoniae strain CAV1042 plasmid pKPC_CAV1042-89, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
266. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP016927 (Klebsiella pneumoniae isolate 23 plasmid pIncL_M_DHQP1400954, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
267. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018315 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
268. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP027148 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed5) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
269. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP015075 (Escherichia coli strain Ecol_745 plasmid pEC745_OXA48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
270. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018690 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
271. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031374 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvOXA-48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
272. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MN187903 (Citrobacter freundii strain Cf164 plasmid pCf164_CTX-M-8, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
273. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP032170 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
274. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018342 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-5, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
275. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to CP020502 (Serratia marcescens strain BWH-23 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
276. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP033880 (Escherichia coli strain 50579417 plasmid p50579417_3_OXA-48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
277. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP029720 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
278. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018712 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
279. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP021742 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000002jNODE_23, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
280. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KY215945 (Klebsiella pneumoniae subsp. pneumoniae strain Kp1210 plasmid pOXA-519, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
281. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KY200950 (Klebsiella pneumoniae subsp. pneumoniae strain Kp1219 plasmid pOXA-517, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
282. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KY781949 (Klebsiella pneumoniae isolate Kp41 plasmid pKp41M, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
283. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KY213890 (Klebsiella pneumoniae strain 38_wz plasmid pOXA48_wz, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
284. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT838202 (Escherichia coli isolate WI2 isolate plasmid pWI2-OXA48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
285. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LN864821 (Raoultella planticola plasmid pRA35, complete sequence, strain RA35) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
286. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP014072 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed1) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
287. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP050846 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-1, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
288. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX524525 (Klebsiella pneumoniae strain RAY plasmid pRAY, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
289. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX523901 (Klebsiella pneumoniae strain Kpn-30715/15 plasmid pOXA-48_30715, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
290. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX523900 (Klebsiella pneumoniae strain Kpn-04963/15 plasmid pOXA-48_4963, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
291. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX523902 (Klebsiella pneumoniae strain Kpn-30891/15 plasmid pOXA-48_30891, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
292. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX636096 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
293. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KT935445 (Klebsiella pneumoniae strain Kp6411 plasmid 6411TF, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
294. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM406491 (Klebsiella pneumoniae strain Kpn-E1.Nr7 plasmid pKpn-E1.Nr7, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
295. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP659188 (Klebsiella pneumoniae strain 153877-1 plasmid pOXA-48E1, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
296. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP025948 (Proteus mirabilis strain Pm-Oxa48 plasmid pOXA48-Pm, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
297. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP061858 (Enterobacter cloacae strain INSRA17313-1 plasmid pUR17313-1, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
298. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP034041 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
299. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011599 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-83, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
300. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP044032 (Klebsiella pneumoniae strain FDAARGOS_631 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
301. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP048353 (Raoultella ornithinolytica strain 23 plasmid p23_D-OXA48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
302. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP034283 (Klebsiella pneumoniae strain I72 plasmid p72_LM_OXA48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
303. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP037737 (Citrobacter freundii strain CAV1857 plasmid pKPC_CAV1857-85, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
304. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP023419 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
305. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK249855 (Enterobacter cloacae strain 105 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
306. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK249856 (Klebsiella pneumoniae strain 91 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
307. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK249858 (Escherichia coli strain 46 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
308. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_021488 (Klebsiella pneumoniae plasmid pKPoxa-48N1, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
309. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
310. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP027039 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncLM, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
311. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP020530 (Enterobacter cloacae strain 174 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
312. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP020844 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
313. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP020844 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
314. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019154 (Klebsiella pneumoniae plasmid pOXA-48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
315. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP041085 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
316. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP023251 (Klebsiella pneumoniae strain CCUG 70742 plasmid pKpn70742_2) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
317. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK966141 (Enterobacter cloacae strain GHZ8R11B plasmid pHNGDR11, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
318. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MK966142 (Klebsiella pneumoniae strain GHP8R3B plasmid pHNGDR03, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
319. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP029138 (Klebsiella pneumoniae strain AR376 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
320. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031805 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
321. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP040036 (Klebsiella pneumoniae strain KPC160117 plasmid pOXA48-L117, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
322. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP022153 (Citrobacter freundii strain 705SK3 plasmid p705SK3_2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
323. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP029599 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-77, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
324. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP022150 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
325. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LR025105 (Escherichia coli isolate EC-1639 plasmid pOXA-48_1639, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
326. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP022826 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
327. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_AP019667 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63632, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
328. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011614 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-92, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
329. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017932 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-76, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
330. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MN792918 (Klebsiella aerogenes strain ST143 plasmid pLAU_KAM9_OXA48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
331. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017936 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-76, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
332. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP040031 (Klebsiella pneumoniae strain KPC160121 plasmid pOXA48-L121, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
333. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018461 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
334. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011640 (Serratia marcescens strain CAV1492 plasmid pCAV1492-73, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
335. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP032174 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
336. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LR025095 (Klebsiella pneumoniae isolate KP9201 plasmid pOXA-48_920, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
337. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP045017 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
338. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP053283 (Escherichia coli strain SCU-308 plasmid pSCU-308-2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
339. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC545849 (Escherichia coli Ec-MW04 plasmid pEc-MW04_OXA DNA, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
340. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC545850 (Klebsiella variicola Kv-MW05 plasmid pKv-MW05_OXA DNA, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
341. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011632 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-84, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
342. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP014698 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
343. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011593 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-69, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
344. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011656 (Citrobacter freundii strain CAV1741 plasmid pKPC_CAV1741, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
345. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to KU159085 (Klebsiella pneumoniae plasmid pOXAAPSS1, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
346. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP011609 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-71, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
347. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_023027 (Klebsiella pneumoniae strain E71T plasmid, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
348. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LN864819 (Klebsiella pneumoniae plasmid pKP112, complete sequence, strain KP112) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
349. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LN864820 (Citrobacter freundii plasmid pCF29, complete sequence, strain CF29) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
350. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LR025091 (Klebsiella pneumoniae isolate KP980 plasmid pOXA-48_980, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
351. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019346 (Enterobacter cloacae plasmid pNE1280, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
352. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018700 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-3, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
353. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LR745044 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pOXA48_Kpn154) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
354. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_021078 (Klebsiella pneumoniae strain Kp002 plasmid pJEG011, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
355. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP027699 (Klebsiella pneumoniae strain KP30835 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
356. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT985279 (Escherichia coli strain 676 plasmid RCS60_p, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
357. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_MK088079 (Klebsiella pneumoniae strain 19 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
358. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_MK370728 (Klebsiella pneumoniae strain 69G1 plasmid pLimOXA-48, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
359. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_MF156266 (Escherichia coli strain 24-S11 plasmid pCESC2, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
360. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP030135 (Klebsiella pneumoniae strain 160111 plasmid pOXA48_L111, complete sequence) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
361. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018736 (Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-2) position: , mismatch: 6, identity: 0.786
gcaggcatagaaaaacggctggcccgca CRISPR spacer
ggaggcaaagaaaaacggctggcacagc Protospacer
* ***** *************** *.
362. spacer 13.40|3421038|34|NC_019897|CRISPRCasFinder matches to NZ_CP042827 (Ruania sp. HY168 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824
accgccgagacgctcaccgggcgcaa-gcggacgg CRISPR spacer
atcgcagagaagctcaccgggcgcaacgccgatg- Protospacer
*.*** **** *************** ** **.*
363. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX783441 (Klebsiella pneumoniae strain KP4368 plasmid pKP4368, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
364. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM406490 (Salmonella enterica subsp. enterica serovar Typhimurium strain 202 plasmid pSEM, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
365. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM406489 (Serratia marcescens strain R471 plasmid R471, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
366. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to CP048042 (Serratia liquefaciens strain JL02 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
367. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP035217 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-C, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
368. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556214 (Escherichia coli CEX24 plasmid pCEX24 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
369. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556215 (Escherichia coli CEX25 plasmid pCEX25 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
370. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556216 (Escherichia coli CEX14 plasmid pCEX14 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
371. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556217 (Escherichia coli CEX3 plasmid pCEX3 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
372. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556218 (Enterobacter cloacae CEX5 plasmid pCEX5 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
373. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556219 (Enterobacter cloacae CEX6 plasmid pCEX6 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
374. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556220 (Enterobacter cloacae CEX4 plasmid pCEX4 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
375. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556221 (Klebsiella pneumoniae CEX18 plasmid pCEX18 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
376. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC556222 (Klebsiella pneumoniae CEX23 plasmid pCEX23 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
377. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_024997 (Klebsiella oxytoca plasmid pACM1, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
378. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
379. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT985387 (Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
380. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP007733 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-068, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
381. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017853 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2d, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
382. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP009852 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-e56, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
383. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026395 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-edb7, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
384. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026142 (Klebsiella pneumoniae strain F127 plasmid pF127_2, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
385. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC536683 (Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
386. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026210 (Citrobacter sp. CFNIH10 plasmid pKPC-2fe2, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
387. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to KU159086 (Klebsiella pneumoniae plasmid pOXAAPSS2, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
388. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042490 (Enterobacter hormaechei strain C15 plasmid pC15_002) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
389. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT985241 (Escherichia coli strain 721 plasmid RCS40_p, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
390. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KX009507 (Escherichia coli strain 06K2206 plasmid LM6771, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
391. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019368 (Enterobacter cloacae plasmid pEl1573, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
392. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KM877517 (Enterobacter cloacae strain CRE623 plasmid pIMP-HB623, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
393. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KP294351 (Escherichia coli strain CZD1527 plasmid pIGT15, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
394. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_KU315015 (Serratia marcescens strain NCTC 50331 plasmid R1215, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
395. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to AP018454 (Klebsiella pneumoniae plasmid pMRY13-133KPN_2 DNA, complete genome, strain: MRY13-133) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
396. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to AP018455 (Klebsiella aerogenes plasmid pMRY13-134EAE_1 DNA, complete genome, strain: MRY13-134) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
397. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_004464 (Citrobacter freundii plasmid pCTX-M3, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
398. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042501 (Enterobacter sp. E76 plasmid pE76_002, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
399. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP048339 (Escherichia coli strain 142 plasmid p142_B, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
400. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042509 (Leclercia adecarboxylata strain E1 plasmid pE1_004, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
401. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026194 (Enterobacteriaceae bacterium ENNIH1 plasmid pKPC-825d, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
402. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT994838 (Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
403. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP024878 (Klebsiella pneumoniae strain NH25 plasmid pNH25.4, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
404. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_005246 (Erwinia amylovora LebB66 plasmid pEL60, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
405. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042514 (Serratia marcescens strain E28 plasmid pE28_002, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
406. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC508263 (Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
407. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017288 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3d, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
408. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019063 (Escherichia coli plasmid pNDM-HK, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
409. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MG516907 (Klebsiella aerogenes plasmid pEa1631, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
410. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP009857 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-d0d, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
411. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042532 (Klebsiella aerogenes strain C9 plasmid pC9_002, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
412. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026385 (Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
413. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP017282 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1c, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
414. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT994833 (Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
415. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031235 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
416. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to KP294350 (Uncultured bacterium plasmid pARM26, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
417. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP018974 (Escherichia coli strain Ecol_545 plasmid pEC545_KPC, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
418. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP048418 (Citrobacter freundii strain CitB plasmid pB_CitB, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
419. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042574 (Enterobacter hormaechei strain E5 plasmid pE5_003, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
420. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042542 (Enterobacter hormaechei strain C4 plasmid pC4_002, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
421. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP014298 (Klebsiella pneumoniae strain KP38731 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
422. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042580 (Enterobacter kobei strain C16 plasmid pC16_002, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
423. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP032193 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
424. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026497 (Klebsiella pneumoniae strain 616 plasmid pKp616_2, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
425. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP026188 (Enterobacteriaceae bacterium ENNIH2 plasmid pKPC-ddab, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
426. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
427. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031216 (Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
428. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP038457 (Escherichia coli strain EC-129 plasmid pEC129_4, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
429. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_011641 (Klebsiella pneumoniae plasmid pCTXM360, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
430. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019344 (Serratia marcescens plasmid R830b, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
431. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042526 (Citrobacter freundii strain E11 plasmid pE11_002, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
432. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
433. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP031322 (Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
434. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to CP052472 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-4, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
435. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_LT985264 (Escherichia coli strain 717 plasmid RCS51TR717_p, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
436. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC505604 (Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
437. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to LC508722 (Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
438. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NC_019889 (Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
439. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to MT193824 (Escherichia coli strain 19-AB01443 plasmid pOX-48-EC1443, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
440. spacer 3.1|3124041|28|NC_019897|CRISPRCasFinder matches to NZ_CP042568 (Enterobacter hormaechei strain C44 plasmid pC44_002, complete sequence) position: , mismatch: 7, identity: 0.75
gcaggcatagaaaaacggctggcccgca CRISPR spacer
tgaggcaaagaaaaacggctggcacagc Protospacer
***** *************** *.
441. spacer 6.23|3276801|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.771
---aatggtcacagcgtccccccgcgcctccgtcgctc CRISPR spacer
ccgcacgg---cagcgtccccgcgcgcctccatcgctt Protospacer
*.** ********** *********.*****.
442. spacer 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MK305891 (Streptomyces phage Gibson, complete genome) position: , mismatch: 8, identity: 0.771
cgagcagagcgcggcggccgagaagac--attccagc CRISPR spacer
cgagaagcgcgcggcggccgagaaggcggaggccg-- Protospacer
**** ** *****************.* * **.
443. spacer 7.4|3279363|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MH779504 (Gordonia phage Getalong, complete genome) position: , mismatch: 8, identity: 0.778
acccgtgcgcaggcagcggttccaccttgagggcgg CRISPR spacer
acccgttcgcaggcagcggctccaccctcgtcgccg Protospacer
****** ************.******.* . ** *
444. spacer 7.4|3279363|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MK376961 (Gordonia phage Asapag, complete genome) position: , mismatch: 8, identity: 0.778
acccgtgcgcaggcagcggttccaccttgagggcgg CRISPR spacer
acccgttcgcaggcagcggctccaccctcgtcgccg Protospacer
****** ************.******.* . ** *
445. spacer 13.36|3420771|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
cagcgcggcgagatcagcgaagggcagtaccggg CRISPR spacer
ctgcggcagcagatcagcgaagggcggtacaggg Protospacer
* *** . ***************.**** ***
446. spacer 6.5|3275603|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.743
acggtcggcgcgatcacttcggcattcgctgacgt CRISPR spacer
ttggtcggcgagatcacttcggcaatctcgcagtt Protospacer
.******** ************* ** * * *
447. spacer 7.9|3279696|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
acgcgattcttccagcgcgacagcacgaaggccaa CRISPR spacer
ctcagatccttcgagcgcgacagcacgaagcgaaa Protospacer
. ***.**** ***************** **
448. spacer 8.3|3281910|36|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.75
acggcggcttcggtgccggattctgcggcgtatcct CRISPR spacer
gtggcggcttcggtgcctgcttctgcggcgggcgcg Protospacer
..*************** * ********** .. *
449. spacer 13.36|3420771|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735
cagcgcggcgagatcagcgaagggcagtaccggg CRISPR spacer
aagaagggcgcgatcagcgaagagcagtacaagc Protospacer
** . **** ***********.******* .*
450. spacer 6.13|3276137|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to CP041517 (Bacillus aryabhattai strain KNU10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714
gtagcttccagcgaattttgcttttcttgatttga CRISPR spacer
tcctcaaccaacgaattttggttttcttgatttat Protospacer
. * ***.********* ************.
451. spacer 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MT498053 (Streptomyces phage PHTowN, complete genome) position: , mismatch: 10, identity: 0.714
cgagcagagcgcggcggccgagaagacattccagc CRISPR spacer
cgagaagcgcgcggcggccgagaaggcggaggcgg Protospacer
**** ** *****************.*. *
452. spacer 6.28|3277141|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MT897908 (Streptomyces phage ShakeNBake, complete genome) position: , mismatch: 10, identity: 0.714
cgagcagagcgcggcggccgagaagacattccagc CRISPR spacer
cgagaagcgcgcggcggccgagaaggcggaggcgg Protospacer
**** ** *****************.*. *
453. spacer 13.5|3418666|37|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010024 (Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence) position: , mismatch: 10, identity: 0.73
atctcccgcagccgttgcgtccatgccgccgacacgt CRISPR spacer
accctatgcaggcgttgcgtccatgccgtcgacatcc Protospacer
*.*.. .**** ****************.*****. .
454. spacer 13.14|3419279|39|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 10, identity: 0.744
atcttattcgcacgctaccccgtcgccatctcgatccaa CRISPR spacer
gccagcctcgcacgcaacgccgtcgccatctcgatcgag Protospacer
..* .******** ** ***************** *.
455. spacer 13.18|3419560|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 10, identity: 0.706
ctccttctgcatttcaagtttgatatcacttaaa CRISPR spacer
ttccttctgctttgcaagtttgatagtaggaatg Protospacer
.********* ** *********** .* * .
456. spacer 13.35|3420705|34|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
gcgcgggatttcgaacggctcgacgacgtgaatg CRISPR spacer
acctgggagttcgaaccgctcgacgacgaggtgt Protospacer
.* .**** ******* *********** *.
457. spacer 13.38|3420904|35|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 11, identity: 0.686
tcattaacgcccgttgttcttcctgcaggcgcttg CRISPR spacer
gggccatgcgccgctgttcttcctgctggcgcttg Protospacer
...* ***.************ ********
458. spacer 13.39|3420971|35|NC_019897|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 11, identity: 0.686
tcattaacgcccgttgttcttcctgcaggcgcttg CRISPR spacer
gggccatgcgccgctgttcttcctgctggcgcttg Protospacer
...* ***.************ ********
459. spacer 7.9|3279696|35|NC_019897|CRISPRCasFinder,CRT,PILER-CR matches to MN095772 (Stenotrophomonas phage Moby, complete genome) position: , mismatch: 12, identity: 0.657
acgcgattcttccagcgcgacagcacgaaggccaa CRISPR spacer
ttcaacttcttcgagcgcgacagcccgaaggagtc Protospacer
. . ****** *********** ******