Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018079 Enterobacter cloacae subsp. dissolvens SDM, complete sequence 1 crisprs cas3,DEDDh,csa3,WYL,DinG 0 2 7 0

Results visualization

1. NC_018079
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018079_1 747546-747677 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052797 Salmonella enterica subsp. enterica serovar Infantis strain CVM N18S2039 plasmid pN18S2039, complete sequence 63456-63485 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 12622-12651 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP038508 Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence 129996-130025 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052788 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence 221022-221051 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052786 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence 232950-232979 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052838 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence 231525-231554 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP028316 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence 128630-128659 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP051676 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence 101317-101346 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP022063 Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence 84260-84289 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052781 Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence 187128-187157 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052834 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence 24105-24134 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052793 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence 43406-43435 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052832 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence 178361-178390 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052830 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence 211357-211386 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP022662 Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-2, complete sequence 73314-73343 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052812 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence 19319-19348 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052810 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence 230399-230428 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052808 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence 11111-11140 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052806 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence 182227-182256 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052791 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence 185722-185751 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052818 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence 208172-208201 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1688442-1688471 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052799 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence 24105-24134 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 264943-264972 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 77271-77300 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052802 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence 298048-298077 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052840 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence 110008-110037 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052783 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence 176473-176502 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052836 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence 764-793 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052779 Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence 122769-122798 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP031362 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence 123173-123202 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052828 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence 109328-109357 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052826 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence 93338-93367 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP016409 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence 77270-77299 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052824 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence 73851-73880 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052822 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence 93338-93367 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP016407 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence 77270-77299 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052820 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence 77270-77299 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP016413 Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence 77270-77299 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 NZ_CP016411 Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence 77270-77299 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052816 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598 147671-147700 7 0.767
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 CP052814 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence 81463-81492 7 0.767
NC_018079_1 1.1|747570|30|NC_018079|CRISPRCasFinder 747570-747599 30 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 341179-341208 8 0.733
NC_018079_1 1.1|747570|30|NC_018079|CRISPRCasFinder 747570-747599 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1386373-1386402 8 0.733
NC_018079_1 1.2|747624|30|NC_018079|CRISPRCasFinder 747624-747653 30 KP881232 Sinorhizobium phage phiM9, complete genome 86166-86195 8 0.733

1. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052797 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N18S2039 plasmid pN18S2039, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

2. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

3. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

4. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

5. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

6. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

7. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP028316 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

8. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

9. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP022063 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

10. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052781 (Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

11. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052834 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

12. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052793 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

13. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

14. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052830 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

15. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP022662 (Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-2, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattccccc	Protospacer
.*******.***.************ .*  

16. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052812 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

17. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052810 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

18. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052808 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

19. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052806 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

20. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052791 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

21. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052818 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

22. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccactggtaccgccattcgacg	Protospacer
.*******.***** **********    *

23. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052799 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

24. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

25. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP047882 (Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

26. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

27. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

28. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052783 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

29. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

30. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

31. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP031362 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

32. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052828 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

33. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052826 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

34. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP016409 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

35. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052824 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

36. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052822 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

37. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP016407 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

38. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052820 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

39. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP016413 (Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

40. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to NZ_CP016411 (Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

41. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052816 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

42. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to CP052814 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

43. spacer 1.1|747570|30|NC_018079|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 8, identity: 0.733

caccactgtcgccgttatcattgccgccgc	CRISPR spacer
ggtttcggtcgccgatatcatggccgccgc	Protospacer
 ... * ******* ****** ********

44. spacer 1.1|747570|30|NC_018079|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.733

caccactgtcgccgttatcattgccgccgc	CRISPR spacer
tattgccaccgccgttaccattgccgccgc	Protospacer
.*...*...********.************

45. spacer 1.2|747624|30|NC_018079|CRISPRCasFinder matches to KP881232 (Sinorhizobium phage phiM9, complete genome) position: , mismatch: 8, identity: 0.733

tgccattgtcactgttaccgccattatcag	CRISPR spacer
tgccattgccaccgttaccgccagctccgc	Protospacer
********.***.********** . .*. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 105164 : 116245 13 Enterobacteria_phage(100.0%) integrase attL 101415:101433|attR 119193:119211
DBSCAN-SWA_2 1017098 : 1025762 10 Enterobacteria_phage(66.67%) integrase attL 1011671:1011685|attR 1023622:1023636
DBSCAN-SWA_3 2203155 : 2211710 10 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_4 2693370 : 2717270 27 Enterobacteria_phage(47.37%) lysis,tail,terminase NA
DBSCAN-SWA_5 2723991 : 2734602 12 Enterobacteria_phage(81.82%) integrase attL 2726686:2726699|attR 2739597:2739610
DBSCAN-SWA_6 3233675 : 3239949 6 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_7 4203579 : 4231457 33 Erwinia_phage(45.16%) tRNA,tail,protease,integrase,plate attL 4209371:4209385|attR 4236745:4236759
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage