Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_016633 Sphaerochaeta pleomorpha str. Grapes, complete sequence 1 crisprs DinG,csa3,DEDDh,WYL,cas3,cas5,cas8c,cas7,cas4,cas1,cas2 0 4 4 0

Results visualization

1. NC_016633
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016633_1 3520456-3523663 TypeI I-C
48 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_016633_1 1.12|3521221|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521221-3521254 34 NC_031944 Synechococcus phage S-WAM1 isolate 0810PA09, complete genome 177319-177352 8 0.765
NC_016633_1 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521682-3521715 34 NC_009036 Shewanella baltica OS155 plasmid pSbal02, complete sequence 57715-57748 10 0.706
NC_016633_1 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521682-3521715 34 NC_009036 Shewanella baltica OS155 plasmid pSbal02, complete sequence 27457-27490 10 0.706
NC_016633_1 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521682-3521715 34 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 86136-86169 10 0.706
NC_016633_1 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521682-3521715 34 NC_017578 Shewanella baltica OS117 plasmid pSBAL11703, complete sequence 22962-22995 10 0.706
NC_016633_1 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521682-3521715 34 NC_017578 Shewanella baltica OS117 plasmid pSBAL11703, complete sequence 63814-63847 10 0.706
NC_016633_1 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521682-3521715 34 NC_017580 Shewanella baltica OS117 plasmid pSBAL11702, complete sequence 19211-19244 10 0.706
NC_016633_1 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521682-3521715 34 NC_017580 Shewanella baltica OS117 plasmid pSBAL11702, complete sequence 20759-20792 10 0.706
NC_016633_1 1.42|3523206|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3523206-3523239 34 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 107042-107075 10 0.706
NC_016633_1 1.13|3521287|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR 3521287-3521320 34 HQ633071 Synechococcus phage S-SKS1 genomic sequence 87333-87366 11 0.676

1. spacer 1.12|3521221|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NC_031944 (Synechococcus phage S-WAM1 isolate 0810PA09, complete genome) position: , mismatch: 8, identity: 0.765

ccgttgatcagatagaagaaatgttttcccgcaa	CRISPR spacer
ttgttcctatgatagaagaaatcttttcacgcaa	Protospacer
..***  *  ************ ***** *****

2. spacer 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NC_009036 (Shewanella baltica OS155 plasmid pSbal02, complete sequence) position: , mismatch: 10, identity: 0.706

cagtagtcgtcaatgctatcatagtcatatgcgt	CRISPR spacer
tcatactcgtcaatgctatcaaagtcacttgaac	Protospacer
. .** *************** *****. ** ..

3. spacer 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NC_009036 (Shewanella baltica OS155 plasmid pSbal02, complete sequence) position: , mismatch: 10, identity: 0.706

cagtagtcgtcaatgctatcatagtcatatgcgt	CRISPR spacer
tcatactcgtcaatgctatcaaagtcacttgaac	Protospacer
. .** *************** *****. ** ..

4. spacer 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 10, identity: 0.706

cagtagtcgtcaatgctatcatagtcatatgcgt	CRISPR spacer
tcatactcgtcaatgctatcaaagtcacttgaac	Protospacer
. .** *************** *****. ** ..

5. spacer 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NC_017578 (Shewanella baltica OS117 plasmid pSBAL11703, complete sequence) position: , mismatch: 10, identity: 0.706

cagtagtcgtcaatgctatcatagtcatatgcgt	CRISPR spacer
tcatactcgtcaatgctatcaaagtcacttgaac	Protospacer
. .** *************** *****. ** ..

6. spacer 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NC_017578 (Shewanella baltica OS117 plasmid pSBAL11703, complete sequence) position: , mismatch: 10, identity: 0.706

cagtagtcgtcaatgctatcatagtcatatgcgt	CRISPR spacer
tcatactcgtcaatgctatcaaagtcacttgaac	Protospacer
. .** *************** *****. ** ..

7. spacer 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NC_017580 (Shewanella baltica OS117 plasmid pSBAL11702, complete sequence) position: , mismatch: 10, identity: 0.706

cagtagtcgtcaatgctatcatagtcatatgcgt	CRISPR spacer
tcatactcgtcaatgctatcaaagtcacttgaac	Protospacer
. .** *************** *****. ** ..

8. spacer 1.19|3521682|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NC_017580 (Shewanella baltica OS117 plasmid pSBAL11702, complete sequence) position: , mismatch: 10, identity: 0.706

cagtagtcgtcaatgctatcatagtcatatgcgt	CRISPR spacer
tcatactcgtcaatgctatcaaagtcacttgaac	Protospacer
. .** *************** *****. ** ..

9. spacer 1.42|3523206|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

cagtcgaacaagataccggcgttggaacttgaac	CRISPR spacer
cagtcgaagaagatcccggcgttgcgctcggaga	Protospacer
******** ***** ********* . .. **. 

10. spacer 1.13|3521287|34|NC_016633|CRISPRCasFinder,CRT,PILER-CR matches to HQ633071 (Synechococcus phage S-SKS1 genomic sequence) position: , mismatch: 11, identity: 0.676

atctccacagaatcgaaaggttgaggtatctcgt	CRISPR spacer
ttggacacagaaccgaaaggttgtggtatactaa	Protospacer
 *   *******.********** ***** ... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1777016 : 1799372 28 uncultured_virus(28.57%) transposase NA
DBSCAN-SWA_2 2910894 : 2919345 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_3 3034383 : 3109718 74 Erysipelothrix_phage(44.83%) protease,tRNA,capsid,terminase,portal,transposase NA
DBSCAN-SWA_4 3132691 : 3141912 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage