Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_016605 Pediococcus claussenii ATCC BAA-344, complete sequence 0 crisprs csa3,DEDDh,cas3,DinG 0 0 4 0
NC_016635 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-1, complete sequence 0 crisprs NA 0 0 0 0
NC_016608 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence 0 crisprs csa3 0 0 0 0
NC_016606 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-2, complete sequence 0 crisprs NA 0 0 0 0
NC_016607 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-4, complete sequence 0 crisprs NA 0 0 0 0
NC_017017 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence 1 crisprs NA 0 1 0 0
NC_016636 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-3, complete sequence 0 crisprs NA 0 0 0 0
NC_017018 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-7, complete sequence 0 crisprs NA 0 0 1 0
NC_017019 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-8, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_016605
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 524840 : 532540 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 572639 : 603409 34 Lactobacillus_phage(17.65%) portal,terminase,capsid,head,tRNA,integrase attL 590596:590616|attR 604401:604421
DBSCAN-SWA_3 910171 : 922216 13 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_4 1579607 : 1587708 8 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_017017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017017_1 5351-5452 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NC_017017 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence 5387-5416 0 1.0
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP014928 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence 6824-6853 0 1.0
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 5237-5266 0 1.0
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP014920 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence 12632-12661 1 0.967
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NC_017468 Lactobacillus helveticus H10 plasmid pH10, complete sequence 15844-15873 1 0.967
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP033891 Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence 3330-3359 1 0.967
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP031200 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence 39624-39653 1 0.967
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NC_008498 Lactobacillus brevis ATCC 367 plasmid 1, complete sequence 8762-8791 1 0.967
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP014874 Lactobacillus backii strain TMW 1.1989 plasmid pL11989-1, complete sequence 6854-6883 2 0.933
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP027191 Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence 29359-29388 2 0.933
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP027195 Lactobacillus sp. CBA3606 plasmid pCBA3606-1, complete sequence 30409-30438 2 0.933
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NC_006529 Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence 4742-4771 2 0.933
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NC_015421 Lactobacillus buchneri NRRL B-30929 plasmid pLBUC03, complete sequence 1005-1034 2 0.933
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP014900 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence 28835-28864 2 0.933
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP014913 Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence 22508-22537 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP019033 Lactobacillus fermentum strain SNUV175 plasmid pSNU175-4, complete sequence 21083-21112 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP017358 Lactobacillus plantarum strain TMW 1.25 plasmid pL125-4, complete sequence 4830-4859 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP017368 Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-5, complete sequence 5770-5799 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP017265 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence 26504-26533 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP019982 Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence 10405-10434 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP019982 Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence 86924-86953 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP017960 Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence 6891-6920 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP017960 Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence 20910-20939 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP014934 Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence 5933-5962 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP014937 Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence 5934-5963 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 MK994179 Lactobacillus plantarum strain PC518 plasmid plp75TA, complete sequence 4885-4914 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_CP011537 Lactobacillus fermentum 3872 plasmid pLF3872, complete sequence 7181-7210 3 0.9
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 NZ_AP014682 Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence 515-544 5 0.833
NC_017017_1 1.1|5387|30|NC_017017|CRISPRCasFinder 5387-5416 30 MN034684 Leviviridae sp. isolate H1_Rhizo_27_scaffold_801 RNA-dependent RNA polymerase (H1Rhizo27801_000001), hypothetical protein (H1Rhizo27801_000002), and hypothetical protein (H1Rhizo27801_000003) genes, complete cds 2054-2083 8 0.733

1. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NC_017017 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
******************************

2. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP014928 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
******************************

3. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
******************************

4. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP014920 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence) position: , mismatch: 1, identity: 0.967

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaat	Protospacer
*****************************.

5. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NC_017468 (Lactobacillus helveticus H10 plasmid pH10, complete sequence) position: , mismatch: 1, identity: 0.967

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaag	Protospacer
***************************** 

6. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP033891 (Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence) position: , mismatch: 1, identity: 0.967

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaag	Protospacer
***************************** 

7. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP031200 (Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence) position: , mismatch: 1, identity: 0.967

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaat	Protospacer
*****************************.

8. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NC_008498 (Lactobacillus brevis ATCC 367 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.967

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gtggggtgtcgtcaacgaactttcgcgaac	Protospacer
*.****************************

9. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP014874 (Lactobacillus backii strain TMW 1.1989 plasmid pL11989-1, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgttgtcaacgaactttcgcgaat	Protospacer
*********.*******************.

10. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP027191 (Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgttgtcaacgaactttcgcgaat	Protospacer
*********.*******************.

11. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP027195 (Lactobacillus sp. CBA3606 plasmid pCBA3606-1, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgttgtcaacgaactttcgcgaat	Protospacer
*********.*******************.

12. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NC_006529 (Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcgtcaacggactttcgcgaag	Protospacer
*****************.*********** 

13. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NC_015421 (Lactobacillus buchneri NRRL B-30929 plasmid pLBUC03, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcgggttgtcgtcaacgaactttcgcgaat	Protospacer
***** ***********************.

14. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP014900 (Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgttgtcaacgaactttcgcgaat	Protospacer
*********.*******************.

15. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP014913 (Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

16. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP019033 (Lactobacillus fermentum strain SNUV175 plasmid pSNU175-4, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggagtgtcgtcaacggactttcgcgaag	Protospacer
****.************.*********** 

17. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP017358 (Lactobacillus plantarum strain TMW 1.25 plasmid pL125-4, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

18. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP017368 (Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-5, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

19. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP017265 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

20. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP019982 (Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggagtgttgtcaacgaactttcgcgaat	Protospacer
****.****.*******************.

21. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP019982 (Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggagtgttgtcaacgaactttcgcgaat	Protospacer
****.****.*******************.

22. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP017960 (Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

23. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP017960 (Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

24. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP014934 (Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

25. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP014937 (Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

26. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to MK994179 (Lactobacillus plantarum strain PC518 plasmid plp75TA, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.*********** 

27. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_CP011537 (Lactobacillus fermentum 3872 plasmid pLF3872, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gcggagtgtcgtcaacggactttcgcgaag	Protospacer
****.************.*********** 

28. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to NZ_AP014682 (Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence) position: , mismatch: 5, identity: 0.833

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
gaggggtgtcgtcaacgaacttatgcggaa	Protospacer
* ******************** .***.* 

29. spacer 1.1|5387|30|NC_017017|CRISPRCasFinder matches to MN034684 (Leviviridae sp. isolate H1_Rhizo_27_scaffold_801 RNA-dependent RNA polymerase (H1Rhizo27801_000001), hypothetical protein (H1Rhizo27801_000002), and hypothetical protein (H1Rhizo27801_000003) genes, complete cds) position: , mismatch: 8, identity: 0.733

gcggggtgtcgtcaacgaactttcgcgaac	CRISPR spacer
cgctggtgtcgtcaacgaacattcgctact	Protospacer
    **************** ***** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_017018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7611 8 Lactococcus_phage(33.33%) transposase,integrase attL 876:887|attR 3703:3714
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage