1. spacer 1.1|40536|31|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
acccaccacaccccgagccgactggccgggg CRISPR spacer
acccaccacaccccgagccgactggccgggg Protospacer
*******************************
2. spacer 1.1|40536|31|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
acccaccacaccccgagccgactggccgggg CRISPR spacer
acccaccacaccccgagccgactggccgggg Protospacer
*******************************
3. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
cgtggcgggctcaccggccgcgatgacct Protospacer
*****************************
4. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
cgtggcgggctcaccggccgcgatgacct Protospacer
*****************************
5. spacer 1.3|40656|31|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
agtgcctcgaagacgagggtggaggctgcgg CRISPR spacer
agtgcctcgaagacgagggtggaggctgcgg Protospacer
*******************************
6. spacer 1.3|40656|31|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
agtgcctcgaagacgagggtggaggctgcgg CRISPR spacer
agtgcctcgaagacgagggtggaggctgcgg Protospacer
*******************************
7. spacer 1.4|40717|31|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgggttgcgggggcgtggatggtcgtggtca CRISPR spacer
cgggttgcgggggcgtggatggtcgtggtca Protospacer
*******************************
8. spacer 1.4|40717|31|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgggttgcgggggcgtggatggtcgtggtca CRISPR spacer
cgggttgcgggggcgtggatggtcgtggtca Protospacer
*******************************
9. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
cttcttggcggccttgttgatgcgcttcttg Protospacer
*******************************
10. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
cttcttggcggccttgttgatgcgcttcttg Protospacer
*******************************
11. spacer 1.6|40597|30|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
cgtggcgggctcaccggccgcgatgacctc Protospacer
******************************
12. spacer 1.6|40597|30|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
cgtggcgggctcaccggccgcgatgacctc Protospacer
******************************
13. spacer 1.7|40656|32|NC_017766|CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
agtgcctcgaagacgagggtggaggctgcggc CRISPR spacer
agtgcctcgaagacgagggtggaggctgcggc Protospacer
********************************
14. spacer 1.7|40656|32|NC_017766|CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
agtgcctcgaagacgagggtggaggctgcggc CRISPR spacer
agtgcctcgaagacgagggtggaggctgcggc Protospacer
********************************
15. spacer 1.8|40717|32|NC_017766|CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgggttgcgggggcgtggatggtcgtggtcat CRISPR spacer
cgggttgcgggggcgtggatggtcgtggtcat Protospacer
********************************
16. spacer 1.8|40717|32|NC_017766|CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgggttgcgggggcgtggatggtcgtggtcat CRISPR spacer
cgggttgcgggggcgtggatggtcgtggtcat Protospacer
********************************
17. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
cttcttggcggccttgttgatgcgcttcttgt Protospacer
********************************
18. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
cttcttggcggccttgttgatgcgcttcttgt Protospacer
********************************
19. spacer 2.1|50754|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgcctggttagcgtcgacgttactttcgaggt CRISPR spacer
cgcctggttagcgtcgacgttactttcgaggt Protospacer
********************************
20. spacer 2.1|50754|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgcctggttagcgtcgacgttactttcgaggt CRISPR spacer
cgcctggttagcgtcgacgttactttcgaggt Protospacer
********************************
21. spacer 2.2|50815|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cggtgctagagccgcccccactacccactacc CRISPR spacer
cggtgctagagccgcccccactacccactacc Protospacer
********************************
22. spacer 2.2|50815|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cggtgctagagccgcccccactacccactacc CRISPR spacer
cggtgctagagccgcccccactacccactacc Protospacer
********************************
23. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
tgttgcaggcgacggcgcaggagatcgtggct Protospacer
********************************
24. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
tgttgcaggcgacggcgcaggagatcgtggct Protospacer
********************************
25. spacer 2.4|50937|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcacacaggtgatcaggaccgtcttcctcgc CRISPR spacer
gtcacacaggtgatcaggaccgtcttcctcgc Protospacer
********************************
26. spacer 2.4|50937|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcacacaggtgatcaggaccgtcttcctcgc CRISPR spacer
gtcacacaggtgatcaggaccgtcttcctcgc Protospacer
********************************
27. spacer 2.5|50998|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
agcatcgatcgcaagccgtgctcgaagcgccg CRISPR spacer
agcatcgatcgcaagccgtgctcgaagcgccg Protospacer
********************************
28. spacer 2.5|50998|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
agcatcgatcgcaagccgtgctcgaagcgccg CRISPR spacer
agcatcgatcgcaagccgtgctcgaagcgccg Protospacer
********************************
29. spacer 2.6|51059|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cccacgaagcccccgtccgagtctgggcgggg CRISPR spacer
cccacgaagcccccgtccgagtctgggcgggg Protospacer
********************************
30. spacer 2.6|51059|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cccacgaagcccccgtccgagtctgggcgggg CRISPR spacer
cccacgaagcccccgtccgagtctgggcgggg Protospacer
********************************
31. spacer 2.6|51059|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cccacgaagcccccgtccgagtctgggcgggg CRISPR spacer
cccacgaagcccccgtccgagtctgggcgggg Protospacer
********************************
32. spacer 2.6|51059|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cccacgaagcccccgtccgagtctgggcgggg CRISPR spacer
cccacgaagcccccgtccgagtctgggcgggg Protospacer
********************************
33. spacer 2.7|51120|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cagctcggcgcgcaggaacggtccgggctgcg CRISPR spacer
cagctcggcgcgcaggaacggtccgggctgcg Protospacer
********************************
34. spacer 2.7|51120|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cagctcggcgcgcaggaacggtccgggctgcg CRISPR spacer
cagctcggcgcgcaggaacggtccgggctgcg Protospacer
********************************
35. spacer 2.8|51181|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cagtccaggccgtccttgatgtgaccgaccgt CRISPR spacer
cagtccaggccgtccttgatgtgaccgaccgt Protospacer
********************************
36. spacer 2.8|51181|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cagtccaggccgtccttgatgtgaccgaccgt CRISPR spacer
cagtccaggccgtccttgatgtgaccgaccgt Protospacer
********************************
37. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gaggtgaggctcgtcggccagggcgccggcaa Protospacer
********************************
38. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gaggtgaggctcgtcggccagggcgccggcaa Protospacer
********************************
39. spacer 2.10|51303|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cagcgtcccggaccgtgcaagatgccccagtc CRISPR spacer
cagcgtcccggaccgtgcaagatgccccagtc Protospacer
********************************
40. spacer 2.10|51303|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cagcgtcccggaccgtgcaagatgccccagtc CRISPR spacer
cagcgtcccggaccgtgcaagatgccccagtc Protospacer
********************************
41. spacer 2.11|51364|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
acaccccaccccatccacagcagtcaggaaga CRISPR spacer
acaccccaccccatccacagcagtcaggaaga Protospacer
********************************
42. spacer 2.11|51364|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
acaccccaccccatccacagcagtcaggaaga CRISPR spacer
acaccccaccccatccacagcagtcaggaaga Protospacer
********************************
43. spacer 2.12|51425|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gagtccgggctgtgggcgttgaagggctacaa CRISPR spacer
gagtccgggctgtgggcgttgaagggctacaa Protospacer
********************************
44. spacer 2.12|51425|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gagtccgggctgtgggcgttgaagggctacaa CRISPR spacer
gagtccgggctgtgggcgttgaagggctacaa Protospacer
********************************
45. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
gtcgacgtcgcgttcgtgccgcgctccgcgtt Protospacer
********************************
46. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
gtcgacgtcgcgttcgtgccgcgctccgcgtt Protospacer
********************************
47. spacer 2.14|51547|32|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
ccttgaccttgtcgaccttcatctcgaacagg Protospacer
********************************
48. spacer 2.14|51547|32|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
ccttgaccttgtcgaccttcatctcgaacagg Protospacer
********************************
49. spacer 3.1|51817|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
ccgccctgccccgcctgagcgcgaacgtgccg Protospacer
********************************
50. spacer 3.1|51817|32|NC_017766|CRISPRCasFinder matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
ccgccctgccccgcctgagcgcgaacgtgccg Protospacer
********************************
51. spacer 3.1|51817|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
ccgccctgccccgcctgagcgcgaacgtgccg Protospacer
********************************
52. spacer 3.2|51878|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
tgcgggaggccatccgccgcgctgtctgtgag CRISPR spacer
tgcgggaggccatccgccgcgctgtctgtgag Protospacer
********************************
53. spacer 3.2|51878|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
tgcgggaggccatccgccgcgctgtctgtgag CRISPR spacer
tgcgggaggccatccgccgcgctgtctgtgag Protospacer
********************************
54. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
agttgcagacgctcccgctcgccgctcaccag Protospacer
********************************
55. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
agttgcagacgctcccgctcgccgctcaccag Protospacer
********************************
56. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
cccgccgcgctcgccctggccactctgggcat Protospacer
********************************
57. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
cccgccgcgctcgccctggccactctgggcat Protospacer
********************************
58. spacer 3.5|52061|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
accgtccagtccaagtacacagctccctaccg CRISPR spacer
accgtccagtccaagtacacagctccctaccg Protospacer
********************************
59. spacer 3.5|52061|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
accgtccagtccaagtacacagctccctaccg CRISPR spacer
accgtccagtccaagtacacagctccctaccg Protospacer
********************************
60. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
ctgaacttcggcaaggcggtcggtgcacgctg Protospacer
********************************
61. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
ctgaacttcggcaaggcggtcggtgcacgctg Protospacer
********************************
62. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcggcgcgcaccgtcgccgacacccacga Protospacer
********************************
63. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcggcgcgcaccgtcgccgacacccacga Protospacer
********************************
64. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcggcgcgcaccgtcgccgacacccacga Protospacer
********************************
65. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 0, identity: 1.0
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcggcgcgcaccgtcgccgacacccacga Protospacer
********************************
66. spacer 3.8|52244|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gagctgtgcaccgccacgatcaacgaccgacg CRISPR spacer
gagctgtgcaccgccacgatcaacgaccgacg Protospacer
********************************
67. spacer 3.8|52244|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gagctgtgcaccgccacgatcaacgaccgacg CRISPR spacer
gagctgtgcaccgccacgatcaacgaccgacg Protospacer
********************************
68. spacer 3.9|52305|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggtactcgcgtcaaggcgcgcgggtcaggcgt CRISPR spacer
ggtactcgcgtcaaggcgcgcgggtcaggcgt Protospacer
********************************
69. spacer 3.9|52305|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggtactcgcgtcaaggcgcgcgggtcaggcgt CRISPR spacer
ggtactcgcgtcaaggcgcgcgggtcaggcgt Protospacer
********************************
70. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
ccgccaacgtggtggccgaacggctgcgccc Protospacer
*******************************
71. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
ccgccaacgtggtggccgaacggctgcgccc Protospacer
*******************************
72. spacer 3.11|52426|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
tggcggtgcatgcccgtgctcaccggcgccag CRISPR spacer
tggcggtgcatgcccgtgctcaccggcgccag Protospacer
********************************
73. spacer 3.11|52426|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
tggcggtgcatgcccgtgctcaccggcgccag CRISPR spacer
tggcggtgcatgcccgtgctcaccggcgccag Protospacer
********************************
74. spacer 3.12|52487|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gataccagcaatctctgtgagtcggcgtcccg CRISPR spacer
gataccagcaatctctgtgagtcggcgtcccg Protospacer
********************************
75. spacer 3.12|52487|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gataccagcaatctctgtgagtcggcgtcccg CRISPR spacer
gataccagcaatctctgtgagtcggcgtcccg Protospacer
********************************
76. spacer 3.13|51812|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atccgccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
atccgccgccctgccccgcctgagcgcgaacgtgccg Protospacer
*************************************
77. spacer 3.13|51812|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atccgccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
atccgccgccctgccccgcctgagcgcgaacgtgccg Protospacer
*************************************
78. spacer 3.14|51873|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atccctgcgggaggccatccgccgcgctgtctgtgag CRISPR spacer
atccctgcgggaggccatccgccgcgctgtctgtgag Protospacer
*************************************
79. spacer 3.14|51873|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atccctgcgggaggccatccgccgcgctgtctgtgag CRISPR spacer
atccctgcgggaggccatccgccgcgctgtctgtgag Protospacer
*************************************
80. spacer 3.15|51934|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atcccagttgcagacgctcccgctcgccgctcaccag CRISPR spacer
atcccagttgcagacgctcccgctcgccgctcaccag Protospacer
*************************************
81. spacer 3.15|51934|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atcccagttgcagacgctcccgctcgccgctcaccag CRISPR spacer
atcccagttgcagacgctcccgctcgccgctcaccag Protospacer
*************************************
82. spacer 3.16|51995|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atccccccgccgcgctcgccctggccactctgggcat CRISPR spacer
atccccccgccgcgctcgccctggccactctgggcat Protospacer
*************************************
83. spacer 3.16|51995|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atccccccgccgcgctcgccctggccactctgggcat CRISPR spacer
atccccccgccgcgctcgccctggccactctgggcat Protospacer
*************************************
84. spacer 3.17|52056|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atcccaccgtccagtccaagtacacagctccctaccg CRISPR spacer
atcccaccgtccagtccaagtacacagctccctaccg Protospacer
*************************************
85. spacer 3.17|52056|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atcccaccgtccagtccaagtacacagctccctaccg CRISPR spacer
atcccaccgtccagtccaagtacacagctccctaccg Protospacer
*************************************
86. spacer 3.18|52117|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atcccctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
atcccctgaacttcggcaaggcggtcggtgcacgctg Protospacer
*************************************
87. spacer 3.18|52117|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atcccctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
atcccctgaacttcggcaaggcggtcggtgcacgctg Protospacer
*************************************
88. spacer 3.19|52178|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atccccaggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
atccccaggcggcgcgcaccgtcgccgacacccacga Protospacer
*************************************
89. spacer 3.19|52178|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atccccaggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
atccccaggcggcgcgcaccgtcgccgacacccacga Protospacer
*************************************
90. spacer 3.20|52239|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atcccgagctgtgcaccgccacgatcaacgaccgacg CRISPR spacer
atcccgagctgtgcaccgccacgatcaacgaccgacg Protospacer
*************************************
91. spacer 3.20|52239|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atcccgagctgtgcaccgccacgatcaacgaccgacg CRISPR spacer
atcccgagctgtgcaccgccacgatcaacgaccgacg Protospacer
*************************************
92. spacer 3.21|52300|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcccggtactcgcgtcaaggcgcgcgggtcaggcgt CRISPR spacer
gtcccggtactcgcgtcaaggcgcgcgggtcaggcgt Protospacer
*************************************
93. spacer 3.21|52300|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcccggtactcgcgtcaaggcgcgcgggtcaggcgt CRISPR spacer
gtcccggtactcgcgtcaaggcgcgcgggtcaggcgt Protospacer
*************************************
94. spacer 3.22|52361|36|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
tcccaccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tcccaccgccaacgtggtggccgaacggctgcgccc Protospacer
************************************
95. spacer 3.22|52361|36|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
tcccaccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tcccaccgccaacgtggtggccgaacggctgcgccc Protospacer
************************************
96. spacer 3.23|52421|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gtccctggcggtgcatgcccgtgctcaccggcgccag CRISPR spacer
gtccctggcggtgcatgcccgtgctcaccggcgccag Protospacer
*************************************
97. spacer 3.23|52421|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gtccctggcggtgcatgcccgtgctcaccggcgccag CRISPR spacer
gtccctggcggtgcatgcccgtgctcaccggcgccag Protospacer
*************************************
98. spacer 3.24|52482|37|NC_017766|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gccccgataccagcaatctctgtgagtcggcgtcccg CRISPR spacer
gccccgataccagcaatctctgtgagtcggcgtcccg Protospacer
*************************************
99. spacer 3.24|52482|37|NC_017766|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gccccgataccagcaatctctgtgagtcggcgtcccg CRISPR spacer
gccccgataccagcaatctctgtgagtcggcgtcccg Protospacer
*************************************
100. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
ggtcaggaacgcggccacaccgacgccccgaa Protospacer
********************************
101. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
ggtcaggaacgcggccacaccgacgccccgaa Protospacer
********************************
102. spacer 4.2|53071|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcttctcgatcatctcgtccgtgttcaccgc CRISPR spacer
gtcttctcgatcatctcgtccgtgttcaccgc Protospacer
********************************
103. spacer 4.2|53071|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcttctcgatcatctcgtccgtgttcaccgc CRISPR spacer
gtcttctcgatcatctcgtccgtgttcaccgc Protospacer
********************************
104. spacer 4.3|53132|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccagggaccgcgtcgtcagcggccacaccccg CRISPR spacer
ccagggaccgcgtcgtcagcggccacaccccg Protospacer
********************************
105. spacer 4.3|53132|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccagggaccgcgtcgtcagcggccacaccccg CRISPR spacer
ccagggaccgcgtcgtcagcggccacaccccg Protospacer
********************************
106. spacer 5.1|54820|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
aagtacggcggatacgcgtacgggtccgatcc CRISPR spacer
aagtacggcggatacgcgtacgggtccgatcc Protospacer
********************************
107. spacer 5.1|54820|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
aagtacggcggatacgcgtacgggtccgatcc CRISPR spacer
aagtacggcggatacgcgtacgggtccgatcc Protospacer
********************************
108. spacer 5.2|54881|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggagcattgccatgctcaagatcgaggtgaag CRISPR spacer
ggagcattgccatgctcaagatcgaggtgaag Protospacer
********************************
109. spacer 5.2|54881|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggagcattgccatgctcaagatcgaggtgaag CRISPR spacer
ggagcattgccatgctcaagatcgaggtgaag Protospacer
********************************
110. spacer 5.3|54942|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgggcccggtcaccttccagtccctcgtccaa CRISPR spacer
cgggcccggtcaccttccagtccctcgtccaa Protospacer
********************************
111. spacer 5.3|54942|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgggcccggtcaccttccagtccctcgtccaa CRISPR spacer
cgggcccggtcaccttccagtccctcgtccaa Protospacer
********************************
112. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
ccgctcagctcgcaccgccgggcggcgcggac Protospacer
********************************
113. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
ccgctcagctcgcaccgccgggcggcgcggac Protospacer
********************************
114. spacer 6.2|55288|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccatcagtactcccgacagagcccaccggttc CRISPR spacer
ccatcagtactcccgacagagcccaccggttc Protospacer
********************************
115. spacer 6.2|55288|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccatcagtactcccgacagagcccaccggttc CRISPR spacer
ccatcagtactcccgacagagcccaccggttc Protospacer
********************************
116. spacer 6.3|55349|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgggtgccaatgtccttgctcatcaggggtt CRISPR spacer
gcgggtgccaatgtccttgctcatcaggggtt Protospacer
********************************
117. spacer 6.3|55349|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgggtgccaatgtccttgctcatcaggggtt CRISPR spacer
gcgggtgccaatgtccttgctcatcaggggtt Protospacer
********************************
118. spacer 6.4|55410|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gacatgcgctcgcccctggaacggcaagggcg CRISPR spacer
gacatgcgctcgcccctggaacggcaagggcg Protospacer
********************************
119. spacer 6.4|55410|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gacatgcgctcgcccctggaacggcaagggcg CRISPR spacer
gacatgcgctcgcccctggaacggcaagggcg Protospacer
********************************
120. spacer 6.5|55471|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
caggtgcgtgcacggcgcgtgcagtgggccgg CRISPR spacer
caggtgcgtgcacggcgcgtgcagtgggccgg Protospacer
********************************
121. spacer 6.5|55471|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
caggtgcgtgcacggcgcgtgcagtgggccgg CRISPR spacer
caggtgcgtgcacggcgcgtgcagtgggccgg Protospacer
********************************
122. spacer 6.6|55532|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
aaggtgacgagctggcccggcctgctcgccgt CRISPR spacer
aaggtgacgagctggcccggcctgctcgccgt Protospacer
********************************
123. spacer 6.6|55532|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
aaggtgacgagctggcccggcctgctcgccgt CRISPR spacer
aaggtgacgagctggcccggcctgctcgccgt Protospacer
********************************
124. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cagttcatcgtcggcgtccgccaggacatcac Protospacer
********************************
125. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cagttcatcgtcggcgtccgccaggacatcac Protospacer
********************************
126. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
gacaccctcggctacaaccagttcgccaccaa Protospacer
********************************
127. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
gacaccctcggctacaaccagttcgccaccaa Protospacer
********************************
128. spacer 6.9|55715|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
********************************
129. spacer 6.9|55715|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
********************************
130. spacer 6.9|55715|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
********************************
131. spacer 6.9|55715|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
********************************
132. spacer 7.1|55999|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
cctcgacgggttcgccgagaaggtgctacaccc Protospacer
*********************************
133. spacer 7.1|55999|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
cctcgacgggttcgccgagaaggtgctacaccc Protospacer
*********************************
134. spacer 7.2|56060|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccccatggcttggttcaaggacgtggacctgga CRISPR spacer
ccccatggcttggttcaaggacgtggacctgga Protospacer
*********************************
135. spacer 7.2|56060|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccccatggcttggttcaaggacgtggacctgga CRISPR spacer
ccccatggcttggttcaaggacgtggacctgga Protospacer
*********************************
136. spacer 7.3|56121|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccccactctggcactgtttcaggccattgcgta CRISPR spacer
ccccactctggcactgtttcaggccattgcgta Protospacer
*********************************
137. spacer 7.3|56121|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccccactctggcactgtttcaggccattgcgta CRISPR spacer
ccccactctggcactgtttcaggccattgcgta Protospacer
*********************************
138. spacer 7.4|56182|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgacttcccgcgaaagtgttgcgaacctagggt CRISPR spacer
cgacttcccgcgaaagtgttgcgaacctagggt Protospacer
*********************************
139. spacer 7.4|56182|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgacttcccgcgaaagtgttgcgaacctagggt CRISPR spacer
cgacttcccgcgaaagtgttgcgaacctagggt Protospacer
*********************************
140. spacer 7.5|56243|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ctccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
ctccggtcgtgcacgactgcgccgactgcggac Protospacer
*********************************
141. spacer 7.5|56243|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ctccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
ctccggtcgtgcacgactgcgccgactgcggac Protospacer
*********************************
142. spacer 7.6|56304|40|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atggtcccggccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
atggtcccggccacaatcgcgacctgttcgagaacaaggc Protospacer
****************************************
143. spacer 7.6|56304|40|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atggtcccggccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
atggtcccggccacaatcgcgacctgttcgagaacaaggc Protospacer
****************************************
144. spacer 7.7|56372|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgctcctaggtggggtgcccgccggggacgtgg CRISPR spacer
cgctcctaggtggggtgcccgccggggacgtgg Protospacer
*********************************
145. spacer 7.7|56372|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgctcctaggtggggtgcccgccggggacgtgg CRISPR spacer
cgctcctaggtggggtgcccgccggggacgtgg Protospacer
*********************************
146. spacer 7.8|56433|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ccacgctgggacctcaccctcggcgcggcctcc Protospacer
*********************************
147. spacer 7.8|56433|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ccacgctgggacctcaccctcggcgcggcctcc Protospacer
*********************************
148. spacer 7.9|56494|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgccacggcctcccggccggagagcttgtgccg CRISPR spacer
cgccacggcctcccggccggagagcttgtgccg Protospacer
*********************************
149. spacer 7.9|56494|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgccacggcctcccggccggagagcttgtgccg CRISPR spacer
cgccacggcctcccggccggagagcttgtgccg Protospacer
*********************************
150. spacer 7.10|56555|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgcgtcgtagaggcggcgatcgttgctgccctg CRISPR spacer
cgcgtcgtagaggcggcgatcgttgctgccctg Protospacer
*********************************
151. spacer 7.10|56555|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgcgtcgtagaggcggcgatcgttgctgccctg CRISPR spacer
cgcgtcgtagaggcggcgatcgttgctgccctg Protospacer
*********************************
152. spacer 7.11|56616|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcctgagggggtcccctatccgaaagaaac CRISPR spacer
cctgcctgagggggtcccctatccgaaagaaac Protospacer
*********************************
153. spacer 7.11|56616|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcctgagggggtcccctatccgaaagaaac CRISPR spacer
cctgcctgagggggtcccctatccgaaagaaac Protospacer
*********************************
154. spacer 7.12|56677|33|NC_017766|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
cggcagaccagggcgatgcgggaactgtcccgg Protospacer
*********************************
155. spacer 7.12|56677|33|NC_017766|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
cggcagaccagggcgatgcgggaactgtcccgg Protospacer
*********************************
156. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ctcgacgggttcgccgagaaggtgctacaccc Protospacer
********************************
157. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ctcgacgggttcgccgagaaggtgctacaccc Protospacer
********************************
158. spacer 7.14|56061|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cccatggcttggttcaaggacgtggacctgga CRISPR spacer
cccatggcttggttcaaggacgtggacctgga Protospacer
********************************
159. spacer 7.14|56061|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cccatggcttggttcaaggacgtggacctgga CRISPR spacer
cccatggcttggttcaaggacgtggacctgga Protospacer
********************************
160. spacer 7.15|56122|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cccactctggcactgtttcaggccattgcgta CRISPR spacer
cccactctggcactgtttcaggccattgcgta Protospacer
********************************
161. spacer 7.15|56122|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cccactctggcactgtttcaggccattgcgta CRISPR spacer
cccactctggcactgtttcaggccattgcgta Protospacer
********************************
162. spacer 7.16|56183|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gacttcccgcgaaagtgttgcgaacctagggt CRISPR spacer
gacttcccgcgaaagtgttgcgaacctagggt Protospacer
********************************
163. spacer 7.16|56183|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gacttcccgcgaaagtgttgcgaacctagggt CRISPR spacer
gacttcccgcgaaagtgttgcgaacctagggt Protospacer
********************************
164. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
tccggtcgtgcacgactgcgccgactgcggac Protospacer
********************************
165. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
tccggtcgtgcacgactgcgccgactgcggac Protospacer
********************************
166. spacer 7.18|56305|31|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
gccacaatcgcgacctgttcgagaacaaggc Protospacer
*******************************
167. spacer 7.18|56305|31|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
gccacaatcgcgacctgttcgagaacaaggc Protospacer
*******************************
168. spacer 7.19|56365|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gctcctaggtggggtgcccgccggggacgtgg CRISPR spacer
gctcctaggtggggtgcccgccggggacgtgg Protospacer
********************************
169. spacer 7.19|56365|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gctcctaggtggggtgcccgccggggacgtgg CRISPR spacer
gctcctaggtggggtgcccgccggggacgtgg Protospacer
********************************
170. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
cacgctgggacctcaccctcggcgcggcctcc Protospacer
********************************
171. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
cacgctgggacctcaccctcggcgcggcctcc Protospacer
********************************
172. spacer 7.21|56487|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gccacggcctcccggccggagagcttgtgccg CRISPR spacer
gccacggcctcccggccggagagcttgtgccg Protospacer
********************************
173. spacer 7.21|56487|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gccacggcctcccggccggagagcttgtgccg CRISPR spacer
gccacggcctcccggccggagagcttgtgccg Protospacer
********************************
174. spacer 7.22|56548|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtcgtagaggcggcgatcgttgctgccctg CRISPR spacer
gcgtcgtagaggcggcgatcgttgctgccctg Protospacer
********************************
175. spacer 7.22|56548|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtcgtagaggcggcgatcgttgctgccctg CRISPR spacer
gcgtcgtagaggcggcgatcgttgctgccctg Protospacer
********************************
176. spacer 7.23|56609|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcctgagggggtcccctatccgaaagaaac CRISPR spacer
ctgcctgagggggtcccctatccgaaagaaac Protospacer
********************************
177. spacer 7.23|56609|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcctgagggggtcccctatccgaaagaaac CRISPR spacer
ctgcctgagggggtcccctatccgaaagaaac Protospacer
********************************
178. spacer 7.24|56670|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
ggcagaccagggcgatgcgggaactgtcccgg Protospacer
********************************
179. spacer 7.24|56670|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
ggcagaccagggcgatgcgggaactgtcccgg Protospacer
********************************
180. spacer 7.25|56731|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggtcgccagtcgaacggcaccgacttcacc CRISPR spacer
gaggtcgccagtcgaacggcaccgacttcacc Protospacer
********************************
181. spacer 7.25|56731|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggtcgccagtcgaacggcaccgacttcacc CRISPR spacer
gaggtcgccagtcgaacggcaccgacttcacc Protospacer
********************************
182. spacer 7.26|56792|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gggacacccttcgctgtcggcagcgtctggac CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac Protospacer
********************************
183. spacer 7.26|56792|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gggacacccttcgctgtcggcagcgtctggac CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac Protospacer
********************************
184. spacer 8.1|57077|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gacgtgctcacttggcgatctccttacgggcg CRISPR spacer
gacgtgctcacttggcgatctccttacgggcg Protospacer
********************************
185. spacer 8.1|57077|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gacgtgctcacttggcgatctccttacgggcg CRISPR spacer
gacgtgctcacttggcgatctccttacgggcg Protospacer
********************************
186. spacer 8.2|57138|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gacgaggtagtcaccctggtccggatccgtcg CRISPR spacer
gacgaggtagtcaccctggtccggatccgtcg Protospacer
********************************
187. spacer 8.2|57138|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gacgaggtagtcaccctggtccggatccgtcg CRISPR spacer
gacgaggtagtcaccctggtccggatccgtcg Protospacer
********************************
188. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atcgagaatcatttcgtcgtcgaccccgcgaa CRISPR spacer
atcgagaatcatttcgtcgtcgaccccgcgaa Protospacer
********************************
189. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atcgagaatcatttcgtcgtcgaccccgcgaa CRISPR spacer
atcgagaatcatttcgtcgtcgaccccgcgaa Protospacer
********************************
190. spacer 8.4|57260|33|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cccacgaagcccccgtccgagtctgggcggggg CRISPR spacer
cccacgaagcccccgtccgagtctgggcggggg Protospacer
*********************************
191. spacer 8.4|57260|33|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cccacgaagcccccgtccgagtctgggcggggg CRISPR spacer
cccacgaagcccccgtccgagtctgggcggggg Protospacer
*********************************
192. spacer 8.4|57260|33|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cccacgaagcccccgtccgagtctgggcggggg CRISPR spacer
cccacgaagcccccgtccgagtctgggcggggg Protospacer
*********************************
193. spacer 8.4|57260|33|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cccacgaagcccccgtccgagtctgggcggggg CRISPR spacer
cccacgaagcccccgtccgagtctgggcggggg Protospacer
*********************************
194. spacer 8.5|57322|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
aggttcccgtactggcggagcggcaggccgaa CRISPR spacer
aggttcccgtactggcggagcggcaggccgaa Protospacer
********************************
195. spacer 8.5|57322|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
aggttcccgtactggcggagcggcaggccgaa CRISPR spacer
aggttcccgtactggcggagcggcaggccgaa Protospacer
********************************
196. spacer 8.6|57383|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gtctggcccaactggtgccaggatcatcccca CRISPR spacer
gtctggcccaactggtgccaggatcatcccca Protospacer
********************************
197. spacer 8.6|57383|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gtctggcccaactggtgccaggatcatcccca CRISPR spacer
gtctggcccaactggtgccaggatcatcccca Protospacer
********************************
198. spacer 8.7|57444|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
caaggtgtcagcacgagacacaggggaggcca CRISPR spacer
caaggtgtcagcacgagacacaggggaggcca Protospacer
********************************
199. spacer 8.7|57444|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
caaggtgtcagcacgagacacaggggaggcca CRISPR spacer
caaggtgtcagcacgagacacaggggaggcca Protospacer
********************************
200. spacer 8.8|57505|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggcggccagtgcgttgaggtcgccaccaacct CRISPR spacer
ggcggccagtgcgttgaggtcgccaccaacct Protospacer
********************************
201. spacer 8.8|57505|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggcggccagtgcgttgaggtcgccaccaacct CRISPR spacer
ggcggccagtgcgttgaggtcgccaccaacct Protospacer
********************************
202. spacer 8.9|57566|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
cgggcccggtcaccttccagtccctcttccaa CRISPR spacer
cgggcccggtcaccttccagtccctcttccaa Protospacer
********************************
203. spacer 8.9|57566|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
cgggcccggtcaccttccagtccctcttccaa CRISPR spacer
cgggcccggtcaccttccagtccctcttccaa Protospacer
********************************
204. spacer 8.10|57627|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
********************************
205. spacer 8.10|57627|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
********************************
206. spacer 8.10|57627|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
********************************
207. spacer 8.10|57627|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
********************************
208. spacer 9.1|57912|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
accgcgaccttccggtggagggcgtgcagttc CRISPR spacer
accgcgaccttccggtggagggcgtgcagttc Protospacer
********************************
209. spacer 9.1|57912|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
accgcgaccttccggtggagggcgtgcagttc CRISPR spacer
accgcgaccttccggtggagggcgtgcagttc Protospacer
********************************
210. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ggccgcatcaccggccccggcttcgaactgcg CRISPR spacer
ggccgcatcaccggccccggcttcgaactgcg Protospacer
********************************
211. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ggccgcatcaccggccccggcttcgaactgcg CRISPR spacer
ggccgcatcaccggccccggcttcgaactgcg Protospacer
********************************
212. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
tgaccgcaggccgccgccacgtcgcgcgcctt Protospacer
********************************
213. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
tgaccgcaggccgccgccacgtcgcgcgcctt Protospacer
********************************
214. spacer 9.4|58095|31|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gacgcgctcgtgaaggtggccaagcagtacc CRISPR spacer
gacgcgctcgtgaaggtggccaagcagtacc Protospacer
*******************************
215. spacer 9.4|58095|31|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gacgcgctcgtgaaggtggccaagcagtacc CRISPR spacer
gacgcgctcgtgaaggtggccaagcagtacc Protospacer
*******************************
216. spacer 9.5|58155|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
tacgagaacggccgctccgagccgaagtcgcc CRISPR spacer
tacgagaacggccgctccgagccgaagtcgcc Protospacer
********************************
217. spacer 9.5|58155|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
tacgagaacggccgctccgagccgaagtcgcc CRISPR spacer
tacgagaacggccgctccgagccgaagtcgcc Protospacer
********************************
218. spacer 9.5|58155|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 0, identity: 1.0
tacgagaacggccgctccgagccgaagtcgcc CRISPR spacer
tacgagaacggccgctccgagccgaagtcgcc Protospacer
********************************
219. spacer 9.6|58216|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gaccctggtaccggatcaccgaccggtaccag CRISPR spacer
gaccctggtaccggatcaccgaccggtaccag Protospacer
********************************
220. spacer 9.6|58216|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gaccctggtaccggatcaccgaccggtaccag CRISPR spacer
gaccctggtaccggatcaccgaccggtaccag Protospacer
********************************
221. spacer 9.7|58277|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgactcgggccgccatcgaacgtgccgaggc CRISPR spacer
gcgactcgggccgccatcgaacgtgccgaggc Protospacer
********************************
222. spacer 9.7|58277|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgactcgggccgccatcgaacgtgccgaggc CRISPR spacer
gcgactcgggccgccatcgaacgtgccgaggc Protospacer
********************************
223. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gaaggcgcgatggccggacgccgggcgatcga Protospacer
********************************
224. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gaaggcgcgatggccggacgccgggcgatcga Protospacer
********************************
225. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ccgccgacgatcaggccgaacgtgccggtcag Protospacer
********************************
226. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ccgccgacgatcaggccgaacgtgccggtcag Protospacer
********************************
227. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gcgggtgggtcgccgccgaccggcgcaccgcc Protospacer
********************************
228. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gcgggtgggtcgccgccgaccggcgcaccgcc Protospacer
********************************
229. spacer 9.11|58521|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gactctgggaccacgatggtggtcaacgtcct CRISPR spacer
gactctgggaccacgatggtggtcaacgtcct Protospacer
********************************
230. spacer 9.11|58521|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gactctgggaccacgatggtggtcaacgtcct CRISPR spacer
gactctgggaccacgatggtggtcaacgtcct Protospacer
********************************
231. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
catttcgatccagagcacgccggccgccgcca CRISPR spacer
catttcgatccagagcacgccggccgccgcca Protospacer
********************************
232. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
catttcgatccagagcacgccggccgccgcca CRISPR spacer
catttcgatccagagcacgccggccgccgcca Protospacer
********************************
233. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gccctgcaccaccaccatttcgtcggccggcg Protospacer
********************************
234. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gccctgcaccaccaccatttcgtcggccggcg Protospacer
********************************
235. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
atcacccccgtgccgaacacgccgacgtcggt Protospacer
********************************
236. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
atcacccccgtgccgaacacgccgacgtcggt Protospacer
********************************
237. spacer 10.1|86893|60|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0
tgggagggagaccgtggtgggcaaggttgcgggcaaggcccgcatcaagacctaccgcgg CRISPR spacer
tgggagggagaccgtggtgggcaaggttgcgggcaaggcccgcatcaagacctaccgcgg Protospacer
************************************************************
238. spacer 10.1|86893|60|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0
tgggagggagaccgtggtgggcaaggttgcgggcaaggcccgcatcaagacctaccgcgg CRISPR spacer
tgggagggagaccgtggtgggcaaggttgcgggcaaggcccgcatcaagacctaccgcgg Protospacer
************************************************************
239. spacer 3.1|51817|32|NC_017766|CRISPRCasFinder matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
ccgccctgccccgcctgagctcgaacgtgccg Protospacer
******************** ***********
240. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggtggcgcgcaccgtcgccgacacccacga Protospacer
****.***************************
241. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 1, identity: 0.969
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcggcgcgcaccgtcgccgacacccatga Protospacer
*****************************.**
242. spacer 5.3|54942|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969
cgggcccggtcaccttccagtccctcgtccaa CRISPR spacer
cgggcccggtcaccttccagtccctcttccaa Protospacer
************************** *****
243. spacer 5.3|54942|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969
cgggcccggtcaccttccagtccctcgtccaa CRISPR spacer
cgggcccggtcaccttccagtccctcttccaa Protospacer
************************** *****
244. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to MH834623 (Arthrobacter phage Peas, complete genome) position: , mismatch: 1, identity: 0.969
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac Protospacer
******.*************************
245. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NC_048094 (Arthrobacter phage Eileen, complete genome) position: , mismatch: 1, identity: 0.969
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac Protospacer
******.*************************
246. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to MH834605 (Arthrobacter phage Constance, complete genome) position: , mismatch: 1, identity: 0.969
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac Protospacer
******.*************************
247. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NC_048095 (Arthrobacter phage Judy, complete genome) position: , mismatch: 1, identity: 0.969
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac Protospacer
******.*************************
248. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to MH834603 (Arthrobacter phage Bridgette, complete genome) position: , mismatch: 1, identity: 0.969
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac Protospacer
******.*************************
249. spacer 6.9|55715|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac Protospacer
***.****************************
250. spacer 6.9|55715|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac Protospacer
***.****************************
251. spacer 7.26|56792|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969
gggacacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
***.****************************
252. spacer 7.26|56792|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969
gggacacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
***.****************************
253. spacer 7.26|56792|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969
gggacacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
***.****************************
254. spacer 7.26|56792|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969
gggacacccttcgctgtcggcagcgtctggac CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac Protospacer
***.****************************
255. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 1, identity: 0.969
atcgagaatcatttcgtcgtcgaccccgcgaa CRISPR spacer
atcgagaatcatttcgtggtcgaccccgcgaa Protospacer
***************** **************
256. spacer 8.9|57566|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969
cgggcccggtcaccttccagtccctcttccaa CRISPR spacer
cgggcccggtcaccttccagtccctcgtccaa Protospacer
************************** *****
257. spacer 8.9|57566|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969
cgggcccggtcaccttccagtccctcttccaa CRISPR spacer
cgggcccggtcaccttccagtccctcgtccaa Protospacer
************************** *****
258. spacer 8.10|57627|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac Protospacer
***.****************************
259. spacer 8.10|57627|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac Protospacer
***.****************************
260. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 1, identity: 0.969
catttcgatccagagcacgccggccgccgcca CRISPR spacer
catctcgatccagagcacgccggccgccgcca Protospacer
***.****************************
261. spacer 7.18|56305|31|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP043961 (Streptomyces tendae strain 139 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.935
gccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
gccacaagcacgacctgttcgagaacaaggc Protospacer
******* *.*********************
262. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.938
atcgagaatcatttcgtcgtcgaccccgcgaa CRISPR spacer
atcgagaaccatttcgtcgtcgatcccgcgaa Protospacer
********.**************.********
263. spacer 9.5|58155|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.938
tacgagaacggccgctccgagccgaagtcgcc CRISPR spacer
tgggagaacggccgctccgagccgaagtcgcc Protospacer
*. *****************************
264. spacer 9.5|58155|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.938
tacgagaacggccgctccgagccgaagtcgcc CRISPR spacer
tacgagaacggccgctcggaaccgaagtcgcc Protospacer
***************** **.***********
265. spacer 9.5|58155|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938
tacgagaacggccgctccgagccgaagtcgcc CRISPR spacer
tgggagaacggccgctccgagccgaagtcgcc Protospacer
*. *****************************
266. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 3, identity: 0.906
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gcggcggcgcgtaccgtcgccgacacccacga Protospacer
*********.********************
267. spacer 3.19|52178|37|NC_017766|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 3, identity: 0.919
atccccaggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
agggccaggcggcgcgcaccgtcgccgacacccacga Protospacer
* *********************************
268. spacer 3.19|52178|37|NC_017766|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.919
atccccaggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
agcagcaggcggcgcgcaccgtcgccgacacccacga Protospacer
* * ********************************
269. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 4, identity: 0.875
caggcggcg-cgcaccgtcgccgacacccacga CRISPR spacer
-atgcggcgacgcaccgtcgccgactccctcga Protospacer
* ****** *************** *** ***
270. spacer 3.13|51812|37|NC_017766|CRT matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 4, identity: 0.892
atccgccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
cctggccgccctgccccgcctgagcgcgaacgtgccg Protospacer
.. *********************************
271. spacer 3.19|52178|37|NC_017766|CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.892
atccccaggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
agggccaggtggcgcgcaccgtcgccgacacccacga Protospacer
* *****.***************************
272. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 5, identity: 0.844
cccgccgcgctcgccctggccac-tctgggcat CRISPR spacer
cccgcccggctcgccctggccacggccgggca- Protospacer
****** *************** *.*****
273. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 5, identity: 0.844
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gcggccgcgcgcaccgtcgccgacacgcacgc Protospacer
*** ******************** ****
274. spacer 3.13|51812|37|NC_017766|CRT matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.865
atccgccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
cctggccgccctgccccgcctgagctcgaacgtgccg Protospacer
.. ********************* ***********
275. spacer 3.19|52178|37|NC_017766|CRT matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 5, identity: 0.865
atccccaggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
aggagcaggcggcgcgcaccgtcgccgacacccatga Protospacer
* *****************************.**
276. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
cagttcatcgtcggcgtccgccaggac-atcac CRISPR spacer
caggtcatcgtctgcgtccgccatggcgatca- Protospacer
*** ******** ********** *.* ****
277. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.844
cagttcatcgtcggcgtccgccaggac-atcac CRISPR spacer
caggtcatcgtctgcgtccgccatggcgatca- Protospacer
*** ******** ********** *.* ****
278. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.844
tccggtcgtgcacgactgcgccgactgcggac- CRISPR spacer
tccggtcgcgcacggctgcgccga-ggcgaacg Protospacer
********.*****.********* ***.**
279. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
atcgagaatcatttcgtcgtcgaccccgcgaa CRISPR spacer
atcgagaaccacttcgtcgtcgacccgggcaa Protospacer
********.**.************** * **
280. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 5, identity: 0.844
ggccgcatcaccggccccggcttcgaactgcg- CRISPR spacer
cgccgcatcaccggccccggcgccg-accgcgg Protospacer
******************** .** **.***
281. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.844
ggccgcatcaccggccccggcttcgaactgcg- CRISPR spacer
cgccgcatcaccggccccggcgccg-accgcgg Protospacer
******************** .** **.***
282. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 5, identity: 0.844
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc Protospacer
*** .* *** ********************
283. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 5, identity: 0.844
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc Protospacer
*** .* *** ********************
284. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 5, identity: 0.844
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc Protospacer
*** .* *** ********************
285. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 5, identity: 0.844
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc Protospacer
*** .* *** ********************
286. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 5, identity: 0.844
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc Protospacer
*** .* *** ********************
287. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
288. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
289. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
290. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
291. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
292. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021803 (Sinorhizobium meliloti strain USDA1021 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
293. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
294. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
295. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
296. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
297. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
298. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_019313 (Sinorhizobium meliloti plasmid pHRC017, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
299. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.844
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ttgcggtt--gtcgccgccgaccggcgctgcgcc Protospacer
**** * ****************** ****
300. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
ctgaccgggctgaccggccgcgatgtcct Protospacer
* . ****** ************* ***
301. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 6, identity: 0.793
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
ctgaccgggctgaccggccgcgatgtcct Protospacer
* . ****** ************* ***
302. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 6, identity: 0.793
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
cgccgcgggctgaccggccgcgatggcaa Protospacer
**. ******* *************.*
303. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.793
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
ggcgtcgggctcgccggccgcgatcaccg Protospacer
*.* *******.*********** ***
304. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.793
cgtggcgggctcaccggccgcgatgacct-- CRISPR spacer
actggcgggctcgccggccgcga--gcctgc Protospacer
**********.********** .***
305. spacer 1.6|40597|30|NC_017766|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.8
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
ggcgtcgggctcgccggccgcgatcaccgc Protospacer
*.* *******.*********** *** *
306. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to MK801721 (Gordonia phage William, complete genome) position: , mismatch: 6, identity: 0.812
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
tccggcaggcgacggcgcaggaggttgtggcg Protospacer
* . *******************.*.*****
307. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_011003 (Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence) position: , mismatch: 6, identity: 0.812
tgttg-caggcgacggcgcaggagatcgtggct CRISPR spacer
-atcgtcaggcgacggcgccggcgatcgtggcc Protospacer
.*.* ************* ** *********.
308. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 6, identity: 0.812
tgttgcag--gcgacggcgcaggagatcgtggct CRISPR spacer
--tcgccgtcgcgacggcggaggagatcgaggct Protospacer
*.** * ********* ********* ****
309. spacer 2.7|51120|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812
--cagctcggcgcgcaggaacggtccgggctgcg CRISPR spacer
gtcggcc--gcgcgcaggaacaggccgggctgcg Protospacer
*.**. ************.* **********
310. spacer 2.7|51120|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007144 (Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence) position: , mismatch: 6, identity: 0.812
cagctcgg-cgcgcaggaacggtccgggctgcg CRISPR spacer
-aacgaggccgcgcaggaacggcccgagctgcg Protospacer
*.* ** *************.***.******
311. spacer 2.8|51181|32|NC_017766|CRISPRCasFinder,CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 6, identity: 0.812
cagtccaggccgtccttgatgtgaccgaccgt CRISPR spacer
acgtccaggccgtgcttgatgtggccgacgga Protospacer
*********** *********.***** *
312. spacer 2.8|51181|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 6, identity: 0.812
cagtccaggccgtccttgatgtgaccgaccgt CRISPR spacer
acgtccaggccgtgcttgatgtggccgacgga Protospacer
*********** *********.***** *
313. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
gtcgacgtcgcgttcgtgccgcgctc---cgcgtt CRISPR spacer
ggcgacgtcgccatcgtgccgcgctcgctcgc--- Protospacer
* ********* ************* ***
314. spacer 2.14|51547|32|NC_017766|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
ccttgaccttgacgaccttcatcgacacccgg Protospacer
*********** *********** * * **
315. spacer 2.14|51547|32|NC_017766|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
ccttgaccttgacgaccttcatcgacacccgg Protospacer
*********** *********** * * **
316. spacer 2.14|51547|32|NC_017766|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 6, identity: 0.812
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
ccttgaccttgtcgaactgcatctggttctgg Protospacer
*************** ** ***** * * **
317. spacer 3.2|51878|32|NC_017766|CRISPRCasFinder matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 6, identity: 0.812
tgcgggaggccatccgccgcgctg----tctgtgag CRISPR spacer
tgcgggagatcatccgccgcgctgaggctctg---- Protospacer
********..************** ****
318. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
gccgccgcgctcgccctggccccgctggccga Protospacer
******************** * **** *.
319. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 6, identity: 0.812
caggcggcgcgcaccgtcgccgacacccacga- CRISPR spacer
cgggcggcgggcagcgtcgccgaca-gcatgac Protospacer
*.******* *** *********** **.**
320. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 6, identity: 0.812
caggcggcgcgcaccgtcgccgacacccacga- CRISPR spacer
tcgacgccgcgcaccgtcgccgtca-ccacgag Protospacer
. *.** *************** ** ******
321. spacer 3.8|52244|32|NC_017766|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.812
gagctgtgcaccgccacgatcaacgaccgacg CRISPR spacer
gcggtgtgcaccccgacgatcaacgaccgggg Protospacer
* * ******** * **************. *
322. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.806
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tggcgctcgtggtggccgaacggctgcgcgc Protospacer
. ** ********************** *
323. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.806
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
cggccctggtggtggccgaacggcggcgcca Protospacer
* *** **************** *****
324. spacer 3.19|52178|37|NC_017766|CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 6, identity: 0.838
atccccaggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
agacggcggcggcgcgtaccgtcgccgacacccacga Protospacer
* * *********.********************
325. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcagc-tcgcaccgccgggcggcgcggac CRISPR spacer
-tgcgcaccgtcgcaccgccgagcggcgcagac Protospacer
.** ** * ***********.*******.***
326. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 6, identity: 0.812
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cgcgtcatcatcggcgtccgccaggacatcca Protospacer
*. *****.********************
327. spacer 7.5|56243|33|NC_017766|PILER-CR matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.818
ctccggtcgtgcacgactgcgccgactgcggac- CRISPR spacer
gtccggtcgcgcacggctgcgccga-ggcgaacg Protospacer
********.*****.********* ***.**
328. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
tcgaagcaggccgccgccccggcgcgcgcctt Protospacer
* . ************* ** **********
329. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812
tgaccgcag--gccgccgccacgtcgcgcgcctt CRISPR spacer
--agcgccgccgccgccgccccgtcgcgcgcgtt Protospacer
* *** * ********* ********** **
330. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to EU307292 (Burkholderia phage Bups phi1 clone 2 partial sequence) position: , mismatch: 6, identity: 0.812
-tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
atga-agcaggccgccgacatgtcgcgcgcgct Protospacer
*** *********** **.********* .*
331. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
--tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
ctcgcccgc--gccgccgccaccgcgcgcgcctt Protospacer
.* **** *********** **********
332. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.812
tgaccgc-aggccgccgccacgtcgcgcgcctt CRISPR spacer
-gaccccgaggccgccgccaccgcgcgcgccga Protospacer
**** * ************* ********
333. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.812
--tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
ctcgcccgc--gccgccgccaccgcgcgcgcctt Protospacer
.* **** *********** **********
334. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP033585 (Streptomyces sp. ADI95-16 plasmid pADI95-16d, complete sequence) position: , mismatch: 6, identity: 0.812
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gagcaggcgatggcgggccgccgggcgatcga Protospacer
**. . ******** ** **************
335. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.812
gaaggcgcgatggccggacgccgggcgatcga- CRISPR spacer
caaggcgctctggccggacgcc-ggcgatggcg Protospacer
******* ************ ****** *
336. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.812
gaaggcgcgatggccggacgccgggcgatcga- CRISPR spacer
caaggcgctctggccggacgcc-ggcgatggcg Protospacer
******* ************ ****** *
337. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 6, identity: 0.812
--gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
ccgaag--tcgaaggccggacgccggacgatcaa Protospacer
**** *** *************.*****.*
338. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812
ccgccg--acgatcaggccgaacgtgccggtcag CRISPR spacer
--gccggagcggtcaggccgaacgtgccggccat Protospacer
**** .**.******************.**
339. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgccgac-gatcaggccgaacgtgccggtcag CRISPR spacer
-ggcggatggatcaggcccagcgtgccggtcag Protospacer
** **. ********* *.************
340. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgccgac-gatcaggccgaacgtgccggtcag CRISPR spacer
-ggcggatggatcaggcccagcgtgccggtcag Protospacer
** **. ********* *.************
341. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to JQ680376 (Unidentified phage clone 2209_scaffold1451 genomic sequence) position: , mismatch: 6, identity: 0.812
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ccgccgatgatcacgccgaacgtggtcgtccg Protospacer
*******.***** ********** . *** *
342. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgccgacg-atcaggccgaacgtgccggtcag CRISPR spacer
-ggcggatgaatcaggcccagcgtgccggtcag Protospacer
** **.* ******** *.************
343. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_006571 (Streptomyces albulus plasmid pNO33 DNA, complete sequence) position: , mismatch: 6, identity: 0.812
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ccggccgcatcgccgccgaccgccgcaccgcc Protospacer
*** .* .************* *********
344. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 6, identity: 0.812
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ccggccgattcgccgccgaccggctcaccgcc Protospacer
*** .*. *************** *******
345. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 6, identity: 0.812
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccacc Protospacer
*** .* *** *****************.**
346. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.812
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgctgg-aggtcgacgccgaccgccgcaccgtc Protospacer
** ** .***** ********* *******.*
347. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 6, identity: 0.812
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgctgg-aggtcgacgccgaccgccgcaccgtc Protospacer
** ** .***** ********* *******.*
348. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 6, identity: 0.812
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgctgg-aggtcgacgccgaccgccgcaccgtc Protospacer
** ** .***** ********* *******.*
349. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.759
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
aaaaccggcctcaccggccgcgacgacct Protospacer
. . *** **************.*****
350. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.759
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
gagttcggtgtcaccggccgcgatgacct Protospacer
. *** *******************
351. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.759
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
acgggcgtgctcaccggccgcgatccccg Protospacer
**** **************** **
352. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.759
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
cttggcgggctcaccggccacgacgcggg Protospacer
* *****************.***.*
353. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.759
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
gcaggctggctccccggccgcgatgagca Protospacer
*** ***** ************* *
354. spacer 1.4|40717|31|NC_017766|CRISPRCasFinder matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 7, identity: 0.774
cgggttgcgggggcgtggatggtcgtggtca CRISPR spacer
cgacatgcgggcgcgtggatggtcttggccc Protospacer
**. ****** ************ ***.*
355. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
cgcatcgccggccttgtcgatgcgcttcgtg Protospacer
* . *.* *********.********** **
356. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 7, identity: 0.774
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
ccgttcggtggccttgtcgatgcgcttctgg Protospacer
*. .*.**.********.*********** *
357. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.774
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
cgcatcgccggccttgtcgatgcgcttcgtg Protospacer
* . *.* *********.********** **
358. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.767
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
aaaaccggcctcaccggccgcgacgacctc Protospacer
. . *** **************.******
359. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
ctgaccgggctgaccggccgcgatgtcctg Protospacer
* . ****** ************* ***
360. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 7, identity: 0.767
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
ctgaccgggctgaccggccgcgatgtcctg Protospacer
* . ****** ************* ***
361. spacer 1.6|40597|30|NC_017766|CRT matches to NC_014839 (Pantoea sp. At-9b plasmid pPAT9B02, complete sequence) position: , mismatch: 7, identity: 0.767
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
tgaagacggctcaccggccgccgtgacctc Protospacer
.* .* ************** .*******
362. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
acgggcgtgctcaccggccgcgatccccgc Protospacer
**** **************** ** *
363. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
cttggcgggctcaccggccacgacgcgggc Protospacer
* *****************.***.* *
364. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 7, identity: 0.767
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
cgccgcgggctgaccggccgcgatggcaag Protospacer
**. ******* *************.*
365. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
cgcatcgccggccttgtcgatgcgcttcgtgt Protospacer
* . *.* *********.********** ***
366. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
cgcatcgccggccttgtcgatgcgcttcgtgt Protospacer
* . *.* *********.********** ***
367. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 7, identity: 0.781
tgttgca-ggcgacggcgcaggagatcgtggct CRISPR spacer
-acagcatggcgacggcgcaggagatggaggcc Protospacer
.. *** ****************** * ***.
368. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
-tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
acggtg-acgcgacggcgctggcgatcgtggcc Protospacer
.* ** * ********** ** *********.
369. spacer 2.8|51181|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cagtccaggccgtccttgatgtgaccgaccgt CRISPR spacer
tgacccaggccgtcctcgatgagaccgaccgc Protospacer
....************.**** *********.
370. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to KU160671 (Arthrobacter phage Vulture, complete genome) position: , mismatch: 7, identity: 0.781
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
ggggccaggatcgtcggccagcgcgccgggga Protospacer
*.**. *** *********** ******* .*
371. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to KU160648 (Arthrobacter phage HunterDalle, complete genome) position: , mismatch: 7, identity: 0.781
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
ggggccaggatcgtcggccagcgcgccgggga Protospacer
*.**. *** *********** ******* .*
372. spacer 3.1|51817|32|NC_017766|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.781
ccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
ccgccctgccccgtctcagcgcggcggatccg Protospacer
*************.** ******. * ***
373. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 7, identity: 0.781
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
agatgcagacgctccagctcgccgccgacggc Protospacer
** ************ *********. ** .
374. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 7, identity: 0.781
agttgcagacgctcccgctcgccgct-caccag CRISPR spacer
cgcggcagacgctctggctcgccgctccaaca- Protospacer
*. **********. ********** ** **
375. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 7, identity: 0.781
agttgcagacgctcccgctcgccgct-caccag CRISPR spacer
cgcggcagacgctctggctcgccgctccaaca- Protospacer
*. **********. ********** ** **
376. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 7, identity: 0.781
cccgccgcgctcgccctggcca---ctctgggcat CRISPR spacer
gccgccgccctcgccctggccactgctacggg--- Protospacer
******* ************* ** .***
377. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 7, identity: 0.781
cccgccgcgctcgccctggcca---ctctgggcat CRISPR spacer
gccgccgccctcgccctggccactgctacggg--- Protospacer
******* ************* ** .***
378. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.781
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
cccgccgggctggccctggccacctcggacaa Protospacer
******* *** ***********...**.**
379. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.781
ctgaacttcggcaaggcggtcggtgcacgctg- CRISPR spacer
tacaacttcggcaaggcggccggtgc-cgtcgc Protospacer
. ****************.****** **..*
380. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 7, identity: 0.781
caggcg-gcgcgcaccgtcgccgacacccacga CRISPR spacer
-gtgcgtatgcgcaccgtcgccgacacgctcga Protospacer
. *** ..****************** * ***
381. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 7, identity: 0.781
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcagcgcgcaccgccgccgacgctctcac Protospacer
*****.**********.*******.*.* *.
382. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 7, identity: 0.781
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggccgtgcgcaccgtcgccgacggccgccc Protospacer
***** *.****************. **.*
383. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.781
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcggcgctcaccgtcgtcgaagctgccga Protospacer
********** ********.*** .*. ***
384. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774
--ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tgctgc--gcgtggtggccgagcggctgcgcgg Protospacer
*.** .************.*********
385. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tggcgctcgtggtggccgagcggctgcgcgc Protospacer
. ** ************.********* *
386. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tggcgctcgtggtggccgagcggctgcgcgc Protospacer
. ** ************.********* *
387. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tggcgctcgtggtggccgagcggctgcgcgc Protospacer
. ** ************.********* *
388. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tggcgctcgtggtggccgagcggctgcgcgc Protospacer
. ** ************.********* *
389. spacer 3.11|52426|32|NC_017766|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.781
tggcggtg-catgcccgtgctcaccggcgccag CRISPR spacer
-gacgaagccatcaccgtgctcaccggcgccac Protospacer
*.**. * *** ******************
390. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to MN813681 (Mycobacterium phage Roary, complete genome) position: , mismatch: 7, identity: 0.781
--ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat Protospacer
**.** ** *****************.**
391. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to KT184694 (Mycobacterium phage Smeadley, complete genome) position: , mismatch: 7, identity: 0.781
--ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat Protospacer
**.** ** *****************.**
392. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to MK524492 (Mycobacterium phage Expelliarmus, complete genome) position: , mismatch: 7, identity: 0.781
--ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat Protospacer
**.** ** *****************.**
393. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to MH825708 (Mycobacterium phage NearlyHeadless, complete genome) position: , mismatch: 7, identity: 0.781
--ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat Protospacer
**.** ** *****************.**
394. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NC_022753 (Mycobacterium phage Fredward, complete genome) position: , mismatch: 7, identity: 0.781
--ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat Protospacer
**.** ** *****************.**
395. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to MH651173 (Mycobacterium phage Dixon, complete genome) position: , mismatch: 7, identity: 0.781
--ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat Protospacer
**.** ** *****************.**
396. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to MT310857 (Mycobacterium phage Danforth, complete genome) position: , mismatch: 7, identity: 0.781
--ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat Protospacer
**.** ** *****************.**
397. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to JX015524 (Mycobacterium virus Astro, complete genome) position: , mismatch: 7, identity: 0.781
--ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat Protospacer
**.** ** *****************.**
398. spacer 4.3|53132|32|NC_017766|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 7, identity: 0.781
ccagggaccgcgtcgtcagcggccacaccccg CRISPR spacer
ggatcgaccgcgtcgtcagcggcctcatccag Protospacer
* ******************* **.** *
399. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 7, identity: 0.781
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
ccgacgggctcgccccgcagggcggcgcggat Protospacer
*** . .****** **** ************.
400. spacer 6.6|55532|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781
aaggtgacgagctggcccggcctgctcgccgt CRISPR spacer
taccgggcgagctggcccggcccgctggccgt Protospacer
* *.***************.*** *****
401. spacer 6.6|55532|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 7, identity: 0.781
aaggtga---cgagctggcccggcctgctcgccgt CRISPR spacer
---gtcaattcgaactggaccggcctgctcgccgc Protospacer
** * ***.**** ***************.
402. spacer 6.6|55532|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 7, identity: 0.781
aaggtga---cgagctggcccggcctgctcgccgt CRISPR spacer
---gtcaattcgaactggaccggcctgctcgccgc Protospacer
** * ***.**** ***************.
403. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 7, identity: 0.781
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac Protospacer
*.* * * *****.*****.***********
404. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 7, identity: 0.781
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac Protospacer
*.* * * *****.*****.***********
405. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 7, identity: 0.781
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac Protospacer
*.* * * *****.*****.***********
406. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 7, identity: 0.781
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac Protospacer
*.* * * *****.*****.***********
407. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to MF140411 (Mycobacterium phage Findley, complete genome) position: , mismatch: 7, identity: 0.781
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac Protospacer
*.* * * *****.*****.***********
408. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510962 (Pseudomonas phage CF3, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
409. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510987 (Pseudomonas phage BR233, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
410. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
411. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510974 (Pseudomonas phage CF140, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
412. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to NC_007805 (Pseudomonas phage F10, complete genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
413. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510978 (Pseudomonas phage CF208, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
414. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510988 (Pseudomonas phage BR299, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
415. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510976 (Pseudomonas phage CF165, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
416. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
417. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510992 (Pseudomonas phage BR144, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
418. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510975 (Pseudomonas phage CF145, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
419. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to MK510986 (Pseudomonas phage BR213, partial genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
420. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to DQ163912 (Bacteriophage F10, complete genome) position: , mismatch: 7, identity: 0.781
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa Protospacer
.** * .*******.*********.******
421. spacer 7.1|55999|33|NC_017766|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
cctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
cttcgtcgggttcgccgaggaggtgcggcagca Protospacer
*.*** *************.****** .** *
422. spacer 7.1|55999|33|NC_017766|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
cctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
cttcgtcgggttcgccgaggaggtgcggcagca Protospacer
*.*** *************.****** .** *
423. spacer 7.1|55999|33|NC_017766|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
cctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
cttcgtcgggttcgccgaggaggtgcggcagca Protospacer
*.*** *************.****** .** *
424. spacer 7.1|55999|33|NC_017766|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
cctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
cttcgtcgggttcgccgaggaggtgcggcagca Protospacer
*.*** *************.****** .** *
425. spacer 7.1|55999|33|NC_017766|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
cctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
cttcgtcgggttcgccgaggaggtgcggcagca Protospacer
*.*** *************.****** .** *
426. spacer 7.6|56304|40|NC_017766|PILER-CR matches to NZ_CP043961 (Streptomyces tendae strain 139 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.825
atggtcccggccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
gcggcaacggccacaagcacgacctgttcgagaacaaggc Protospacer
..**. ********* *.*********************
427. spacer 7.12|56677|33|NC_017766|PILER-CR matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
cggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
cggcagaccagggcgatgcgcgagctgagcgcc Protospacer
******************** **.*** *
428. spacer 7.12|56677|33|NC_017766|PILER-CR matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 7, identity: 0.788
cggcagaccagggcgatgcgggaactgtcccgg-- CRISPR spacer
cggcagaccaggacgatgctggaa--gccagggcg Protospacer
************.****** **** *.* **
429. spacer 7.12|56677|33|NC_017766|PILER-CR matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.788
cggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
cgtccagccagggcgatgcgggaatagtccccg Protospacer
** * ..*****************. ***** *
430. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca Protospacer
.*** *************.****** .** *
431. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca Protospacer
.*** *************.****** .** *
432. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca Protospacer
.*** *************.****** .** *
433. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca Protospacer
.*** *************.****** .** *
434. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca Protospacer
.*** *************.****** .** *
435. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc- CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca Protospacer
*********** ***** ***** .*** *
436. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc- CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca Protospacer
*********** ***** ***** .*** *
437. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc- CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca Protospacer
*********** ***** ***** .*** *
438. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc- CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca Protospacer
*********** ***** ***** .*** *
439. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781
ctcgacgggttcgccgagaaggtgctacaccc- CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca Protospacer
*********** ***** ***** .*** *
440. spacer 7.18|56305|31|NC_017766|CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 7, identity: 0.774
gccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
agggctatcgcgacctgttcgagaacccggc Protospacer
. .* ******************** ***
441. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MH590604 (Microbacterium phage ColaCorta, complete genome) position: , mismatch: 7, identity: 0.781
-cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca Protospacer
.*** * ****** ***.************
442. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MT553340 (Microbacterium phage Glamour, complete genome) position: , mismatch: 7, identity: 0.781
-cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca Protospacer
.*** * ****** ***.************
443. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MN096378 (Microbacterium phage MCubed, complete genome) position: , mismatch: 7, identity: 0.781
-cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca Protospacer
.*** * ****** ***.************
444. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MH513982 (Microbacterium phage Sansa, complete genome) position: , mismatch: 7, identity: 0.781
-cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca Protospacer
.*** * ****** ***.************
445. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MK894432 (Microbacterium phage Finny, complete genome) position: , mismatch: 7, identity: 0.781
-cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca Protospacer
.*** * ****** ***.************
446. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MH590606 (Microbacterium phage Andromedas, complete genome) position: , mismatch: 7, identity: 0.781
-cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca Protospacer
.*** * ****** ***.************
447. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MG839027 (Microbacterium phage Eleri, complete genome) position: , mismatch: 7, identity: 0.781
-cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca Protospacer
.*** * ****** ***.************
448. spacer 7.21|56487|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781
gccacggcctcccggccggagagcttgtgccg CRISPR spacer
gccacggcgtcccggccggtgagcacccggcg Protospacer
******** ********** **** . .* **
449. spacer 7.21|56487|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781
gccacggcctcccggccggagagcttgtgccg CRISPR spacer
gccacggcgtcccggccggtgagcacccggcg Protospacer
******** ********** **** . .* **
450. spacer 7.22|56548|32|NC_017766|CRISPRCasFinder,CRT matches to MK494108 (Mycobacterium phage Charm, complete genome) position: , mismatch: 7, identity: 0.781
gcgtcgtagaggcggcgatcgttgctgccctg--- CRISPR spacer
tcgtcgtagaggccgcgaccgttggt---ctgggc Protospacer
************ ****.***** * ***
451. spacer 7.22|56548|32|NC_017766|CRISPRCasFinder,CRT matches to MN585974 (Mycobacterium phage DreamTeam1, complete genome) position: , mismatch: 7, identity: 0.781
gcgtcgtagaggcggcgatcgttgctgccctg--- CRISPR spacer
tcgtcgtagaggccgcgaccgttggt---ctgggc Protospacer
************ ****.***** * ***
452. spacer 7.24|56670|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
ggcagaccagggcgatgcgcgagctgagcgcc Protospacer
******************* **.*** *
453. spacer 7.24|56670|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.781
ggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
gtccagccagggcgatgcgggaatagtccccg Protospacer
* * ..*****************. ***** *
454. spacer 7.24|56670|32|NC_017766|CRISPRCasFinder,CRT matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 7, identity: 0.781
ggcagaccagggcgatgcgggaactgtcccgg-- CRISPR spacer
ggcagaccaggacgatgctggaa--gccagggcg Protospacer
***********.****** **** *.* **
455. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032827 (Sphingomonas sp. YZ-8 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
atcgagaa-----tcatttcgtcgtcgaccccgcgaa CRISPR spacer
-----gaagcccttcatgtcgtcgtcgaccccgagaa Protospacer
*** **** *************** ***
456. spacer 8.5|57322|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046903 (Pseudomonas stutzeri strain PM101005 plasmid p1_PM101005, complete sequence) position: , mismatch: 7, identity: 0.781
aggttcccgtactggcggagcggcaggccgaa CRISPR spacer
cgatttgcgaactggcggagtggcaggccgca Protospacer
*.**. ** **********.********* *
457. spacer 8.6|57383|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_001387 (Streptomyces lividans plasmid pIJ101, complete sequence) position: , mismatch: 7, identity: 0.781
gtctggcccaactggtgccaggatcatcccca CRISPR spacer
ctctggcccgattggtgccaggattcccacca Protospacer
********.*.************. .* ***
458. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to MN585994 (Mycobacterium phage SheaKeira, complete genome) position: , mismatch: 7, identity: 0.781
-ggccgcatcaccggccccggcttcgaactgcg CRISPR spacer
ggggcgt-tcaacggccccggctccgaactgta Protospacer
** **. *** ***********.*******..
459. spacer 9.4|58095|31|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
gacgcgctcgtgaaggtggccaagcagtacc CRISPR spacer
aacgcgctcatgaaggtggcgaagcgggccg Protospacer
.********.********** ****.* *
460. spacer 9.4|58095|31|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 7, identity: 0.774
gacgcgctcgtgaaggtggccaagcagtacc CRISPR spacer
ggcgacgtcgtgaaggtggccaacctgtact Protospacer
*.** **************** * ****.
461. spacer 9.4|58095|31|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to LR606149 (Rhizobium sp. Q54 genome assembly, plasmid: 6) position: , mismatch: 7, identity: 0.774
gacgcgctcgtgaaggtggccaagcagtacc CRISPR spacer
gacgcgctcgtggagctggccaatgactcac Protospacer
************.** ******* * * *
462. spacer 9.6|58216|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gaccctggt--accggatcaccgaccggtaccag CRISPR spacer
--cccgcattaaccggatcatcgatcggtaccag Protospacer
*** .* *********.***.*********
463. spacer 9.7|58277|32|NC_017766|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.781
gcgac-tcgggccgccatcgaacgtgccgaggc CRISPR spacer
-cgccgccaggccgccatcgaccgtggcgagga Protospacer
** * .*.************ **** *****
464. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021375 (Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence) position: , mismatch: 7, identity: 0.781
gaaggcgcgatggccggacgccgggcgatcga- CRISPR spacer
caaggcgctctggccggacgccgga-gatggcg Protospacer
******* **************. *** *
465. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
gcgccgaccatcaggccgaacgcgccaaggag Protospacer
******* *************.***.. **
466. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
gcgccgaccatcaggccgaacgcgccaaggag Protospacer
******* *************.***.. **
467. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to MH727561 (Mycobacterium phage Serendipitous, complete genome) position: , mismatch: 7, identity: 0.781
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ccgatatggatcaggccgagcgtgctggtcag Protospacer
*** .. ***********.*****.******
468. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to MG711460 (Faecalibacterium phage FP_Mushu, complete genome) position: , mismatch: 7, identity: 0.781
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ccgccgatgatcacgccgaacgtggtcgcccg Protospacer
*******.***** ********** . *.* *
469. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 7, identity: 0.781
ccgccgacgatcaggccgaacgtgccggtcag-- CRISPR spacer
tggtcgacggtcaggccgaacgtgtcg--cagta Protospacer
. *.*****.**************.** ***
470. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ccgccggcgagcaggccgaacgtcacgccgag Protospacer
******.*** ************ ** . **
471. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 7, identity: 0.781
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gacgcatcgtctccgccgaccggcgcaccgcc Protospacer
* * *** ********************
472. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
acgccttcgtcgccgccgccctgcgcaccgcc Protospacer
.** * ********** ** **********
473. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tcgtggagttcgccgccgactggtgcaccgcc Protospacer
** * .* ***********.**.********
474. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP028569 (Acinetobacter pittii strain WCHAP005046 plasmid p1_005046, complete sequence) position: , mismatch: 7, identity: 0.781
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc Protospacer
***..* *** *********** *******
475. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP033559 (Acinetobacter nosocomialis strain 2012C01-137 plasmid p2012C01-137-2, complete sequence) position: , mismatch: 7, identity: 0.781
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc Protospacer
***..* *** *********** *******
476. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP033551 (Acinetobacter nosocomialis strain 2014S01-097 plasmid p2014S01-097-1, complete sequence) position: , mismatch: 7, identity: 0.781
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc Protospacer
***..* *** *********** *******
477. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP033546 (Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-1, complete sequence) position: , mismatch: 7, identity: 0.781
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc Protospacer
***..* *** *********** *******
478. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.781
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gcgacctgatcgccgccgacccgcgcgccgcc Protospacer
***. . *.************ ****.*****
479. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP044357 (Acinetobacter baumannii strain CAM180-1 plasmid pCAM180A, complete sequence) position: , mismatch: 7, identity: 0.781
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc Protospacer
***..* *** *********** *******
480. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 7, identity: 0.781
--gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgtcgggc--atcgccgccgacctgggcaccgcc Protospacer
****. .************ * ********
481. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP028139 (Acinetobacter baumannii strain NCIMB 8209 plasmid pAbNCIMB8209_134, complete sequence) position: , mismatch: 7, identity: 0.781
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc Protospacer
***..* *** *********** *******
482. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.781
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gatttcaatccagagcaagccggccgcgcgcg Protospacer
*****.********** ********* *.
483. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP017304 (Rhodococcus sp. YL-1 plasmid pYLL2 sequence) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgcag Protospacer
*. * *****.***************** *
484. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatgaccatgaccatttcgtcggccggcg Protospacer
*. * ****. *******************
485. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP050125 (Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg Protospacer
*. * *****.***************** .*
486. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatgaccatgaccatttcgtcggccggcg Protospacer
*. * ****. *******************
487. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg Protospacer
*. * *****.***************** .*
488. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg Protospacer
*. * *****.***************** .*
489. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg Protospacer
*. * *****.***************** .*
490. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg Protospacer
*. * *****.***************** .*
491. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.781
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
gtgcatcaccatcaccatttcgtccgccgggg Protospacer
*. * *****.************ ***** *
492. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 7, identity: 0.781
gccctgcac-caccaccatttcgtcggccggcg CRISPR spacer
-ctcgacgcgcaccaccatttcctcgggcggcg Protospacer
*.* .*.* ************ **** *****
493. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP009294 (Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence) position: , mismatch: 7, identity: 0.781
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
atcacccgcgtgccgaccacgccgcctacgtg Protospacer
******* ******** ******* * **
494. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 7, identity: 0.781
atcacccccgtgccgaacacgccga--cgtcggt CRISPR spacer
accaccgtcgtgccgaacacgccgaagcgctg-- Protospacer
*.**** .***************** **..*
495. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 7, identity: 0.781
atcacccccgtgccgaacacgccga--cgtcggt CRISPR spacer
accaccgtcgtgccgaacacgccgaagcgctg-- Protospacer
*.**** .***************** **..*
496. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 8, identity: 0.724
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
tatggcgggctcaccggcctcgacaaggc Protospacer
..***************** ***..* .
497. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 8, identity: 0.724
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
tatggcgggctcaccggcctcgacaaggc Protospacer
..***************** ***..* .
498. spacer 1.3|40656|31|NC_017766|CRISPRCasFinder matches to MH834602 (Microbacterium phage Brahms, complete genome) position: , mismatch: 8, identity: 0.742
agtgcctcgaagacgagggtggaggctgcgg CRISPR spacer
gggtcgccgtagacgagggtggcggctgcga Protospacer
.* * .** ************ *******.
499. spacer 1.3|40656|31|NC_017766|CRISPRCasFinder matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 8, identity: 0.742
agtgcctcgaagacgagggtggaggctgcgg CRISPR spacer
gggtcgccgtagacgagggtggcggctgcga Protospacer
.* * .** ************ *******.
500. spacer 1.3|40656|31|NC_017766|CRISPRCasFinder matches to MH834604 (Microbacterium phage Coltrane, complete genome) position: , mismatch: 8, identity: 0.742
agtgcctcgaagacgagggtggaggctgcgg CRISPR spacer
gggtcgccgtagacgagggtggcggctgcga Protospacer
.* * .** ************ *******.
501. spacer 1.3|40656|31|NC_017766|CRISPRCasFinder matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 8, identity: 0.742
agtgcctcgaagacgagggtggaggctgcgg CRISPR spacer
gggtcgccgtagacgagggtggcggctgcga Protospacer
.* * .** ************ *******.
502. spacer 1.4|40717|31|NC_017766|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742
cgggttgcgggggcgtggatggtcgtggtca CRISPR spacer
gtggacaggggggcggggaaggtcgtggtca Protospacer
** .. ******* *** ***********
503. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to KX815338 (Streptomyces phage Joe, complete genome) position: , mismatch: 8, identity: 0.742
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
gctgttgacggccttgttgatgcgctccagc Protospacer
.* ***.******************.*
504. spacer 1.6|40597|30|NC_017766|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 8, identity: 0.733
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
gagttcggtgtcaccggccgcgatgacctg Protospacer
. *** *******************
505. spacer 1.6|40597|30|NC_017766|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.733
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
gcaggctggctccccggccgcgatgagcag Protospacer
*** ***** ************* *
506. spacer 1.8|40717|32|NC_017766|CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75
cgggttgcgggggcgtggatggtcgtggtcat CRISPR spacer
gtggacaggggggcggggaaggtcgtggtcat Protospacer
** .. ******* *** ************
507. spacer 1.8|40717|32|NC_017766|CRT,PILER-CR matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 8, identity: 0.75
cgggttgcgggggcgtggatggtcgtggtcat CRISPR spacer
cgacatgcgggcgcgtggatggtcttggcccg Protospacer
**. ****** ************ ***.*
508. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 8, identity: 0.75
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
ccgttcggtggccttgtcgatgcgcttctgga Protospacer
*. .*.**.********.*********** *
509. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.75
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
acaagcaggcgacggcgcacgggatcgtgggg Protospacer
*************** *.********
510. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.75
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
acaagcaggcgacggcgcacgggatcgtgggg Protospacer
*************** *.********
511. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
ggcggacggcgacggcgtaggagatggtggcc Protospacer
*. * **********.******* *****.
512. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
ggcggacggcgacggcgtaggagatggtggcc Protospacer
*. * **********.******* *****.
513. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
-tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
gcgat-caggcggcggcgcaggagttcgtgcgc Protospacer
.* * ******.*********** ***** .
514. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017078 (Novosphingobium resinovorum strain SA1 plasmid pSA3, complete sequence) position: , mismatch: 8, identity: 0.75
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
cgccgcacgcgacggcgcaggagaacgcgccc Protospacer
.*..*** **************** **.* *.
515. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021031 (Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gtgcgccggcgagtcggccagggcgccggcag Protospacer
* * *** *******************.
516. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gtgcgccggcgagtcggccagggcgccggcag Protospacer
* * *** *******************.
517. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
518. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
519. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
520. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
521. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
522. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
523. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
524. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
525. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
526. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
527. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
528. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
529. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
530. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
531. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
532. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
533. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
534. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
535. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
536. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
537. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
538. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag Protospacer
* * * ********* *.***********.
539. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcggtgagccttgtcggccagggcggagacgg Protospacer
* ****** **.************* *.*..
540. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 8, identity: 0.75
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
tcggcgaggctcgtcggccggggcgatgtcga Protospacer
**.**************.***** .* *.*
541. spacer 2.12|51425|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP037915 (Sphingomonas sp. AAP5 plasmid p150, complete sequence) position: , mismatch: 8, identity: 0.75
gagtccgggctgtgggcgttgaagggctacaa CRISPR spacer
ccggccgcgctgtgggcgctgaagggctatcc Protospacer
* *** **********.**********.
542. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
gcgtgcgtcgcattcgtgccgcgctcggcgac Protospacer
*. .******.************** *** .
543. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
gtcgacgccgcgttcatgccgcgtccgctgct Protospacer
*******.*******.*******..* .*.*
544. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP027794 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
gcgagcatcgcgttcttgacgcgctccgcggt Protospacer
*. ..*.******** ** *********** *
545. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
gcggggctcgcgctcgagccgcgctccgcgct Protospacer
*. *. *****.*** *************.*
546. spacer 2.14|51547|32|NC_017766|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
tggcggctttttcgaccttcatctcgagcagg Protospacer
. .*.*.** ****************.****
547. spacer 2.14|51547|32|NC_017766|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
tggcggctttttcgaccttcatctcgagcagg Protospacer
. .*.*.** ****************.****
548. spacer 2.14|51547|32|NC_017766|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
ccttggccttggcgaccttcatcccttcgcgg Protospacer
*****.***** ***********.* **
549. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
ggctgctgacgctgccgctcgccgctcccgtc Protospacer
.*.*** ****** ************* *
550. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
caggccgcgctcgccctggccgccctcaccac Protospacer
* ******************.*.** . **.
551. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
caggccgcgctcgccctggccgccctcaccac Protospacer
* ******************.*.** . **.
552. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NC_017771 (Deinococcus gobiensis I-0 plasmid P3, complete sequence) position: , mismatch: 8, identity: 0.75
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
cccgatgcgctcgccctggccacaccgaccgc Protospacer
**** .***************** *.*. *..
553. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 8, identity: 0.75
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
caggccgcgctcgccctggccgccctcaccac Protospacer
* ******************.*.** . **.
554. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
caggccgcgctcgccctggccgccctcaccac Protospacer
* ******************.*.** . **.
555. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 8, identity: 0.75
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
cccgccgggctggccctggccacctccgacaa Protospacer
******* *** ***********... *.**
556. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to KU998247 (Gordonia phage Bachita, complete genome) position: , mismatch: 8, identity: 0.75
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
cccgccgcgcgcgcccgggccacacagtcgac Protospacer
********** ***** ****** * * *.
557. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 8, identity: 0.75
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gcgatggcacgcaccatcgccgacacccaaca Protospacer
*..***.******.************* *
558. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 8, identity: 0.75
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gcgatggcacgcaccatcgccgacacccaaca Protospacer
*..***.******.************* *
559. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 8, identity: 0.75
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gcgatggcacgcaccatcgccgacacccagca Protospacer
*..***.******.************* *
560. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
tcgtcgcggcccaccgtcgccgccacccacgc Protospacer
. * ** ** *********** ********
561. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.75
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
ctgacggtgcgcaccttcgccgacaccgtccg Protospacer
* *.***.******* *********** * .
562. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gaggcggcccgcaccgtcgacgacgtgcgcaa Protospacer
******* ********** ****.. *.*.*
563. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_011990 (Agrobacterium radiobacter K84 plasmid pAtK84b, complete sequence) position: , mismatch: 8, identity: 0.75
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
cgcgaggcgcgcaccgtcgactacacccgtaa Protospacer
*. * ************** * ******...*
564. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
aaagccgcgtggtggccgaacgggtgcgccg Protospacer
. * .**************** ******
565. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
cggaattcgtggtggacgaacggctgcgcga Protospacer
* * ******** *************
566. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
cggaattcgtggtggacgaacggctgcgcga Protospacer
* * ******** *************
567. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tggtcgccgtggtgtcggaacggctgcgcca Protospacer
. *.*. ******* * *************
568. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.742
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tggtcgccgtggtgtcggaacggctgcgcca Protospacer
. *.*. ******* * *************
569. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 8, identity: 0.742
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tggtcgccgtggtgtcggaacggctgcgcca Protospacer
. *.*. ******* * *************
570. spacer 3.11|52426|32|NC_017766|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.75
tggcggtgcatgcccgtgctcaccggc--gccag CRISPR spacer
aactggtggaggcccgtgctcaccggcaagcc-- Protospacer
. .**** * **************** ***
571. spacer 3.19|52178|37|NC_017766|CRT matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 8, identity: 0.784
atccccaggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
agagcgcggccgcgcgcaccgtcgccgacacgcacgc Protospacer
* * *** ******************** ****
572. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 8, identity: 0.75
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
acctacgaactcgaccacaccgacgccccgga Protospacer
. ..* **** **.****************.*
573. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 8, identity: 0.75
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
acctacgaactcgaccacaccgacgccccgga Protospacer
. ..* **** **.****************.*
574. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 8, identity: 0.75
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
acctacgaactcgaccacaccgacgccccgga Protospacer
. ..* **** **.****************.*
575. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 8, identity: 0.75
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
acctacgaactcgaccacaccgacgccccgga Protospacer
. ..* **** **.****************.*
576. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NZ_CP011453 (Altererythrobacter atlanticus strain 26DY36 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
ggtcagcaacgtggccacaccgaagatgccga Protospacer
****** ****.*********** * . * .*
577. spacer 4.2|53071|32|NC_017766|CRISPRCasFinder matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 8, identity: 0.75
gtcttctcgatcatctcgtccgtgttcaccgc CRISPR spacer
ggcttctcgatcatctcggccgggtcctgggg Protospacer
* **************** *** **.* *
578. spacer 4.2|53071|32|NC_017766|CRISPRCasFinder matches to NZ_CP027930 (Microbacterium sp. SGAir0570 plasmid pSGAir0570_2, complete sequence) position: , mismatch: 8, identity: 0.75
gtcttctcgatcatctcgtccgtgttcaccgc CRISPR spacer
gccttctcgatcagctcgtccgcgtacgcgct Protospacer
*.*********** ********.** *.* .
579. spacer 4.3|53132|32|NC_017766|CRISPRCasFinder matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ccagggaccgcgtcgtcagcggccacaccccg CRISPR spacer
gccaggtgagcgtccacagcggccacaccccg Protospacer
* .** ***** ****************
580. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
tctacctgatcggaccgccgggcggcgaggac Protospacer
.* .* * *** ************** ****
581. spacer 6.4|55410|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gacatgcgctcgcccctggaacggcaagggcg CRISPR spacer
gcctgctgctcgctccgggaacggcaagggcc Protospacer
* * .******.** **************
582. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
gacgaactcgtcggcggccgccaggacctcac Protospacer
* ********* ********** ****
583. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.75
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cacggccgggtcggcgtccgcccggacgtcac Protospacer
** * ************* ****.****
584. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 8, identity: 0.75
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
cgcggcaccggctacgaccagttcgtcaccaa Protospacer
.*. * .*******.*********.******
585. spacer 7.1|55999|33|NC_017766|PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
cctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
cctcgacgagttcgccgacaaggtcgttccgct Protospacer
********.********* ***** * * *.
586. spacer 7.8|56433|33|NC_017766|PILER-CR matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 8, identity: 0.758
-ccacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
gcggtgccggaa-ctcacccccggcgcggcctcg Protospacer
* ..**.**.* *******.************
587. spacer 7.8|56433|33|NC_017766|PILER-CR matches to MT657343 (Microbacterium phage GaeCeo, complete genome) position: , mismatch: 8, identity: 0.758
ccacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
cagagctgggacctcaccttcggcacggtcggc Protospacer
* . **************.*****.***.* *
588. spacer 7.9|56494|33|NC_017766|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.758
cgccacggcctcccggccggagagcttgtgccg CRISPR spacer
ggccacggcgtcccggccggtgagcacccggcg Protospacer
******** ********** **** . .* **
589. spacer 7.9|56494|33|NC_017766|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.758
cgccacggcctcccggccggagagcttgtgccg CRISPR spacer
ggccacggcgtcccggccggtgagcacccggcg Protospacer
******** ********** **** . .* **
590. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ctcgacgagttcgccgacaaggtcgttccgct Protospacer
*******.********* ***** * * *.
591. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP041044 (Paracoccus sp. AK26 plasmid pAK2, complete sequence) position: , mismatch: 8, identity: 0.75
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ttcgacgggttcggcgacaaggtggaattcct Protospacer
.************ *** ****** *. **.
592. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
cccggtcgtcctcgactgcgccgaccaggccc Protospacer
.******** * *************.. * *
593. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
cccggtcgtcctcgactgcgccgaccaggccc Protospacer
.******** * *************.. * *
594. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
tccggacgtgcacgaatgcgccgtcatggcgc Protospacer
***** ********* ******* * * .*
595. spacer 7.19|56365|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.75
gctcctaggtggggtgcccgccggggacgtgg CRISPR spacer
ccgacgaggtggggtgccggccggggccgaag Protospacer
* * ************ ******* ** .*
596. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MT657343 (Microbacterium phage GaeCeo, complete genome) position: , mismatch: 8, identity: 0.75
cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
agagctgggacctcaccttcggcacggtcggc Protospacer
. **************.*****.***.* *
597. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
atcgagaatcatttcgtcgtcgaccccgcgaa CRISPR spacer
ggccttgatcatctcgttgtcgaccccgcgaa Protospacer
. * .*****.****.**************
598. spacer 8.5|57322|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
aggttcc--cgtactggcggagcggcaggccgaa CRISPR spacer
--gctgcgatgtactggccgagccgcaggccgat Protospacer
*.* * .******** **** *********
599. spacer 8.5|57322|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to MG592544 (Vibrio phage 1.177.O._10N.286.45.E10, partial genome) position: , mismatch: 8, identity: 0.75
aggttcccgtactggcggagcggcaggccgaa CRISPR spacer
aatctccagtactggcggagcggctggttcaa Protospacer
*. .*** **************** **.. **
600. spacer 9.1|57912|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.75
accgcgaccttccggtggagggcgtgcagttc CRISPR spacer
gccgcgggcttccggtggagggcgtctcggcc Protospacer
.*****. ***************** . * .*
601. spacer 9.1|57912|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.75
accgcgaccttccggtggagggcgtgcagttc CRISPR spacer
tcgtcgaccttccggtggagggagcgcctttg Protospacer
* ****************** *.** **
602. spacer 9.1|57912|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.75
accgcgaccttccggtggagggcgtgcagttc CRISPR spacer
tcgtcgaccttccggtggagggagcgcctttg Protospacer
* ****************** *.** **
603. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 8, identity: 0.75
ggccgcatcaccggccccggcttcgaactgcg- CRISPR spacer
atccgcaccaccggccacggcttcg-tcggcat Protospacer
. *****.******** ******** * **.
604. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 8, identity: 0.75
ggccgcatcaccggccccggcttcgaactgcg- CRISPR spacer
atccgcaccaccggccacggcttcg-tcggcat Protospacer
. *****.******** ******** * **.
605. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 8, identity: 0.75
ggccgcatcaccggccccggcttcgaactgcg- CRISPR spacer
atccgcaccaccggccacggcttcg-tcggcat Protospacer
. *****.******** ******** * **.
606. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 8, identity: 0.75
ggccgcatcaccggccccggcttcgaactgcg CRISPR spacer
gacgacggcaccggcccccgcttcgcactgcc Protospacer
*.* .*. ********** ****** *****
607. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ggccgcatcaccggccccggcttcgaactgcg CRISPR spacer
gcgcgcatcaccggcgccggcgtcgacgagag Protospacer
* ************ ***** **** * *
608. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
gttcccgaggccgccgccgcgtcgcgcgcccg Protospacer
** ***********.***********.
609. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
ccatcgcagtccgccgccacgtggcgcgcgcc Protospacer
. *.***** ************ ****** ..
610. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 8, identity: 0.75
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
agcccgcaggccgcctccacctcgcgccacag Protospacer
* ************ **** ****** *
611. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
cgctcgccggccgccaccacgtcgcgcgggtg Protospacer
.* .*** *******.************ *
612. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
--tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
cccggcag--ggccgccgccgcgtcgcgcggctg Protospacer
.*.* * **********.********* **
613. spacer 9.7|58277|32|NC_017766|CRISPRCasFinder,CRT matches to MN234226 (Mycobacterium phage Curiosium, complete genome) position: , mismatch: 8, identity: 0.75
gcgactcgggccgccatcgaacgtgccgaggc CRISPR spacer
gtgatcgctgccgccgtcgagcgtgccgaggc Protospacer
*.**.. ******.****.***********
614. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 8, identity: 0.75
gaaggcgcgatggccggacgccgggcgatcga-- CRISPR spacer
agcggcgcgctggccagacgccgggc--ccgatg Protospacer
.. ****** *****.********** .***
615. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 8, identity: 0.75
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gtcggaatgatggccggatcccgggcgatcgg Protospacer
* ** ..**********. ***********.
616. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
gcgccgacgatcaggcagaccgtgcagtcgaa Protospacer
*************** ** ***** * . *.
617. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgacgatcaggccgaacgtgc--cggtcag CRISPR spacer
gggccgtcgatcaggccgaacctgcggtggcc-- Protospacer
**** ************** *** .**.*
618. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ggaccagcgatcaggccgaacggaccggtcaa Protospacer
.**..*************** .*******.
619. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ggaccagcgatcaggccgaacggaccggtcaa Protospacer
.**..*************** .*******.
620. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
gcgccgacgatcaggcagaccgtgcagtcgaa Protospacer
*************** ** ***** * . *.
621. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
ctcgccacgataaggccgatcgtgccggtgac Protospacer
*. * ***** ******* ********* *
622. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctcgcatcgtctccgccgaccggcgcaccgcc Protospacer
. * *** ********************
623. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctcgcatcgtctccgccgaccggcgcaccgcc Protospacer
. * *** ********************
624. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_007949 (Polaromonas sp. JS666 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctgggtggctcgcggccgaccggcgcatgccg Protospacer
.****** **** *************. *
625. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tccgccggatcgccgccggccggcgcaccgtt Protospacer
* * .**.*********.***********..
626. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
aagcccgcgtcgtcgccgaccagcgcaccgcc Protospacer
. * .* ****.********.**********
627. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP042995 (Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc Protospacer
.**..* *** *********** *******
628. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_KX426229 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.1, complete sequence) position: , mismatch: 8, identity: 0.75
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc Protospacer
.**..* *** *********** *******
629. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
-gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cgcaga-aaatcgccgccgacctgcgcacggcc Protospacer
**.*. ...************ ****** ***
630. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP033573 (Acinetobacter nosocomialis strain 2010N17-248 plasmid p2010N17-248, complete sequence) position: , mismatch: 8, identity: 0.75
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc Protospacer
.**..* *** *********** *******
631. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggtg-ggtcgccgccgaccggcgcaccgcc CRISPR spacer
-cgaacgcggtcggcgccgacgggcgcaccgtg Protospacer
**...* ***** ******* *********.
632. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP019144 (Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence) position: , mismatch: 8, identity: 0.75
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc Protospacer
.**..* *** *********** *******
633. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 8, identity: 0.75
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc Protospacer
.**..* *** *********** *******
634. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggtg-ggtcgccgccgaccggcgcaccgcc CRISPR spacer
-tggacgcggtcgccgccgacctgcgcgccgag Protospacer
.**..* ************** ****.***
635. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gcccgatcatcgccgccgcccgccgcaccgcc Protospacer
** * .********* *** *********
636. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP018825 (Acinetobacter ursingii strain M3 plasmid pAURM-1, complete sequence) position: , mismatch: 8, identity: 0.75
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc Protospacer
.**..* *** *********** *******
637. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032290 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.6, complete sequence) position: , mismatch: 8, identity: 0.75
---gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc Protospacer
.**..* *** *********** *******
638. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to FJ937737 (Burkholderia cenocepacia phage BcepIL02, complete genome) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gaagtcgatccagcgcccgccggccgccgtgc Protospacer
* ********* ** ************.
639. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NC_012743 (Burkholderia phage BcepIL02, complete genome) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gaagtcgatccagcgcccgccggccgccgtgc Protospacer
* ********* ** ************.
640. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
catttcg---atccagagcacgccggccgccgcca CRISPR spacer
---gtcgggtgcccagagcaggcccgccgccgcca Protospacer
*** ..******** *** **********
641. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NC_009939 (Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
cagcgggtaccagagcacgccgcccgcagcca Protospacer
** . * ************* **** ****
642. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gaagtggctccagaacaccccggccgccgccc Protospacer
* * * ******.*** ************
643. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to MK494124 (Mycobacterium phage Kristoff, complete genome) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
caacacgatccaggtcacgccggccgccatcg Protospacer
** . ********. *************..*.
644. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to MN586038 (Mycobacterium phage WalterMcMickey, complete genome) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
caacacgatccaggtcacgccggccgccatcg Protospacer
** . ********. *************..*.
645. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to JX411619 (Mycobacterium virus Rebeuca, complete genome) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
caacacgatccaggtcacgccggccgccatcg Protospacer
** . ********. *************..*.
646. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NC_041982 (Mycobacterium phage Twister, complete genome) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
caacacgatccaggtcacgccggccgccatcg Protospacer
** . ********. *************..*.
647. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to MT522002 (Mycobacterium phage Topanga, complete genome) position: , mismatch: 8, identity: 0.75
catttcgatccagagcacgccggccgccgcca CRISPR spacer
caacacgatccaggtcacgccggccgccatcg Protospacer
** . ********. *************..*.
648. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 8, identity: 0.75
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
tccctgcaccaccatcatttggtccgtgggat Protospacer
*************.***** *** *. **
649. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to KM659098 (Sinorhizobium sp. LM21 plasmid pLM21S1, complete sequence) position: , mismatch: 8, identity: 0.75
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
aacgttcggcaccaccttttcgccggccggcg Protospacer
. * * *. ******* *****.*********
650. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 8, identity: 0.75
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
gcgggcgccgtgccgaacacgctgacgtcgga Protospacer
.. . * ***************.********
651. spacer 1.2|40597|29|NC_017766|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.69
cgtggcgggctcaccggccgcgatgacct CRISPR spacer
cgtggcgggctgaccggccgcaggagtgc Protospacer
*********** *********.. ... .
652. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 9, identity: 0.71
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
tttctcggcggccttgtcgatgcggcgcaac Protospacer
.****.***********.****** . *
653. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to MN703407 (Microbacterium phage Leaf, complete genome) position: , mismatch: 9, identity: 0.71
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
gcgcgcggccgccttgttgttgcgcttctgc Protospacer
. * .*** ********* *********
654. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to MN703414 (Microbacterium phage Dewdrop, complete genome) position: , mismatch: 9, identity: 0.71
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
gcgcgcggccgccttgttgttgcgcttctgc Protospacer
. * .*** ********* *********
655. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 9, identity: 0.7
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
tatggcgggctcaccggcctcgacaaggca Protospacer
..***************** ***..* .
656. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 9, identity: 0.7
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
tatggcgggctcaccggcctcgacaaggca Protospacer
..***************** ***..* .
657. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 9, identity: 0.7
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
actggcgggctcgccggccgcgagcctgcc Protospacer
**********.********** . .*
658. spacer 1.7|40656|32|NC_017766|CRT,PILER-CR matches to MH834602 (Microbacterium phage Brahms, complete genome) position: , mismatch: 9, identity: 0.719
agtgcctcgaagacgagggtggaggctgcggc CRISPR spacer
gggtcgccgtagacgagggtggcggctgcgat Protospacer
.* * .** ************ *******..
659. spacer 1.7|40656|32|NC_017766|CRT,PILER-CR matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 9, identity: 0.719
agtgcctcgaagacgagggtggaggctgcggc CRISPR spacer
gggtcgccgtagacgagggtggcggctgcgat Protospacer
.* * .** ************ *******..
660. spacer 1.7|40656|32|NC_017766|CRT,PILER-CR matches to MH834604 (Microbacterium phage Coltrane, complete genome) position: , mismatch: 9, identity: 0.719
agtgcctcgaagacgagggtggaggctgcggc CRISPR spacer
gggtcgccgtagacgagggtggcggctgcgat Protospacer
.* * .** ************ *******..
661. spacer 1.7|40656|32|NC_017766|CRT,PILER-CR matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 9, identity: 0.719
agtgcctcgaagacgagggtggaggctgcggc CRISPR spacer
gggtcgccgtagacgagggtggcggctgcgat Protospacer
.* * .** ************ *******..
662. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to MN703407 (Microbacterium phage Leaf, complete genome) position: , mismatch: 9, identity: 0.719
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
gcgcgcggccgccttgttgttgcgcttctgct Protospacer
. * .*** ********* ********* *
663. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to MN703414 (Microbacterium phage Dewdrop, complete genome) position: , mismatch: 9, identity: 0.719
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
gcgcgcggccgccttgttgttgcgcttctgct Protospacer
. * .*** ********* ********* *
664. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134467 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence) position: , mismatch: 9, identity: 0.719
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
tcgcggcggcgacggcggagcagatcgtggtg Protospacer
* .* ********** ** *********.
665. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 9, identity: 0.719
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
agacggtcgcgacggcgcaggcgaacgtggcg Protospacer
* .* ************* ** ******
666. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 9, identity: 0.719
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
cggcggccgcgatggcgcaggagaccgtggcc Protospacer
.* .* ****.***********.******.
667. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
cgccagaggctggtcggccaggacgccggccc Protospacer
. ****** **********.*******
668. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
cgccagaggctggtcggccaggacgccggccc Protospacer
. ****** **********.*******
669. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcccgcgggctcgccggccggggcgccggcca Protospacer
* .******.*****.********** *
670. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
ggtgtgaggctcggcggccaaggcgccatatc Protospacer
*. ********** ******.******.
671. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
tcgctgaggctggtcggcgagggcgccgaact Protospacer
* ******* ****** *********.
672. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
tggcagagcctcgtcggccagggcggcgacgg Protospacer
.* *** **************** **.*..
673. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gccggtcggctcgtcggccaggacgacggcgg Protospacer
* * ***************.** ****..
674. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
aacagggaactcgtcggccagggcaccgccaa Protospacer
.* . *...***************.*** ***
675. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
atcgaagggctcgtcgtcaagggcgccggcga Protospacer
. * ..********* * ***********.*
676. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gccggtcggctcgtcggccaggacgacggcgg Protospacer
* * ***************.** ****..
677. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gccggtcggctcgtcggccaggacgacggcgg Protospacer
* * ***************.** ****..
678. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gccggtcggctcgtcggccaggacgacggcgg Protospacer
* * ***************.** ****..
679. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcccggccgctcgtcggccgcggcgccggcat Protospacer
* * ***********. **********
680. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
gcgaactggctcgtcggccagtgcgacggccc Protospacer
* *. ************** *** ****
681. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 9, identity: 0.719
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
cccgtcggggtcgtcggccagggcgccagcct Protospacer
** .** *****************.**
682. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 9, identity: 0.719
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
gagcgcgtcgcgctcgtgccgcgcgccgggga Protospacer
* .*******.*********** *** *
683. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
aaggccgtcgcgatcgtgccgcgcgccgggga Protospacer
. * ******* *********** *** *
684. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
aaggccgtcgcgatcgtgccgcgcgccgggga Protospacer
. * ******* *********** *** *
685. spacer 2.13|51486|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
gtcgacgtcgcgttcgtgccgcgctccgcgtt CRISPR spacer
aaggccgtcgcgatcgtgccgcgcgccgggga Protospacer
. * ******* *********** *** *
686. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gattgctgacgctgccgctcgccgcccccgtc Protospacer
..**** ****** ***********.* *
687. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gattgctgacgctgccgctcgccgcccccgtc Protospacer
..**** ****** ***********.* *
688. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
ctggccgcgctggccctggccgctctcacgac Protospacer
*. ******** *********.**** . *.
689. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
ctggccgcgctggccctggccgctctcacgac Protospacer
*. ******** *********.**** . *.
690. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
ctggccgcgctggccctggccgctctcacgac Protospacer
*. ******** *********.**** . *.
691. spacer 3.4|52000|32|NC_017766|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cccgccgcgctcgccctggccactctgggcat CRISPR spacer
ctggccgcgctggccctggccgctctcacgac Protospacer
*. ******** *********.**** . *.
692. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
tataacttcggcaaggcggccggtgctatcgc Protospacer
. ****************.****** *
693. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 9, identity: 0.719
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
cgtcacgtcggcaatgcggtcggtgcagacgt Protospacer
* ** ******* ************ .*
694. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP011296 (Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence) position: , mismatch: 9, identity: 0.719
ctgaac--ttcggcaaggcggtcggtgcacgctg CRISPR spacer
--ggatcgttcggcaagacggtcggtggacgaac Protospacer
*.*. *********.********* ***
695. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
cgtcacgtcggcaatgcggtcggtgcagacgt Protospacer
* ** ******* ************ .*
696. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 9, identity: 0.719
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
cgtcacgtcggcaatgcggtcggtgcagacgt Protospacer
* ** ******* ************ .*
697. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcgctgcgcaccgtcgccgagtgggccgg Protospacer
****** .*************** **.
698. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gaggaggctcgcaccgtcgccgacgaggtcgg Protospacer
*** *** ***************. **.
699. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caccaacggcgcaccgccgccggcacccacgc Protospacer
** . ********.*****.********
700. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gccccgcagcgcatcgtcgccgacacccgcgc Protospacer
** *****.**************.**
701. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
cgcccggcccgcaccgtcgccgacgcctgcac Protospacer
*. **** ***************.**..*.
702. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
ccactcccccgcacccacgccgacacccacga Protospacer
* . . * ****** ***************
703. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
ccactcccccgcacccacgccgacacccacga Protospacer
* . . * ****** ***************
704. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggccgcgcgcaccggcgccgaggctgcccg Protospacer
***** ********** ****** .*. * .
705. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 9, identity: 0.719
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggccgcgcgcaccggcgccgaggctgcccg Protospacer
***** ********** ****** .*. * .
706. spacer 3.8|52244|32|NC_017766|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gagctgtgcaccgccacgatcaacgaccgacg CRISPR spacer
cggctgtccaccgccacggtcaacgcctatct Protospacer
.***** **********.****** *.. *
707. spacer 3.9|52305|32|NC_017766|CRISPRCasFinder matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 9, identity: 0.719
ggtactcgcgtcaaggcgcgcgggtcaggcgt CRISPR spacer
aggtcacgcgtcagggcgcgcggggcagggtc Protospacer
.* * *******.********** **** .
708. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.71
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
aaagccgggtggtggccgaacgggtgcgccg Protospacer
. * . *************** ******
709. spacer 3.10|52366|31|NC_017766|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
ccgccaacgtggtggccgaacggctgcgccc CRISPR spacer
tgaccgacgtggtggccggacggctgtcggc Protospacer
. .**.************.*******. *
710. spacer 3.14|51873|37|NC_017766|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.757
atccctgcgggaggccatccgccgcgctgtctgtgag CRISPR spacer
ctccctgcaggaggcgatccgccgcgcgaccaaggag Protospacer
*******.****** *********** ..* . ***
711. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 9, identity: 0.719
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gtcgcggaacgcggccagaccgaagcccgtga Protospacer
* . ************ ***** **** .*
712. spacer 4.2|53071|32|NC_017766|CRISPRCasFinder matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 9, identity: 0.719
gtcttctcgatcatctcgtccgtgttcaccgc CRISPR spacer
gcgaactccatcatctcgtccttgttcagggt Protospacer
*. *** ************ ****** *.
713. spacer 5.1|54820|32|NC_017766|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.719
aagtacggcggatacgcgtacgggtccgatcc CRISPR spacer
cgccgcggcgggtacgcgtacgggtccgcggc Protospacer
. ..******.**************** *
714. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
ttgtattcctcgctcagccgggcggcgcggac Protospacer
..*. . ***** * ****************
715. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026745 (Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
ttgtattcctcgctcagccgggcggcgcggac Protospacer
..*. . ***** * ****************
716. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
acgtgtcgctcgcactgccggccggcgcggtg Protospacer
**. . ********.***** ********
717. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046917 (Paraburkholderia sp. DHF22 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
attcttcgctcgcaccgccggtcgacgcggtg Protospacer
. **. ************** **.*****
718. spacer 6.4|55410|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
gacatgcgctcgcccctggaacggcaagggcg CRISPR spacer
ccgatgcgatcgcgcctggaacggcaggcggc Protospacer
***** **** ************.* *
719. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
gagttcctcgtcggcgtcctccagggcgaggt Protospacer
***** ************ *****.*. ..
720. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020948 (Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence) position: , mismatch: 9, identity: 0.719
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
ggcgtcgacgtcggcgcccgccatgacatcat Protospacer
. **. ********.****** *******.
721. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
ggcgtcgacgtcggcgcccgccacgacatcat Protospacer
. **. ********.****** *******.
722. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
cagttcatcgtcggcgtctaccacaaacgcga Protospacer
******************..*** .* *.
723. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022197 (Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
gacaccttcggcaacaaccagttcttctgggc Protospacer
******.***** *********** .* .
724. spacer 6.9|55715|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
acgctcgccttcgctggcggcagcgtcaggat Protospacer
. * . ********* ********** ***.
725. spacer 7.5|56243|33|NC_017766|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727
ctccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
acccggtcgtcctcgactgcgccgaccaggccc Protospacer
.******** * *************.. * *
726. spacer 7.5|56243|33|NC_017766|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727
ctccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
acccggtcgtcctcgactgcgccgaccaggccc Protospacer
.******** * *************.. * *
727. spacer 7.8|56433|33|NC_017766|PILER-CR matches to MN310543 (Microbacterium phage ChickenKing, complete genome) position: , mismatch: 9, identity: 0.727
ccacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
cagagctgggacctcaccttcggcacggtgggc Protospacer
* . **************.*****.***. *
728. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 9, identity: 0.719
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ctcggcgggttcgccaagaaggtccgaagaga Protospacer
****.**********.******* * * .
729. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 9, identity: 0.719
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ctcggcgggttcgccaagaaggtccgaagaga Protospacer
****.**********.******* * * .
730. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
ctcgacgggctcgccgagacggttcggaagtt Protospacer
*********.********* *** * . * ..
731. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
cgcgcatcagcacggctgcgacgactgcggac Protospacer
. ** . *****.***** ***********
732. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 9, identity: 0.719
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
cgcgcatcagcacggctgcgacgactgcggac Protospacer
. ** . *****.***** ***********
733. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
cgcgcatcagcacggctgcgacgactgcggac Protospacer
. ** . *****.***** ***********
734. spacer 7.18|56305|31|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
gccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
taggcaatcccgacctgttcgagaaccttga Protospacer
.***** **************** *
735. spacer 7.18|56305|31|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 9, identity: 0.71
gccacaatcgcgacctgttcgagaacaaggc CRISPR spacer
taggcaatcccgacctgttcgagaaccttga Protospacer
.***** **************** *
736. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 9, identity: 0.719
cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
cggtgccggaactcacccccggcgcggcctcg Protospacer
*. . *** *******.************
737. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to MN310543 (Microbacterium phage ChickenKing, complete genome) position: , mismatch: 9, identity: 0.719
cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
agagctgggacctcaccttcggcacggtgggc Protospacer
. **************.*****.***. *
738. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719
cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
acctgggggtcctcaccctcggcgccgccggc Protospacer
* *** *************** *** *
739. spacer 7.21|56487|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 9, identity: 0.719
gccacggcctcccggccggagagcttgtgccg CRISPR spacer
tccacggcctcccggtcggagtgcccaaacag Protospacer
**************.***** **... .* *
740. spacer 7.22|56548|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP039694 (Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtcgtagaggcggcgatcgttgctgccctg CRISPR spacer
agctcgaagaggcggcgatcgttgatggcgcc Protospacer
. *** ***************** ** * .
741. spacer 7.24|56670|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagaccagggcgatgcgggaactgtcccgg CRISPR spacer
cattgcccagggggatgcgggaacggtccaga Protospacer
.. * ****** *********** **** *.
742. spacer 7.26|56792|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719
gggacacccttcgctgtcggcagcgtctggac CRISPR spacer
acgctcgccttcgctggcggcagcgtcaggat Protospacer
. * . ********* ********** ***.
743. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 9, identity: 0.719
atcgagaatcatttcgtcgtcgaccccgcgaa CRISPR spacer
gtgccggatcatttcgccttcgaccccgcgcg Protospacer
.* *.*********.* *********** .
744. spacer 8.8|57505|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggccagtgcgttgaggtcgccaccaacct CRISPR spacer
ggcggccagggcgtcgaggtcgcgggcgaggc Protospacer
********* ****.******** . *.* .
745. spacer 8.8|57505|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggccagtgcgttgaggtcgccaccaacct CRISPR spacer
tgcggccagttcgttgcggtcgccgggatcga Protospacer
********* ***** *******. * *
746. spacer 8.8|57505|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggccagtgcgttgaggtcgccaccaacct CRISPR spacer
cgcgtccattgcgttgaggtcgcctgcggcga Protospacer
*** *** *************** *..*
747. spacer 8.8|57505|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggccagtgcgttgaggtcgccaccaacct CRISPR spacer
tgcggccagttcgttgcggtcgccgggatcga Protospacer
********* ***** *******. * *
748. spacer 8.9|57566|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcccggtcaccttccagtccctcttccaa CRISPR spacer
atcgcccggtcacctccctgtccctcggcccg Protospacer
************.** ******* ** .
749. spacer 8.9|57566|32|NC_017766|CRISPRCasFinder,CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 9, identity: 0.719
cgggcccggtcaccttccagtccctcttccaa CRISPR spacer
tgaactgggtgaccttccagtccatcttcccg Protospacer
.*..*. *** ************ ****** .
750. spacer 8.10|57627|32|NC_017766|CRISPRCasFinder matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719
ggggcacccttcgctgtcggcagcgtctggac CRISPR spacer
acgctcgccttcgctggcggcagcgtcaggat Protospacer
. * . ********* ********** ***.
751. spacer 9.1|57912|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to MN234220 (Gordonia phage Lambo, complete genome) position: , mismatch: 9, identity: 0.719
accgcgaccttccggtggagggcgtgcagttc CRISPR spacer
tccgcaaccttcaggtggagggcggcaagcga Protospacer
****.****** *********** **.
752. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 9, identity: 0.719
ggccgcatcaccggccccggcttcgaactgcg CRISPR spacer
gtcgatatcaccggcaccggcttcgatctcga Protospacer
* * ..********* ********** ** .
753. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 9, identity: 0.719
ggccgcatcaccggccccggcttcgaactgcg CRISPR spacer
gtcgatatcaccggcaccggcttcgatctcga Protospacer
* * ..********* ********** ** .
754. spacer 9.2|57973|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 9, identity: 0.719
ggccgcatcaccggccccggcttcgaactgcg CRISPR spacer
taccgcatcaccggcaccggcgtcgtcgtcct Protospacer
.************* ***** *** * *
755. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
acgtcgcaggccgccgccacatcgcccgcgcg Protospacer
..****************.**** *** .
756. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
accgcgcaggccgcctcgacgtcgcgcggcca Protospacer
*********** * ********** *.
757. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035513 (Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence) position: , mismatch: 9, identity: 0.719
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
gcgctggaggccgctgccacgacgcgcgcccc Protospacer
.*.* *******.****** ********..
758. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 9, identity: 0.719
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
tggccgcaggccgccgcctcgtcctacctggt Protospacer
**.*************** **** ..* . *
759. spacer 9.6|58216|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 9, identity: 0.719
gaccctggtaccggatcaccgaccggtaccag CRISPR spacer
agtactgggaccggttcaccgaccggttcggg Protospacer
... **** ***** ************ * .*
760. spacer 9.7|58277|32|NC_017766|CRISPRCasFinder,CRT matches to KT898134 (Aeromonas phage phiARM81mr, complete genome) position: , mismatch: 9, identity: 0.719
gcgactcgggccgccatcgaacgtgccgaggc CRISPR spacer
accaaggaggccgccattgagcgtgccgagga Protospacer
.* * .*********.**.**********
761. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gctttgccgatggccgaacgccggccgatcgc Protospacer
* *********.******* ******
762. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
atgcgggcgtcggccggacgccgggcgatctt Protospacer
. . * *** .*******************
763. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gctttgccgatggccgaacgccggccgatcgc Protospacer
* *********.******* ******
764. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
765. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
766. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
767. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
768. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
769. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
770. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
771. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
772. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP011772 (Croceicoccus naphthovorans strain PQ-2 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
ccacgggcgatggctggacgcccggcgatatc Protospacer
* * ********.******* ******
773. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
774. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg Protospacer
* .* ****** *** ************ .
775. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
cacgaggcgatcagcccgaacgtgcccgtcgt Protospacer
* *.******* *********** ***.
776. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
gcgccgacgatcacgccgaaggtgagaccgag Protospacer
************ ****** *** . . **
777. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 9, identity: 0.719
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
gcgccgacgatcacgccgaaggtgagaccgag Protospacer
************ ****** *** . . **
778. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
cgatcgccgatcaggccgagcgtgccgctttt Protospacer
* ..** ************.******* *.
779. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.719
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
acgagatcgatcaggccgaaaatgccggtctt Protospacer
** . ************* .********
780. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
cgatcgccgatcaggccgagcgtgccgctttt Protospacer
* ..** ************.******* *.
781. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP025584 (Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence) position: , mismatch: 9, identity: 0.719
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
gccccgacgatcaggccgatcgagccacccgc Protospacer
* **************** ** ***. .*.
782. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.719
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctcgcggggtcgccgccgaccggcgatccgag Protospacer
. * ******************* ***
783. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 9, identity: 0.719
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctctcggcgtcgccaccgacctgcgcaccgcc Protospacer
. * ******.****** **********
784. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.719
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tttcgagggtcgcctcagaccggcgcaccaca Protospacer
. * ******** * ************.*
785. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ggcaccggctcgccgccgacccgcgcacccac Protospacer
* . .** ************ ******* *
786. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cccagctggtcgccgccgactggctcaccgaa Protospacer
* .*. *************.*** *****
787. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
tcgacgccctcgccgcccaccggcgcgccgcc Protospacer
**. ******** ********.*****
788. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
aggtcgcgctcgccgccaaccggcgcatcgcc Protospacer
. * * ********.*********.****
789. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP030830 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence) position: , mismatch: 9, identity: 0.719
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gatttcgatccagagcacgcctgcattgacgt Protospacer
******************** ** . .*
790. spacer 9.13|58643|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 9, identity: 0.719
gccctgcaccaccaccatttcgtcggccggcg CRISPR spacer
cgcgtgcatcaccacgatttcgtcggcaagga Protospacer
* ****.****** *********** .* .
791. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
ctggcccccgtgccgatcacgccgacgcgccg Protospacer
* .************ **********.
792. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
acatgcaccgggccgaccacgccgacgtcgtc Protospacer
*. * *** ***** ************* .
793. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
gaccccctcgcgccgaacacgccgacggcaac Protospacer
. * ***.**.**************** *...
794. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to NC_000867 (Pseudoalteromonas phage PM2, complete genome) position: , mismatch: 10, identity: 0.677
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
accgaccacggcctagttgatgcgcttgttg Protospacer
.. . .****** ************ ***
795. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to NC_042121 (Pseudoalteromonas phage Cr39582, complete genome) position: , mismatch: 10, identity: 0.677
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
accgaccacggcctagttgatgcgcttgttg Protospacer
.. . .****** ************ ***
796. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to AF155037 (Alteromonas phage PM2, complete genome) position: , mismatch: 10, identity: 0.677
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
accgaccacggcctagttgatgcgcttgttg Protospacer
.. . .****** ************ ***
797. spacer 1.5|40778|31|NC_017766|CRISPRCasFinder matches to M26134 (Bacteriophage PM2 structural protein gene containing purine/pyrimidine rich regions and anti-Z-DNA-IgG binding regions, complete cds) position: , mismatch: 10, identity: 0.677
cttcttggcggccttgttgatgcgcttcttg CRISPR spacer
accgaccacggcctagttgatgcgcttgttg Protospacer
.. . .****** ************ ***
798. spacer 1.6|40597|30|NC_017766|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.667
cgtggcgggctcaccggccgcgatgacctc CRISPR spacer
cgtggcgggctgaccggccgcaggagtgcg Protospacer
*********** *********.. ... .
799. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 10, identity: 0.688
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
tttctcggcggccttgtcgatgcggcgcaacg Protospacer
.****.***********.****** . *
800. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.688
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
agatgcaggcggcggcgaaggagatcacccgc Protospacer
* ********.***** ********.. .
801. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.688
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
agatgcaggcggcggcgaaggagatcacccgc Protospacer
* ********.***** ********.. .
802. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 10, identity: 0.688
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
gccatcaggcgacggcgaaggagaacgttggc Protospacer
. ************ ****** *** * .
803. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
cgcgcattgcgacggcggaggagatcgtcgcc Protospacer
.*. ********* ********** **.
804. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 10, identity: 0.688
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
gcgcgcgggcgaaggcgcaggagatcggcgtg Protospacer
.**.***** ************** *.
805. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024309 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence) position: , mismatch: 10, identity: 0.688
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
cgcgcattgcgacggcggaggagatcgtcgcc Protospacer
.*. ********* ********** **.
806. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
cgcgcattgcgacggcggaggagatcgtcgcc Protospacer
.*. ********* ********** **.
807. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.688
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
agatgcaggcggcggcgaaggagatcacccgc Protospacer
* ********.***** ********.. .
808. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_008757 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence) position: , mismatch: 10, identity: 0.688
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
atgcgccggatcgtcggccagggcgccagccc Protospacer
. * ** *****************.**
809. spacer 2.9|51242|32|NC_017766|CRISPRCasFinder,CRT matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688
gaggtgaggctcgtcggccagggcgccggcaa CRISPR spacer
atgcgccggatcgtcggccagggcgccagccc Protospacer
. * ** *****************.**
810. spacer 2.14|51547|32|NC_017766|CRT matches to MH450125 (Arthrobacter phage MediumFry, complete genome) position: , mismatch: 10, identity: 0.688
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
gcttgaccttgttgaccttcttcttgtctgac Protospacer
***********.******* ***.* ...
811. spacer 3.1|51817|32|NC_017766|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
ccgccctgccccggctgaccgcgtccccaggc Protospacer
************* **** **** * ..
812. spacer 3.2|51878|32|NC_017766|CRISPRCasFinder matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tgcgggaggccatccgccgcgctgtctgtgag CRISPR spacer
tgcgtcaggccatccgccgcgctcagggctca Protospacer
**** ***************** *. .
813. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_KX443388 (Rhodococcus hoagii strain PAM1216 plasmid pVAPA1216, complete sequence) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
814. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_KX443406 (Rhodococcus hoagii strain PAM1413 plasmid pVAPB1413, complete sequence) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
815. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_KX443397 (Rhodococcus hoagii strain PAM1475 plasmid pVAPB1475, complete sequence) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
816. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_KX443407 (Rhodococcus hoagii strain PAM1533 plasmid PVAPB1533, complete sequence) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
817. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_CP027795 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas2, complete sequence) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
818. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_CP041646 (Rhodococcus hoagii strain WY plasmid pWY, complete sequence) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
819. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NC_014247 (Rhodococcus equi plasmid pVAPAMBE116, complete sequence) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
820. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NZ_CP039433 (Rhodococcus sp. SGAir0479 plasmid unnamed) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
821. spacer 3.3|51939|32|NC_017766|CRISPRCasFinder matches to NC_011150 (Rhodococcus equi plasmid pVAPB1593, complete sequence) position: , mismatch: 10, identity: 0.688
agttgcagacgctcccgctcgccgctcaccag CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt Protospacer
. . ****************** ** **
822. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
823. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
catcggctcggccaggcggtcggtgcgcgccc Protospacer
* . .***** *************.***.
824. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
825. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
cccggcttcggcaaggcgctcggtgtacttga Protospacer
*. ..************* ******.** . .
826. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
827. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
828. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
829. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
830. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
831. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
832. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
833. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
834. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
835. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
836. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
837. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
838. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
839. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
840. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
841. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
842. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
843. spacer 3.6|52122|32|NC_017766|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
ctgaacttcggcaaggcggtcggtgcacgctg CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc Protospacer
. .*.**************** * ****.
844. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gctgcggcgcacaccgccgccgacacatcgaa Protospacer
*******.*****.********* . .*
845. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP030841 (Acidisarcina polymorpha strain SBC82 plasmid pACPOL1, complete sequence) position: , mismatch: 10, identity: 0.688
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gggccggcgcgcaaggtcgccgacaccactct Protospacer
.* ********* ************ .
846. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
agggcggcgcgctccgccgccgacaggtcggc Protospacer
.********** ***.******** . *
847. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gctgcggcgcacaccgccgccgacacatcgaa Protospacer
*******.*****.********* . .*
848. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gctgcggcgcacaccgccgccgacacatcgaa Protospacer
*******.*****.********* . .*
849. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
gctgcggcgcacaccgacgccgacacatcgaa Protospacer
*******.***** ********* . .*
850. spacer 3.11|52426|32|NC_017766|CRISPRCasFinder matches to NZ_CP032091 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tggcggtgcatgcccgtgctcaccggcgccag CRISPR spacer
cagtagtacatgcccgtgctcagcggcgttgt Protospacer
..*..**.************** *****...
851. spacer 3.13|51812|37|NC_017766|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.73
atccgccgccctgccccgcctgagcgcgaacgtgccg CRISPR spacer
atccgccgccctgccccggctgaccgcgtccccaggc Protospacer
****************** **** **** * ..
852. spacer 3.15|51934|37|NC_017766|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 10, identity: 0.73
atcccagttgcagacgctcccgctcgccgctcaccag CRISPR spacer
cccgcagatgcagacgctccagctcgccgccgacggc Protospacer
.* *** ************ *********. ** .
853. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 10, identity: 0.688
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
gggcaggaacgcgggcacaccgacctgtttgc Protospacer
** *********** ********* . .. .
854. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 10, identity: 0.688
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
tccttggaacgcgaccacaccgacggccgaag Protospacer
.. ********.*********** ** .*.
855. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
cacaaggacctcggccacaccgacgccgccgc Protospacer
.. **** * **************** * .
856. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
ataccggaacgcggccacaacgccgcccacgg Protospacer
. * ************** ** ***** ..
857. spacer 4.1|53010|32|NC_017766|CRISPRCasFinder matches to MN234170 (Mycobacterium phage MalagasyRose, complete genome) position: , mismatch: 10, identity: 0.688
ggtcaggaacgcggccacaccgacgccccgaa CRISPR spacer
ctccaggaacgcgaccacaccggcgctcttgc Protospacer
.**********.********.***.*. .
858. spacer 4.2|53071|32|NC_017766|CRISPRCasFinder matches to NZ_CP048424 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gtcttctcgatcatctcgtccgtgttcaccgc CRISPR spacer
cgtttctcgaacatctcgaccgtgttccagaa Protospacer
.******* ******* ******** .
859. spacer 4.2|53071|32|NC_017766|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 10, identity: 0.688
gtcttctcgatcatctcgtccgtgttcaccgc CRISPR spacer
aacttctcgatcatcgcgtcggtgtcgagtcg Protospacer
. ************* **** ****. * .
860. spacer 4.2|53071|32|NC_017766|CRISPRCasFinder matches to MN694806 (Marine virus AFVG_250M690, complete genome) position: , mismatch: 10, identity: 0.688
gtcttctcgatcatctcgtccgtgttcaccgc CRISPR spacer
cccttctcgatcatctcctccctgtgcctgtt Protospacer
.*************** *** *** * . .
861. spacer 4.3|53132|32|NC_017766|CRISPRCasFinder matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 10, identity: 0.688
ccagggaccgcgtcgtcagcggccacaccccg CRISPR spacer
gaattgaccgcgttgccagcggccacacgggc Protospacer
* ********.*.************
862. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012899 (Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence) position: , mismatch: 10, identity: 0.688
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
ggcagcagctcgccccgccggccggcgcagcg Protospacer
******** ******* ******.*
863. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_018696 (Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence) position: , mismatch: 10, identity: 0.688
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
ggcagcagctcgccccgccggccggcgcagcg Protospacer
******** ******* ******.*
864. spacer 6.1|55227|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.688
ccgctcagctcgcaccgccgggcggcgcggac CRISPR spacer
tgccaaagcccgcgccgccgggcggcgcgagg Protospacer
. * ***.***.***************..
865. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.688
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
tacgtcctcgtcggcgtccggcaggacgggga Protospacer
.* ** ************* ******. .
866. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NC_018023 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence) position: , mismatch: 10, identity: 0.688
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
gagttcatcgtcggcctcggccagcgccgtct Protospacer
************** ** ***** .* . .
867. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 10, identity: 0.688
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
gcgcggctcgtcggggtccgccaggagatcga Protospacer
*. ******* *********** ***.
868. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 10, identity: 0.688
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
gacctcatcgtcggcgcccgccgggacccggt Protospacer
* .************.*****.**** . ..
869. spacer 6.7|55593|32|NC_017766|CRISPRCasFinder,CRT matches to KT287080 (Enterobacter phage phiEap-2, complete genome) position: , mismatch: 10, identity: 0.688
cagttcatcgtcggcgtccgccaggacatcac CRISPR spacer
tgagttctcgtcggcgttcgccagggcatctt Protospacer
... *. **********.*******.**** .
870. spacer 6.8|55654|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 10, identity: 0.688
gacaccctcggctacaaccagttcgccaccaa CRISPR spacer
ctcaccttcggctacgaccagttcgaccttgg Protospacer
****.********.********* * ....
871. spacer 7.10|56555|33|NC_017766|PILER-CR matches to NZ_CP039694 (Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence) position: , mismatch: 10, identity: 0.697
cgcgtcgtagaggcggcgatcgttgctgccctg CRISPR spacer
gagctcgaagaggcggcgatcgttgatggcgcc Protospacer
. *** ***************** ** * .
872. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 10, identity: 0.688
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
caggctcgtgcgcgaccgcgccgactgctcga Protospacer
. * ******.****.*********** .
873. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 10, identity: 0.688
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
caggctcgtgcgcgaccgcgccgactgctcga Protospacer
. * ******.****.*********** .
874. spacer 7.20|56426|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 10, identity: 0.688
cacgctgggacctcaccctcggcgcggcctcc CRISPR spacer
tccgctgggaccgcaacctcggcgccaagact Protospacer
. ********** ** ********* . *.
875. spacer 8.3|57199|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atcgagaatcatttcgtcgtcgaccccgcgaa CRISPR spacer
ttcgagaatcacgtcgtcgtcgacgtacaggc Protospacer
**********. *********** . *.
876. spacer 8.5|57322|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to KY676784 (Streptomyces phage ToastyFinz, complete genome) position: , mismatch: 10, identity: 0.688
aggttcccgtactggcggagcggcaggccgaa CRISPR spacer
gtacggccgaacaggcggagcggcaggccgcg Protospacer
. .. *** ** ***************** .
877. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 10, identity: 0.688
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
ccggcgcaggccgccgccccggcgcgcgaacc Protospacer
. . ************** ** ****** ..
878. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 10, identity: 0.688
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
cggttcacggccgccgccatggcgcgcgcctc Protospacer
.*... ***********.* *********.
879. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_011667 (Thauera sp. MZ1T plasmid pTha01, complete sequence) position: , mismatch: 10, identity: 0.688
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
ggcttttcggccgccgcgacgtcgagcgcctg Protospacer
* .. . ********* ****** ******
880. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
ggcaggcacgccgccaccacgtcgcgcgggga Protospacer
* *** ******.************
881. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
gcgtggaaggccgccgccgcgtcgggcgccgc Protospacer
.. * ***********.***** ***** .
882. spacer 9.7|58277|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.688
gcgactcgggccgccatcgaacgtgccgaggc CRISPR spacer
gatcagggggccgccctcgaacgcgccgagcg Protospacer
* ******** *******.******
883. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
884. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
885. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
886. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
887. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
888. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
889. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
890. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
891. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
892. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
893. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
894. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
895. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
896. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
897. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
898. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
899. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
900. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
901. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
902. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
903. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
904. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
905. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
906. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
907. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
908. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
909. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
910. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
911. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
912. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tggccgacgatggccggccgccgggcgatcct Protospacer
.. .********** ************
913. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
accagcacgatggccggacggcgggcgaggat Protospacer
. .**.************* ******* .
914. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
caccgcgcggtggccgggcgccgggcggagtt Protospacer
* *****.*******.*********.
915. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
gcgctggccatggccgggcgccgggcgatgat Protospacer
* . ** ********.*********** .
916. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to NC_021780 (Salmonella phage FSL SP-088, complete genome) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tgctgcgcgatggcacgacgccgggcgtacac Protospacer
. ********** *********** *.
917. spacer 9.8|58338|32|NC_017766|CRISPRCasFinder,CRT matches to KC139515 (Salmonella phage FSL SP-124, complete genome) position: , mismatch: 10, identity: 0.688
gaaggcgcgatggccggacgccgggcgatcga CRISPR spacer
tgctgcgcgatggcacgacgccgggcgtacac Protospacer
. ********** *********** *.
918. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to MK373789 (Escherichia phage vB_EcoS_PTXU06, complete genome) position: , mismatch: 10, identity: 0.688
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
aagcccgcgatcaggccgaacgtgcgaacgcg Protospacer
*** .****************** ... *
919. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
ctctcggggtcgccgccgaccggcgatccgag Protospacer
. ******************* ***
920. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat Protospacer
* .. ****** *************.** .
921. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat Protospacer
* .. ****** *************.** .
922. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat Protospacer
* .. ****** *************.** .
923. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat Protospacer
* .. ****** *************.** .
924. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
cagggtgggtcgcagccgcccggcggctcaaa Protospacer
*********** **** ****** .*.
925. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat Protospacer
* .. ****** *************.** .
926. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
acctcgtactcgccgccgccctgcgcaccgcc Protospacer
.* . ********* ** **********
927. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
gactcaaactcgccgccgtccgccgcaccgcc Protospacer
* .. ********* *** *********
928. spacer 9.11|58521|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 10, identity: 0.688
gactctgggaccacgatggtggtcaacgtcct CRISPR spacer
ccggtcgagaccacgatggaggtcaacgcccg Protospacer
..*.*********** ********.**
929. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 10, identity: 0.688
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gaccgtcatccagggcacgccggccgcggcgg Protospacer
*.. . ******.************* ** .
930. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 10, identity: 0.688
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gatctcgatccagagcacgcctgctttgacgt Protospacer
**.***************** **. . .*
931. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
agttccccggtgccgatcacgccgacgaactg Protospacer
* . **** ******* **********
932. spacer 9.14|58704|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
atcacccccgtgccgaacacgccgacgtcggt CRISPR spacer
ccgattaccgtgccggacacgccgacatcgac Protospacer
. *.. ********.**********.***..
933. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to NC_000867 (Pseudoalteromonas phage PM2, complete genome) position: , mismatch: 11, identity: 0.656
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
accgaccacggcctagttgatgcgcttgttga Protospacer
.. . .****** ************ ***
934. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to M26134 (Bacteriophage PM2 structural protein gene containing purine/pyrimidine rich regions and anti-Z-DNA-IgG binding regions, complete cds) position: , mismatch: 11, identity: 0.656
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
accgaccacggcctagttgatgcgcttgttga Protospacer
.. . .****** ************ ***
935. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to NC_042121 (Pseudoalteromonas phage Cr39582, complete genome) position: , mismatch: 11, identity: 0.656
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
accgaccacggcctagttgatgcgcttgttga Protospacer
.. . .****** ************ ***
936. spacer 1.9|40778|32|NC_017766|CRT,PILER-CR matches to AF155037 (Alteromonas phage PM2, complete genome) position: , mismatch: 11, identity: 0.656
cttcttggcggccttgttgatgcgcttcttgt CRISPR spacer
accgaccacggcctagttgatgcgcttgttga Protospacer
.. . .****** ************ ***
937. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_011003 (Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence) position: , mismatch: 11, identity: 0.656
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
ctctgcaggcgaccgcgcagcagatcaatcga Protospacer
. .********** ****** *****.
938. spacer 2.3|50876|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 11, identity: 0.656
tgttgcaggcgacggcgcaggagatcgtggct CRISPR spacer
ctctgcaggcgaccgcgcagcagatcaatcga Protospacer
. .********** ****** *****.
939. spacer 2.4|50937|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 11, identity: 0.656
gtcacacaggtgatcaggaccgtcttcctcgc CRISPR spacer
aagctgaaggtgatcaagaccgacttcctcaa Protospacer
. .. *********.***** *******.
940. spacer 2.7|51120|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to NC_012521 (Rhodococcus opacus B4 plasmid pROB02, complete sequence) position: , mismatch: 11, identity: 0.656
cagctcggcgcgcaggaacggtccgggctgcg CRISPR spacer
tgcatcggcaggcaggaacggtccgggtgttt Protospacer
.. *****. ****************. .
941. spacer 2.14|51547|32|NC_017766|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 11, identity: 0.656
ccttgaccttgtcgaccttcatctcgaacagg CRISPR spacer
aaactgccgtgtcggccttcatctcgaacgtc Protospacer
. .** *****.**************.
942. spacer 3.7|52183|32|NC_017766|CRISPRCasFinder matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 11, identity: 0.656
caggcggcgcgcaccgtcgccgacacccacga CRISPR spacer
caggcggcgcgcaccgtggcggaactgagtag Protospacer
***************** ** ** . ....
943. spacer 3.14|51873|37|NC_017766|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 11, identity: 0.703
atccctgcgggaggccatccgccgcgctgtctgtgag CRISPR spacer
ctccctgcaggaggccatccggcgcgccacgacggaa Protospacer
*******.************ *****... **.
944. spacer 3.16|51995|37|NC_017766|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.703
atccccccgccgcgctcgccctggccactctgggcat CRISPR spacer
ccgtggccgccgcgctcgccctggccccgctggccga Protospacer
. . ******************** * **** *.
945. spacer 7.13|56000|32|NC_017766|CRISPRCasFinder,CRT matches to NC_015409 (Verrucosispora maris AB-18-032 plasmid pVMKU, complete sequence) position: , mismatch: 11, identity: 0.656
ctcgacgggttcgccgagaaggtgctacaccc CRISPR spacer
gacgacgggttcgccgagcagttgcggacggt Protospacer
**************** ** *** . .
946. spacer 7.17|56244|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656
tccggtcgtgcacgactgcgccgactgcggac CRISPR spacer
cgatctcgtgctcgactgcgccgacagctacg Protospacer
. ****** ************* ** .
947. spacer 9.3|58034|32|NC_017766|PILER-CR,CRISPRCasFinder,CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 11, identity: 0.656
tgaccgcaggccgccgccacgtcgcgcgcctt CRISPR spacer
atgccgcaggccgccgcctcggcgcggaaggc Protospacer
.*************** ** **** . .
948. spacer 9.9|58399|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 11, identity: 0.656
ccgccgacgatcaggccgaacgtgccggtcag CRISPR spacer
gaagcgacgatcagctcgaacgtgccgacgcc Protospacer
. ********** .***********..
949. spacer 9.10|58460|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.656
gcgggtgggtcgccgccgaccggcgcaccgcc CRISPR spacer
agcacccggtcggcgccgcccggcgcaccggg Protospacer
. . . ***** ***** ***********
950. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gccgacgatccagcgcacaccggccgcccgtg Protospacer
. ******** ****.********* ..
951. spacer 9.12|58582|32|NC_017766|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656
catttcgatccagagcacgccggccgccgcca CRISPR spacer
gccgacgatccagcgcacaccggccgcccgtg Protospacer
. ******** ****.********* ..