Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017769 Streptococcus pneumoniae ST556, complete sequence 2 crisprs DEDDh,cas3,DinG 0 1 12 0

Results visualization

1. NC_017769
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017769_1 1120403-1120506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017769_2 1449629-1449761 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017769_1 1.1|1120436|38|NC_017769|CRISPRCasFinder 1120436-1120473 38 KY065475 Streptococcus phage IPP35, complete genome 23044-23081 4 0.895
NC_017769_1 1.1|1120436|38|NC_017769|CRISPRCasFinder 1120436-1120473 38 MK448453 Streptococcus satellite phage Javan360, complete genome 13985-14022 5 0.868

1. spacer 1.1|1120436|38|NC_017769|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 4, identity: 0.895

ccctttttttctacaataaaataggctccataatatct	CRISPR spacer
gactttttttctacacaaaaataggctccataatatct	Protospacer
  *************  *********************

2. spacer 1.1|1120436|38|NC_017769|CRISPRCasFinder matches to MK448453 (Streptococcus satellite phage Javan360, complete genome) position: , mismatch: 5, identity: 0.868

ccctttttttctacaataaaataggctccataatatct	CRISPR spacer
gactttttttctacaacaaaataggctccataatattc	Protospacer
  **************.*******************..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13046 : 110163 95 Streptococcus_phage(75.36%) integrase,tRNA,bacteriocin,holin,terminase,transposase,tail,portal,protease,capsid attL 10839:10854|attR 59731:59746
DBSCAN-SWA_2 152026 : 193464 43 Streptococcus_phage(50.0%) transposase,bacteriocin,tRNA NA
DBSCAN-SWA_3 239847 : 247673 13 Streptococcus_phage(75.0%) NA NA
DBSCAN-SWA_4 387790 : 442595 44 Streptococcus_phage(23.08%) transposase,protease,holin,integrase attL 390637:390650|attR 443977:443990
DBSCAN-SWA_5 514174 : 577068 56 Klosneuvirus(18.18%) protease,transposase,bacteriocin,tRNA NA
DBSCAN-SWA_6 807169 : 814175 10 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_7 927868 : 990928 57 Indivirus(15.79%) transposase,protease,holin NA
DBSCAN-SWA_8 1236886 : 1290674 45 Streptococcus_phage(44.44%) integrase,tRNA,bacteriocin,holin,protease,transposase attL 1241252:1241296|attR 1294336:1294380
DBSCAN-SWA_9 1473655 : 1480409 9 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_10 1734911 : 1742242 9 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_11 1823684 : 1850256 29 Streptococcus_phage(92.0%) integrase,bacteriocin attL 1815384:1815399|attR 1852800:1852815
DBSCAN-SWA_12 2129194 : 2137948 9 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage