Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015291 Streptococcus oralis Uo5, complete genome 1 crisprs DEDDh,WYL,cas3,DinG 3 1 6 0

Results visualization

1. NC_015291
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015291_1 563290-563650 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_015291_1 1.3|563456|30|NC_015291|PILER-CR,CRISPRCasFinder,CRT 563456-563485 30 NC_015291.1 1380825-1380854 1 0.967
NC_015291_1 1.4|563521|30|NC_015291|PILER-CR,CRISPRCasFinder,CRT 563521-563550 30 NC_015291.1 584699-584728 1 0.967
NC_015291_1 1.1|563325|31|NC_015291|PILER-CR,CRISPRCasFinder,CRT 563325-563355 31 NC_015291.1 1076286-1076316 2 0.935

1. spacer 1.3|563456|30|NC_015291|PILER-CR,CRISPRCasFinder,CRT matches to position: 1380825-1380854, mismatch: 1, identity: 0.967

cacatcccttcactagagggttggaccttt	CRISPR spacer
cacatcccttcgctagagggttggaccttt	Protospacer
***********.******************

2. spacer 1.4|563521|30|NC_015291|PILER-CR,CRISPRCasFinder,CRT matches to position: 584699-584728, mismatch: 1, identity: 0.967

cttggcgtaggtgggcgtaaaaggcagcaa	CRISPR spacer
cttggcgtaggtgagcgtaaaaggcagcaa	Protospacer
*************.****************

3. spacer 1.1|563325|31|NC_015291|PILER-CR,CRISPRCasFinder,CRT matches to position: 1076286-1076316, mismatch: 2, identity: 0.935

aatggagccgtttgtgttctagctgtgacag	CRISPR spacer
aatggagctgtttgtgtactagctgtgacag	Protospacer
********.******** *************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015291_1 1.5|563586|30|NC_015291|PILER-CR,CRISPRCasFinder,CRT 563586-563615 30 NZ_CP032366 Bacillus wiedmannii strain SR52 plasmid unnamed1, complete sequence 78399-78428 8 0.733

1. spacer 1.5|563586|30|NC_015291|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032366 (Bacillus wiedmannii strain SR52 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

taaggcatttgttagctgtaatggtattaa	CRISPR spacer
tctcttatttgtaagctgtaatgctattat	Protospacer
*    .****** ********** ***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32800 : 44360 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 481569 : 487855 11 Pneumococcus_phage(16.67%) NA NA
DBSCAN-SWA_3 575431 : 584780 13 Streptococcus_phage(42.86%) protease NA
DBSCAN-SWA_4 1198644 : 1207173 10 Streptococcus_phage(87.5%) NA NA
DBSCAN-SWA_5 1269893 : 1277144 10 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_6 1797215 : 1853231 55 Streptococcus_phage(73.91%) protease,integrase,tRNA,bacteriocin,transposase attL 1815866:1815880|attR 1854794:1854808
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage