Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015758 Mycobacterium tuberculosis variant africanum GM041182, complete genome 14 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,cas2,cas1,csm5gr7,csm3gr7,csm2gr11,cas10,cas6 12 33 1 1

Results visualization

1. NC_015758
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_1 329228-329338 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_2 363228-363926 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_3 688888-688964 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_4 836377-837005 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_5 922676-923587 Orphan NA
19 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_6 1209270-1210126 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_7 2087608-2087862 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_8 2169349-2169568 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_9 3095752-3097993 TypeIII II-B,III-A
30 spacers
cas2,cas1,csm5gr7,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_10 3099316-3101478 TypeIII II-B,III-A
29 spacers
cas2,cas1,csm5gr7,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_11 3831520-3831609 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_12 3930562-3930797 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_13 4070071-4070290 Unclear NA
2 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015758_14 4086618-4086706 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 830893-830919 0 1.0
NC_015758_6 6.8|1209698|16|NC_015758|CRISPRCasFinder 1209698-1209713 16 NC_015758.1 2087923-2087938 0 1.0
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1576090-1576108 0 1.0
NC_015758_12 12.1|3930615|45|NC_015758|PILER-CR 3930615-3930659 45 NC_015758.1 3930949-3930993 0 1.0
NC_015758_12 12.1|3930615|45|NC_015758|PILER-CR 3930615-3930659 45 NC_015758.1 3931234-3931278 0 1.0
NC_015758_12 12.2|3930713|51|NC_015758|PILER-CR 3930713-3930763 51 NC_015758.1 3931323-3931373 0 1.0
NC_015758_4 4.5|836634|19|NC_015758|CRT 836634-836652 19 NC_015758.1 2849123-2849141 1 0.947
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 838131-838157 1 0.963
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 922409-922435 1 0.963
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 327992-328018 1 0.963
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 331014-331040 1 0.963
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 333364-333390 1 0.963
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 2413124-2413150 1 0.963
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 833935-833953 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1210922-1210940 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1215111-1215129 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1215183-1215201 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 331409-331427 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 671637-671655 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1633935-1633953 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1636734-1636752 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1639589-1639607 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1640351-1640369 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1989309-1989327 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2060847-2060865 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2061393-2061411 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2327765-2327783 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2788876-2788894 1 0.947
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2792404-2792422 1 0.947
NC_015758_7 7.2|2087689|18|NC_015758|CRT 2087689-2087706 18 NC_015758.1 397810-397827 1 0.944
NC_015758_7 7.2|2087689|18|NC_015758|CRT 2087689-2087706 18 NC_015758.1 604181-604198 1 0.944
NC_015758_7 7.4|2087779|18|NC_015758|CRT 2087779-2087796 18 NC_015758.1 3429192-3429209 1 0.944
NC_015758_2 2.5|363516|42|NC_015758|CRISPRCasFinder 363516-363557 42 NC_015758.1 371531-371572 2 0.952
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NC_015758.1 370346-370378 2 0.939
NC_015758_4 4.5|836634|19|NC_015758|CRT 836634-836652 19 NC_015758.1 883440-883458 2 0.895
NC_015758_4 4.5|836634|19|NC_015758|CRT 836634-836652 19 NC_015758.1 980987-981005 2 0.895
NC_015758_4 4.5|836634|19|NC_015758|CRT 836634-836652 19 NC_015758.1 1571889-1571907 2 0.895
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 834355-834381 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 835501-835527 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 922310-922336 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 1211243-1211269 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 3787007-3787033 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 3923968-3923994 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 3924124-3924150 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 331965-331991 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 332304-332330 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 671965-671991 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 1659318-1659344 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 1861374-1861400 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_015758.1 2060665-2060691 2 0.926
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_015758.1 2947983-2948004 2 0.909
NC_015758_6 6.11|1209836|22|NC_015758|CRISPRCasFinder 1209836-1209857 22 NC_015758.1 834865-834886 2 0.909
NC_015758_6 6.11|1209836|22|NC_015758|CRISPRCasFinder 1209836-1209857 22 NC_015758.1 1215138-1215159 2 0.909
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 335147-335165 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 620845-620863 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 621067-621085 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 837633-837651 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1087339-1087357 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1087987-1088005 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1210325-1210343 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1210841-1210859 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1211132-1211150 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1211150-1211168 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1215429-1215447 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2000732-2000750 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2408972-2408990 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2681569-2681587 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3031162-3031180 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3031261-3031279 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3686055-3686073 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3785579-3785597 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3785762-3785780 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3785930-3785948 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3915170-3915188 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3924346-3924364 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 4070281-4070299 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 4070290-4070308 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 328165-328183 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 329391-329409 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 332516-332534 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 334704-334722 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 334833-334851 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 335100-335118 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 335223-335241 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 359800-359818 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 440145-440163 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 543473-543491 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 670803-670821 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1092039-1092057 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1493832-1493850 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1622352-1622370 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1639454-1639472 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1639463-1639481 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1639676-1639694 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1639727-1639745 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1860959-1860977 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1861487-1861505 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 1988583-1988601 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2088118-2088136 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2296301-2296319 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2347601-2347619 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2413045-2413063 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2555701-2555719 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2782200-2782218 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 2782782-2782800 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3722100-3722118 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3722724-3722742 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3722967-3722985 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3723099-3723117 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 3725124-3725142 2 0.895
NC_015758_6 6.13|1209953|19|NC_015758|CRISPRCasFinder 1209953-1209971 19 NC_015758.1 4013508-4013526 2 0.895

1. spacer 5.19|923543|27|NC_015758|CRT matches to position: 830893-830919, mismatch: 0, identity: 1.0

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggtaacggcgg	Protospacer
***************************

2. spacer 6.8|1209698|16|NC_015758|CRISPRCasFinder matches to position: 2087923-2087938, mismatch: 0, identity: 1.0

gtggctgtacggcgac	CRISPR spacer
gtggctgtacggcgac	Protospacer
****************

3. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1576090-1576108, mismatch: 0, identity: 1.0

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggtggc	Protospacer
*******************

4. spacer 12.1|3930615|45|NC_015758|PILER-CR matches to position: 3930949-3930993, mismatch: 0, identity: 1.0

agcggccggcaccggaggcaccggcggcatgatcggcaccacagg	CRISPR spacer
agcggccggcaccggaggcaccggcggcatgatcggcaccacagg	Protospacer
*********************************************

5. spacer 12.1|3930615|45|NC_015758|PILER-CR matches to position: 3931234-3931278, mismatch: 0, identity: 1.0

agcggccggcaccggaggcaccggcggcatgatcggcaccacagg	CRISPR spacer
agcggccggcaccggaggcaccggcggcatgatcggcaccacagg	Protospacer
*********************************************

6. spacer 12.2|3930713|51|NC_015758|PILER-CR matches to position: 3931323-3931373, mismatch: 0, identity: 1.0

gggccggcgccgacgccgaccagcccggcgccaccggcggcaccgggttcg	CRISPR spacer
gggccggcgccgacgccgaccagcccggcgccaccggcggcaccgggttcg	Protospacer
***************************************************

7. spacer 4.5|836634|19|NC_015758|CRT matches to position: 2849123-2849141, mismatch: 1, identity: 0.947

ggcctccaccgacgtcgcc	CRISPR spacer
ggccgccaccgacgtcgcc	Protospacer
**** **************

8. spacer 5.19|923543|27|NC_015758|CRT matches to position: 838131-838157, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

9. spacer 5.19|923543|27|NC_015758|CRT matches to position: 922409-922435, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

10. spacer 5.19|923543|27|NC_015758|CRT matches to position: 327992-328018, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

11. spacer 5.19|923543|27|NC_015758|CRT matches to position: 331014-331040, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

12. spacer 5.19|923543|27|NC_015758|CRT matches to position: 333364-333390, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

13. spacer 5.19|923543|27|NC_015758|CRT matches to position: 2413124-2413150, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

14. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 833935-833953, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

15. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1210922-1210940, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

16. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1215111-1215129, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

17. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1215183-1215201, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

18. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 331409-331427, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

19. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 671637-671655, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggtggc	Protospacer
******.************

20. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1633935-1633953, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggtggc	Protospacer
********* *********

21. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1636734-1636752, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

22. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1639589-1639607, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

23. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1640351-1640369, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

24. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1989309-1989327, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

25. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2060847-2060865, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

26. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2061393-2061411, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

27. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2327765-2327783, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggtcggtggc	Protospacer
***********.*******

28. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2788876-2788894, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggtggc	Protospacer
** ****************

29. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2792404-2792422, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggtggc	Protospacer
************ ******

30. spacer 7.2|2087689|18|NC_015758|CRT matches to position: 397810-397827, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

31. spacer 7.2|2087689|18|NC_015758|CRT matches to position: 604181-604198, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

32. spacer 7.4|2087779|18|NC_015758|CRT matches to position: 3429192-3429209, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

33. spacer 2.5|363516|42|NC_015758|CRISPRCasFinder matches to position: 371531-371572, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

34. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to position: 370346-370378, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

35. spacer 4.5|836634|19|NC_015758|CRT matches to position: 883440-883458, mismatch: 2, identity: 0.895

ggcctccaccgacgtcgcc	CRISPR spacer
ggcctcccccgacgtagcc	Protospacer
******* ******* ***

36. spacer 4.5|836634|19|NC_015758|CRT matches to position: 980987-981005, mismatch: 2, identity: 0.895

ggcctccaccgacgtcgcc	CRISPR spacer
ggccgccaccgacatcgcc	Protospacer
**** ********.*****

37. spacer 4.5|836634|19|NC_015758|CRT matches to position: 1571889-1571907, mismatch: 2, identity: 0.895

ggcctccaccgacgtcgcc	CRISPR spacer
ggccaccaccgacggcgcc	Protospacer
**** ********* ****

38. spacer 5.19|923543|27|NC_015758|CRT matches to position: 834355-834381, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacgccgg	Protospacer
******************.**** ***

39. spacer 5.19|923543|27|NC_015758|CRT matches to position: 835501-835527, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaccggcggcaacggcgg	Protospacer
*********** ******.********

40. spacer 5.19|923543|27|NC_015758|CRT matches to position: 922310-922336, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggtgg	Protospacer
******************.*****.**

41. spacer 5.19|923543|27|NC_015758|CRT matches to position: 1211243-1211269, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggccacggcgg	Protospacer
******************. *******

42. spacer 5.19|923543|27|NC_015758|CRT matches to position: 3787007-3787033, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctcatcggcaacggcggcaacggcgg	Protospacer
*** **************.********

43. spacer 5.19|923543|27|NC_015758|CRT matches to position: 3923968-3923994, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgctcggcaacggcggtatcggcgg	Protospacer
**** *************** ******

44. spacer 5.19|923543|27|NC_015758|CRT matches to position: 3924124-3924150, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgctcggcaacggcggcaacggcgg	Protospacer
**** *************.********

45. spacer 5.19|923543|27|NC_015758|CRT matches to position: 331965-331991, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcggcaacggcgg	Protospacer
**** *************.********

46. spacer 5.19|923543|27|NC_015758|CRT matches to position: 332304-332330, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggtaacggcggcaacggcgg	Protospacer
*********.********.********

47. spacer 5.19|923543|27|NC_015758|CRT matches to position: 671965-671991, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatgggcaacggcggcaacggcgg	Protospacer
****** ***********.********

48. spacer 5.19|923543|27|NC_015758|CRT matches to position: 1659318-1659344, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggtaacggcggtgacggcgg	Protospacer
*********.*********.*******

49. spacer 5.19|923543|27|NC_015758|CRT matches to position: 1861374-1861400, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcgggaacggcgg	Protospacer
**** ************* ********

50. spacer 5.19|923543|27|NC_015758|CRT matches to position: 2060665-2060691, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcgacggcggtgacggcgg	Protospacer
**********.********.*******

51. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to position: 2947983-2948004, mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tggcgggggtgccggcggtgtc	Protospacer
** *** ***************

52. spacer 6.11|1209836|22|NC_015758|CRISPRCasFinder matches to position: 834865-834886, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgccggtggggcc	Protospacer
*********** ****** ***

53. spacer 6.11|1209836|22|NC_015758|CRISPRCasFinder matches to position: 1215138-1215159, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgtcggtggcgcc	Protospacer
*********** ******.***

54. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 335147-335165, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgccgccggtggc	Protospacer
********  *********

55. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 620845-620863, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggcgccggtggc	Protospacer
** ****** *********

56. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 621067-621085, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

57. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 837633-837651, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

58. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1087339-1087357, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

59. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1087987-1088005, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggaggggccggcggc	Protospacer
****** ********.***

60. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1210325-1210343, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggaggc	Protospacer
******.******** ***

61. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1210841-1210859, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggccggcggc	Protospacer
** ************.***

62. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1211132-1211150, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggcgccggtggc	Protospacer
** ****** *********

63. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1211150-1211168, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggccggcggc	Protospacer
** ************.***

64. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1215429-1215447, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

65. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2000732-2000750, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgtcggcggtgccggtggc	Protospacer
**.****** *********

66. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2408972-2408990, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggtcgatggc	Protospacer
***********.**.****

67. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2681569-2681587, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

68. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3031162-3031180, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

69. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3031261-3031279, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

70. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3686055-3686073, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcgggcccggtggc	Protospacer
***** **** ********

71. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3785579-3785597, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

72. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3785762-3785780, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

73. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3785930-3785948, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

74. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3915170-3915188, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccagcggggccggcggc	Protospacer
****.**********.***

75. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3924346-3924364, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggcacggtggc	Protospacer
**********  *******

76. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 4070281-4070299, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

77. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 4070290-4070308, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

78. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 328165-328183, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

79. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 329391-329409, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

80. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 332516-332534, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

81. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 334704-334722, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

82. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 334833-334851, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

83. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 335100-335118, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggtcggtggc	Protospacer
** ********.*******

84. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 335223-335241, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

85. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 359800-359818, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcggcgccggtggc	Protospacer
***** *** *********

86. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 440145-440163, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggacggtggc	Protospacer
** ******** *******

87. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 543473-543491, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggccgggccggtggc	Protospacer
** **** ***********

88. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 670803-670821, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

89. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1092039-1092057, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

90. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1493832-1493850, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

91. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1622352-1622370, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggagccggtggc	Protospacer
******.**.*********

92. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1639454-1639472, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggcgccggtggc	Protospacer
******.** *********

93. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1639463-1639481, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

94. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1639676-1639694, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

95. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1639727-1639745, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

96. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1860959-1860977, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

97. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1861487-1861505, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

98. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 1988583-1988601, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

99. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2088118-2088136, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

100. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2296301-2296319, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgtcggc	Protospacer
************** .***

101. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2347601-2347619, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

102. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2413045-2413063, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

103. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2555701-2555719, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

104. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2782200-2782218, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcaggcggtgccggtggc	Protospacer
*** ***** *********

105. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 2782782-2782800, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggaccggcggc	Protospacer
**********.****.***

106. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3722100-3722118, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

107. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3722724-3722742, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgcaggtggc	Protospacer
********* ** ******

108. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3722967-3722985, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggtgccggtggc	Protospacer
******.** *********

109. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3723099-3723117, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

110. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 3725124-3725142, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

111. spacer 6.13|1209953|19|NC_015758|CRISPRCasFinder matches to position: 4013508-4013526, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136911 1 0.955
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 KY087993 Mycobacterium phage Hammy, complete genome 24359-24385 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MF140398 Mycobacterium phage Amohnition, complete genome 24446-24472 2 0.926
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MF140406 Mycobacterium phage DarthP, complete genome 24368-24394 2 0.926
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 794580-794601 2 0.909
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 75477-75498 2 0.909
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 713470-713491 2 0.909
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 29437-29458 2 0.909
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 56975-56996 2 0.909
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 458462-458483 2 0.909
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1354617-1354638 2 0.909
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 881389-881410 2 0.909
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_047977 Microbacterium phage Hendrix, complete genome 3065-3086 2 0.909
NC_015758_6 6.15|1210037|22|NC_015758|CRISPRCasFinder 1210037-1210058 22 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 917429-917450 2 0.909
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 MH019216 Streptomyces phage Wentworth, complete genome 60058-60082 3 0.88
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4024254-4024277 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4460576-4460599 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 122201-122224 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 37773-37796 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 116652-116675 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 72348-72371 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 KU716094 Mycobacterium phage Eidsmoe, complete genome 5649-5672 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MH371122 Mycobacterium phage Priya, complete genome 5650-5673 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MK016502 Mycobacterium phage Pat3, complete genome 22827-22850 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MK937593 Mycobacterium phage Flypotenuse, complete genome 23717-23740 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MG872835 Mycobacterium phage Conquerage, complete genome 5649-5672 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MH536820 Mycobacterium phage Glexan, complete genome 23717-23740 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 91001-91024 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 44795-44818 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1701753-1701776 3 0.875
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MH271298 Microbacterium phage Floof, complete genome 37939-37962 3 0.875
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_022087 Mycobacterium phage AnnaL29, complete genome 5558-5584 3 0.889
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 174571-174597 3 0.889
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MN549360 Rhizobium phage RL38J1, complete genome 66420-66446 3 0.889
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 MN703413 Arthrobacter phage Powerpuff, complete genome 38834-38858 3 0.88
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 MT024871 Arthrobacter phage YesChef, complete genome 37693-37717 3 0.88
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 355111-355132 3 0.864
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 58695-58716 3 0.864
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 90623-90644 3 0.864
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1457966-1457987 3 0.864
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 422944-422965 3 0.864
NC_015758_6 6.7|1209653|22|NC_015758|CRISPRCasFinder 1209653-1209674 22 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 3900-3921 3 0.864
NC_015758_6 6.11|1209836|22|NC_015758|CRISPRCasFinder 1209836-1209857 22 NZ_CP048287 Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence 4076-4097 3 0.864
NC_015758_7 7.5|2087818|24|NC_015758|CRT 2087818-2087841 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NC_015758_7 7.5|2087818|24|NC_015758|CRT 2087818-2087841 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NC_015758_2 2.1|363261|27|NC_015758|CRISPRCasFinder 363261-363287 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NC_015758_2 2.1|363261|27|NC_015758|CRISPRCasFinder 363261-363287 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NC_015758_2 2.7|363657|27|NC_015758|CRISPRCasFinder 363657-363683 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NC_015758_4 4.1|836400|34|NC_015758|CRT 836400-836433 34 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 260399-260432 4 0.882
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 196562-196586 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 843598-843622 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 592616-592640 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NZ_CP021410 Celeribacter manganoxidans strain DY25 plasmid pDY25-F, complete sequence 41972-41996 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 102523-102547 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 44808-44832 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 KY555147 Caulobacter phage Ccr34, complete genome 5086-5110 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 KY555147 Caulobacter phage Ccr34, complete genome 210993-211017 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 KY555143 Caulobacter phage Ccr2, complete genome 6129-6153 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 KY555143 Caulobacter phage Ccr2, complete genome 215303-215327 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NC_019410 Caulobacter phage CcrKarma, complete genome 4928-4952 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NC_019410 Caulobacter phage CcrKarma, complete genome 216502-216526 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 KY555146 Caulobacter phage Ccr32, complete genome 5086-5110 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 KY555146 Caulobacter phage Ccr32, complete genome 210553-210577 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 KY555144 Caulobacter phage Ccr5, complete genome 5178-5202 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 KY555144 Caulobacter phage Ccr5, complete genome 213399-213423 4 0.84
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 JX163858 Caulobacter phage phiCbK, complete genome 202746-202770 4 0.84
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 KY945355 Mycobacterium phage Shandong1, complete genome 25634-25660 4 0.852
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 106725-106751 4 0.852
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NC_041888 Mycobacterium phage Tortellini, complete genome 37216-37242 4 0.852
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1096460-1096489 4 0.867
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1898211-1898234 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 261506-261529 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 673134-673157 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 60076-60099 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MN582086 Siphoviridae sp. ctdEk19, complete genome 33324-33347 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 21980-22003 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MT889380 Mycobacterium phage Coco12, complete genome 22623-22646 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NC_023698 Mycobacterium phage Avani, complete genome 21987-22010 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MT114167 Mycobacterium phage Phanphagia, complete genome 22278-22301 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 558871-558894 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1500559-1500582 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 295932-295955 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1116335-1116358 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MN096355 Mycobacterium phage Purky, complete genome 48975-48998 4 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 MK279853 Gordonia phage Gray, complete genome 68404-68427 4 0.833
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MT723940 Mycobacterium phage Ellie, complete genome 24126-24152 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MG198783 Gordonia phage Mahdia, complete genome 21931-21957 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_023067 Streptomyces sp. F2 plasmid pFP3, complete sequence 30855-30881 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP011274 Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence 78443-78469 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 83951-83977 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1813514-1813540 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1820602-1820628 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 454199-454225 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1694896-1694922 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MT889380 Mycobacterium phage Coco12, complete genome 22836-22862 4 0.852
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22517 4 0.852
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 9745-9769 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1906386-1906410 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 794756-794780 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 CP003956 Rhodococcus opacus PD630 plasmid 7, complete sequence 34847-34871 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1665271-1665295 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 15832-15856 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 348896-348920 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 406425-406449 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 26065-26089 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 450297-450321 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NC_022437 Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence 16147-16171 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1382131-1382155 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1418915-1418939 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 118938-118962 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1711697-1711721 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 722328-722352 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 67000-67024 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 118938-118962 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1149411-1149435 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 438623-438647 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 243636-243660 4 0.84
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1410063-1410087 4 0.84
NC_015758_7 7.5|2087818|24|NC_015758|CRT 2087818-2087841 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NC_015758_7 7.5|2087818|24|NC_015758|CRT 2087818-2087841 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NC_015758_7 7.5|2087818|24|NC_015758|CRT 2087818-2087841 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NC_015758_2 2.1|363261|27|NC_015758|CRISPRCasFinder 363261-363287 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NC_015758_2 2.1|363261|27|NC_015758|CRISPRCasFinder 363261-363287 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NC_015758_2 2.7|363657|27|NC_015758|CRISPRCasFinder 363657-363683 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NC_015758_2 2.7|363657|27|NC_015758|CRISPRCasFinder 363657-363683 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NC_015952 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence 129668-129692 5 0.8
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 252446-252470 5 0.8
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1389719-1389743 5 0.8
NC_015758_4 4.3|836532|25|NC_015758|CRT 836532-836556 25 NZ_CP048425 Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence 18587-18611 5 0.8
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 KX683875 Mycobacterium phage Baehexic, complete genome 12181-12207 5 0.815
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 KM197169 Mycobacterium phage Piro94, complete genome 12178-12204 5 0.815
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 MF668269 Mycobacterium phage Drake55, complete genome 12177-12203 5 0.815
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 MK284522 Mycobacterium phage Malec, complete genome 11950-11976 5 0.815
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 KM677210 Mycobacterium phage Larenn, complete genome 11945-11971 5 0.815
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 94545-94574 5 0.833
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 243155-243184 5 0.833
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 1800-1826 5 0.815
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 136919-136945 5 0.815
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 658056-658082 5 0.815
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1514868-1514894 5 0.815
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5852040-5852066 5 0.815
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 235006-235032 5 0.815
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 263243-263269 5 0.815
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 MH576962 Streptomyces phage Satis, complete genome 95306-95332 5 0.815
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 MK620894 Streptomyces phage Kradal, complete genome 95310-95336 5 0.815
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1068923-1068952 5 0.833
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1739900-1739929 5 0.833
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233389-233418 5 0.833
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 44938-44967 5 0.833
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 137673-137702 5 0.833
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 984252-984281 5 0.833
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1598936-1598965 5 0.833
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233398-233427 5 0.833
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292905-292934 5 0.833
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 AY950802 Haloarcula phage SH1, complete genome 16104-16133 5 0.833
NC_015758_5 5.18|923501|24|NC_015758|CRT 923501-923524 24 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 11649-11672 5 0.792
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3050221-3050247 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 351029-351055 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 67859-67885 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 13686-13712 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 141160-141186 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 107345-107371 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 76100-76126 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 954137-954163 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 954235-954261 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 957327-957353 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 3110-3136 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 637890-637916 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 282741-282767 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 11750-11776 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MK814754 Mycobacterium phage Sumter, complete genome 28141-28167 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MK814754 Mycobacterium phage Sumter, complete genome 28639-28665 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MN369739 Mycobacterium phage Kenuha5, complete genome 22588-22614 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MK967397 Mycobacterium phage Mahavrat, complete genome 24814-24840 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MH001451 Mycobacterium phage Nairb, complete genome 21242-21268 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 KY348865 Mycobacterium phage Bubbles123, complete genome 25540-25566 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MN428047 Mycobacterium phage Doomphist, complete genome 24962-24988 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MT771340 Mycobacterium phage Jorgensen, complete genome 28476-28502 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MF155936 Mycobacterium phage ZenTime222, complete genome 21242-21268 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 KF614509 Rhizobium phage vB_RleS_L338C, complete genome 100818-100844 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MK305886 Mycobacterium phage Poenanya, complete genome 24962-24988 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 JN859129 Mycobacterium virus DotProduct, complete genome 24829-24855 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MK494089 Mycobacterium phage Ibrahim, complete genome 21242-21268 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_024135 Mycobacterium phage Bernal13, complete genome 21242-21268 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_011054 Mycobacterium phage Boomer, complete genome 24637-24663 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 KM591905 Mycobacterium phage RonRayGun, complete genome 21242-21268 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MN735432 Mycobacteriophage Whitty, complete genome 21242-21268 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1425048-1425074 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 326423-326449 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1547236-1547262 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1481197-1481223 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1347491-1347517 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 537266-537292 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1492767-1492793 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1409701-1409727 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1346513-1346539 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1391887-1391913 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1391878-1391904 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1347483-1347509 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1346836-1346862 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1347474-1347500 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1486112-1486138 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1425194-1425220 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1175053-1175079 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 90307-90333 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1425176-1425202 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1425161-1425187 5 0.815
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MT778840 Rhizobium phage P11VFA, complete genome 100109-100135 5 0.815
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MG925349 Mycobacterium phage Mendokysei, complete genome 21052-21085 5 0.853
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3841167-3841191 5 0.8
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 157500-157524 5 0.8
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 179155-179179 5 0.8
NC_015758_6 6.4|1209473|25|NC_015758|CRISPRCasFinder 1209473-1209497 25 NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 67026-67050 5 0.8
NC_015758_2 2.1|363261|27|NC_015758|CRISPRCasFinder 363261-363287 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NC_015758_2 2.7|363657|27|NC_015758|CRISPRCasFinder 363657-363683 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NC_015758_2 2.9|363807|27|NC_015758|CRISPRCasFinder 363807-363833 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NC_015758_2 2.10|363867|27|NC_015758|CRISPRCasFinder 363867-363893 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 266274-266304 6 0.806
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1540611-1540641 6 0.806
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 255204-255234 6 0.806
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 658647-658673 6 0.778
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 NC_023606 Mycobacterium phage CRB1, complete genome 11649-11675 6 0.778
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 MK524491 Mycobacterium phage Whabigail7, complete genome 12139-12165 6 0.778
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 KX619650 Mycobacterium phage Jerm, complete genome 12089-12115 6 0.778
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 MN585998 Mycobacterium phage Bugsy, complete genome 12128-12154 6 0.778
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 JN408460 Mycobacterium phage Turbido, complete genome 12151-12177 6 0.778
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 MH077576 Mycobacterium phage AbbyPaige, complete genome 12129-12155 6 0.778
NC_015758_5 5.5|922922|27|NC_015758|CRT 922922-922948 27 MH825704 Mycobacterium phage LilTurb, complete genome 12148-12174 6 0.778
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1925675-1925704 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 2140117-2140146 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1976527-1976556 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1925852-1925881 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1976547-1976576 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1976525-1976554 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1925295-1925324 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1925239-1925268 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 2068574-2068603 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 94975-95004 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 2026793-2026822 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 176045-176074 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 94722-94751 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 165131-165160 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 50987-51016 6 0.8
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 460274-460303 6 0.8
NC_015758_5 5.12|923216|27|NC_015758|CRT 923216-923242 27 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 147990-148016 6 0.778
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 508-537 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 280809-280838 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 561652-561681 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554428-554457 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542116-542145 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 610786-610815 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571170-571199 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1563589-1563618 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 421135-421164 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1217050-1217079 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1265979-1266008 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1135414-1135443 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP037868 Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence 5790-5819 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1195134-1195163 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1134511-1134540 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 762260-762289 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168711-1168740 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168700-1168729 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1135406-1135435 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134762-1134791 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1135397-1135426 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1217165-1217194 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1217149-1217178 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1217142-1217171 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_019408 Caulobacter phage CcrRogue, complete genome 180466-180495 6 0.8
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 174181-174210 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 270228-270257 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 MK937608 Microbacterium phage Cressida, complete genome 54022-54051 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554437-554466 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542125-542154 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP017592 Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence 7337-7366 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP008898 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence 43955-43984 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 73653-73682 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 36331-36360 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571179-571208 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 317155-317184 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 116386-116415 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 79588-79617 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 132572-132601 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 26128-26157 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 132570-132599 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 32030-32059 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14031-14060 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 17715-17744 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 19031-19060 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1930897-1930926 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190353-190382 6 0.8
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 MH029534 Myoviridae environmental samples clone NHS-Seq2, complete sequence 34123-34152 6 0.8
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211450-2211476 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350669-350695 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3465308-3465334 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 750706-750732 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455044-455070 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 25156-25182 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1244998-1245024 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52095-52121 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 282903-282929 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MT939492 Xanthomonas phage Xoo-sp14, complete genome 88792-88818 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MF919498 Mycobacterium phage Cindaradix, complete genome 3036-3062 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 KR997929 Mycobacterium phage Barriga, complete genome 28338-28364 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MH576971 Mycobacterium phage Arlo, complete genome 28739-28765 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_028815 Mycobacterium phage Nhonho, complete genome 29082-29108 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1732371-1732397 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 120441-120467 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 179896-179922 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 74237-74263 6 0.778
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 524877-524903 6 0.778
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466597-3466630 6 0.824
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210883-2210916 6 0.824
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283764-283797 6 0.824
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445248-445281 6 0.824
NC_015758_2 2.4|363456|27|NC_015758|CRISPRCasFinder 363456-363482 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 178334-178364 7 0.774
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 244637-244667 7 0.774
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1328751-1328780 7 0.767
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 803623-803652 7 0.767
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 47988-48017 7 0.767
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 273279-273308 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 943873-943902 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 392100-392129 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1838430-1838459 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 616186-616215 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 397449-397478 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1703655-1703684 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 212329-212358 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 679499-679528 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1744018-1744047 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1760732-1760761 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 178925-178954 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 75369-75398 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 153012-153041 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 589998-590027 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 81538-81567 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 845884-845913 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 258296-258325 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1723933-1723962 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1859622-1859651 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 137321-137350 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 258496-258525 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 257917-257946 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 234345-234374 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 461507-461536 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 254201-254230 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 236985-237014 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 298368-298397 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 258487-258516 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 461579-461608 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 390422-390451 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1964821-1964850 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 461516-461545 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 237930-237959 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 849014-849043 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1227007-1227036 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 238244-238273 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 245279-245308 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 235437-235466 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 126762-126791 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 234570-234599 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 258309-258338 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 231309-231338 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 235690-235719 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 238261-238290 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 251052-251081 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 298440-298469 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 230351-230380 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 461938-461967 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 438995-439024 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 245262-245291 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 245236-245265 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 241864-241893 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 240004-240033 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 235466-235495 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 280525-280554 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 251050-251079 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 HM560026 Uncultured bacterium plasmid pTRACA45, complete sequence 1764-1793 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_010867 Neisseria lactamica plasmid pNL3.1, complete sequence 3216-3245 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 121720-121749 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 535160-535189 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 326858-326887 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121664-121693 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 KT997827 Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome 28429-28458 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 235977-236006 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1424992-1425021 7 0.767
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 KT997829 Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome 24686-24715 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 278785-278814 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 113824-113853 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 158849-158878 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 384914-384943 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 317121-317150 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 385410-385439 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 260932-260961 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 329309-329338 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 391416-391445 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 243975-244004 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 301676-301705 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 201076-201105 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 635292-635321 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 422833-422862 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 494408-494437 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 MN582086 Siphoviridae sp. ctdEk19, complete genome 33318-33347 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 864583-864612 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP022700 Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence 61493-61522 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1238691-1238720 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1484042-1484071 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1466967-1466996 7 0.767
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 119508-119537 7 0.767
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3050899-3050925 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350099-350125 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350108-350134 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MN369764 Mycobacterium phage Rahalelujah, complete genome 24340-24366 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MK524490 Mycobacterium phage Donny, complete genome 33811-33837 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MT522000 Mycobacterium phage Soul22, complete genome 22192-22218 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22190-22216 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 AY129336 Mycobacteriophage Che9d, complete genome 22205-22231 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MK967392 Gordonia phage GrandSlam, complete genome 24586-24612 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MK359343 Mycobacterium phage Pollywog, complete genome 23655-23681 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_042030 Mycobacterium phage Yoshi, complete sequence 22193-22219 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_048729 Mycobacterium phage Renaud18, complete genome 22865-22891 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MH669001 Mycobacterium phage EleanorGeorge, complete genome 25342-25368 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_026585 Mycobacteriophage Estave1, complete genome 22558-22584 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MG925354 Mycobacterium phage Ogopogo, complete genome 22785-22811 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_023698 Mycobacterium phage Avani, complete genome 22197-22223 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 JN699007 Mycobacterium phage Acadian, complete genome 33806-33832 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MT889381 Mycobacterium phage Suigeneris, complete genome 33811-33837 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 MH077585 Mycobacterium phage TChen, complete genome 22970-22996 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_048788 Mycobacterium phage ThetaBob, complete genome 22783-22809 7 0.741
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 KC736071 Mycobacterium phage WIVsmall, complete genome 29690-29716 7 0.741
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210628-2210661 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2209827-2209860 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 24930-24963 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2133215-2133248 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MT889380 Mycobacterium phage Coco12, complete genome 22836-22869 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22524 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 531146-531179 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 117310-117343 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 254574-254607 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP039641 Azospirillum sp. TSH100 plasmid p2, complete sequence 30914-30947 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH697583 Mycobacterium phage EricMillard, complete genome 32257-32290 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH727551 Mycobacterium phage Kalah2, complete genome 32307-32340 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH077579 Mycobacterium phage Halley, complete genome 31970-32003 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH669017 Mycobacterium phage Zelink, complete genome 33051-33084 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN062701 Mycobacterium phage Dallas, complete genome 31496-31529 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK524527 Mycobacterium phage ThreeRngTarjay, complete genome 32107-32140 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK524529 Mycobacterium phage Phoebus, complete genome 32257-32290 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MF919512 Mycobacterium phage Klein, complete genome 31531-31564 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 KF114875 Mycobacterium phage Redno2, complete genome 31720-31753 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK967379 Mycobacterium phage HokkenD, complete genome 31519-31552 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 307986-308019 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 178492-178525 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 275379-275412 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445383-445416 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 275378-275411 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN813686 Mycobacterium phage BirdsNest, complete genome 30327-30360 7 0.794
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 31516-31549 7 0.794
NC_015758_6 6.9|1209737|37|NC_015758|CRISPRCasFinder 1209737-1209773 37 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136926 7 0.811
NC_015758_7 7.3|2087728|30|NC_015758|CRT 2087728-2087757 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NC_015758_7 7.3|2087728|30|NC_015758|CRT 2087728-2087757 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NC_015758_7 7.3|2087728|30|NC_015758|CRT 2087728-2087757 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NC_015758_4 4.1|836400|34|NC_015758|CRT 836400-836433 34 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 1018454-1018487 8 0.765
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 575000-575030 8 0.742
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 137858-137888 8 0.742
NC_015758_4 4.6|836676|34|NC_015758|CRT 836676-836709 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2205840-2205873 8 0.765
NC_015758_4 4.7|836733|31|NC_015758|CRT 836733-836763 31 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 272581-272611 8 0.742
NC_015758_4 4.7|836733|31|NC_015758|CRT 836733-836763 31 NC_011044 Mycobacterium phage Nigel, complete genome 16897-16927 8 0.742
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1255759-1255788 8 0.733
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 53329-53358 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2714450-2714479 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 837910-837939 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 424702-424731 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 975216-975245 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1013021-1013050 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_KY126370 Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence 93253-93282 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 22400-22429 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1889334-1889363 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 21202-21231 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 30108-30137 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 32856-32885 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 111116-111145 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 KY555144 Caulobacter phage Ccr5, complete genome 178242-178271 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_KP873172 Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence 21059-21088 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 159096-159125 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 50097-50126 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 15249-15278 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP024682 Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence 41943-41972 8 0.733
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 242723-242752 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 28649-28678 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 310870-310899 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 462801-462830 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 292109-292138 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 287383-287412 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 292305-292334 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 292675-292704 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 306458-306487 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 292675-292704 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 295900-295929 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 292670-292699 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 306458-306487 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 292305-292334 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 298287-298316 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1682210-1682239 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 294530-294559 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 375826-375855 8 0.733
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 112972-113001 8 0.733
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466471-3466504 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350662-350695 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350530-350563 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3051061-3051094 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36586-36619 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_047958 Burkholderia phage vB_BmuP_KL4, complete genome 28566-28599 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117037-117070 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 928385-928418 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 131278-131311 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117079-117112 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117037-117070 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 670302-670335 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1123064-1123097 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 530145-530178 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 187401-187434 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN234223 Mycobacterium phage Philly, complete genome 30948-30981 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 KJ194581 Mycobacterium phage Audrey, complete genome 31094-31127 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH051265 Mycobacterium phage Yahalom, complete genome 31107-31140 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH316565 Mycobacterium phage Mortcellus, complete genome 31732-31765 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MT310871 Mycobacterium phage Jackstina, complete genome 31017-31050 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 EU816589 Mycobacterium phage Phaedrus, complete genome 31013-31046 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MT952851 Mycobacterium phage Gervas, complete genome 31075-31108 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MG920059 Mycobacterium phage Baloo, complete genome 31097-31130 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_023686 Mycobacterium phage Gadjet, complete genome 31104-31137 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_041965 Mycobacterium phage Athena, complete genome 31845-31878 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 DQ398049 Mycobacterium phage Pipefish, complete genome 32489-32522 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MT310892 Mycobacterium phage Compostia, complete genome 31524-31557 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN699018 Mycobacterium phage Kamiyu, complete genome 31063-31096 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687345-687378 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 118498-118531 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 539300-539333 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK814754 Mycobacterium phage Sumter, complete genome 28141-28174 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK814754 Mycobacterium phage Sumter, complete genome 28639-28672 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN369739 Mycobacterium phage Kenuha5, complete genome 22588-22621 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK967397 Mycobacterium phage Mahavrat, complete genome 24814-24847 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MT522000 Mycobacterium phage Soul22, complete genome 22192-22225 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 KY348865 Mycobacterium phage Bubbles123, complete genome 25540-25573 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN428047 Mycobacterium phage Doomphist, complete genome 24962-24995 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22190-22223 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 AY129336 Mycobacteriophage Che9d, complete genome 22205-22238 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MT771340 Mycobacterium phage Jorgensen, complete genome 28476-28509 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK359343 Mycobacterium phage Pollywog, complete genome 23655-23688 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_042030 Mycobacterium phage Yoshi, complete sequence 22193-22226 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_048729 Mycobacterium phage Renaud18, complete genome 22865-22898 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_026585 Mycobacteriophage Estave1, complete genome 22558-22591 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK305886 Mycobacterium phage Poenanya, complete genome 24962-24995 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN859129 Mycobacterium virus DotProduct, complete genome 24829-24862 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MG925354 Mycobacterium phage Ogopogo, complete genome 22785-22818 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN698995 Mycobacterium phage Dori, complete genome 28163-28196 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_023698 Mycobacterium phage Avani, complete genome 22197-22230 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_011054 Mycobacterium phage Boomer, complete genome 24637-24670 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN234184 Mycobacterium phage IdentityCrisis, complete genome 19984-20017 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH077585 Mycobacterium phage TChen, complete genome 22970-23003 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_048788 Mycobacterium phage ThetaBob, complete genome 22783-22816 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 125963-125996 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 138036-138069 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN096355 Mycobacterium phage Purky, complete genome 13505-13538 8 0.765
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN234183 Mycobacterium phage Antsirabe, complete genome 23060-23093 8 0.765
NC_015758_6 6.9|1209737|37|NC_015758|CRISPRCasFinder 1209737-1209773 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 683728-683764 8 0.784
NC_015758_7 7.3|2087728|30|NC_015758|CRT 2087728-2087757 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NC_015758_7 7.3|2087728|30|NC_015758|CRT 2087728-2087757 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NC_015758_10 10.30|3100018|29|NC_015758|PILER-CR 3100018-3100046 29 MK599315 Pseudomonas phage PA1C, complete genome 299172-299200 8 0.724
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NC_015758_3 3.1|688911|31|NC_015758|CRISPRCasFinder 688911-688941 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NC_015758_4 4.1|836400|34|NC_015758|CRT 836400-836433 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1648791-1648824 9 0.735
NC_015758_4 4.1|836400|34|NC_015758|CRT 836400-836433 34 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1767990-1768023 9 0.735
NC_015758_4 4.1|836400|34|NC_015758|CRT 836400-836433 34 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1767936-1767969 9 0.735
NC_015758_4 4.1|836400|34|NC_015758|CRT 836400-836433 34 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 252273-252306 9 0.735
NC_015758_4 4.1|836400|34|NC_015758|CRT 836400-836433 34 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 250549-250582 9 0.735
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP010616 Phaeobacter inhibens strain P92 plasmid pP92_f, complete sequence 7033-7063 9 0.71
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP010635 Phaeobacter inhibens strain P78 plasmid pP78_f, complete sequence 7033-7063 9 0.71
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 41595-41625 9 0.71
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP010755 Phaeobacter inhibens strain P70 plasmid pP70_f, complete sequence 7033-7063 9 0.71
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP010713 Phaeobacter inhibens strain P66 plasmid pP66_h, complete sequence 7032-7062 9 0.71
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NZ_CP010740 Phaeobacter inhibens strain P72 plasmid pP72_e, complete sequence 7033-7063 9 0.71
NC_015758_4 4.4|836580|31|NC_015758|CRT 836580-836610 31 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 2621-2651 9 0.71
NC_015758_4 4.6|836676|34|NC_015758|CRT 836676-836709 34 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 15396-15429 9 0.735
NC_015758_4 4.6|836676|34|NC_015758|CRT 836676-836709 34 NC_008697 Nocardioides sp. JS614 plasmid pNOCA01, complete sequence 82457-82490 9 0.735
NC_015758_4 4.6|836676|34|NC_015758|CRT 836676-836709 34 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 84043-84076 9 0.735
NC_015758_4 4.7|836733|31|NC_015758|CRT 836733-836763 31 NZ_CP046571 Xanthomonas albilineans strain Xa-FJ1 plasmid pXaFJ1, complete sequence 12159-12189 9 0.71
NC_015758_5 5.8|923057|30|NC_015758|CRT 923057-923086 30 NZ_CP021026 Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence 272281-272310 9 0.7
NC_015758_5 5.15|923357|30|NC_015758|CRT 923357-923386 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5046041-5046070 9 0.7
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 65937-65966 9 0.7
NC_015758_5 5.17|923453|30|NC_015758|CRT 923453-923482 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 65937-65966 9 0.7
NC_015758_5 5.19|923543|27|NC_015758|CRT 923543-923569 27 NC_017553 Pantoea ananatis PA13 plasmid PAGR_p, complete sequence 195315-195341 9 0.667
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350101-350134 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210928-2210961 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 231456-231489 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306612-306645 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283233-283266 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 EF602154 Burkholderia phage BcepNY3, complete genome 21505-21538 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 23287-23320 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_005263 Burkholderia phage Bcep1, complete genome 23287-23320 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 307143-307176 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 298112-298145 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 723127-723160 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP053906 Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence 19270-19303 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 15929-15962 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 652970-653003 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 490801-490834 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 637964-637997 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 235008-235041 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 646029-646062 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 635838-635871 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 684904-684937 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1303766-1303799 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 897262-897295 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 233325-233358 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 560015-560048 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1424629-1424662 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 796570-796603 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 659643-659676 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1083784-1083817 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1052610-1052643 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1150006-1150039 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 654523-654556 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 771404-771437 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 290861-290894 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 371773-371806 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1224363-1224396 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 997046-997079 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1083789-1083822 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH001451 Mycobacterium phage Nairb, complete genome 21242-21275 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MF155936 Mycobacterium phage ZenTime222, complete genome 21242-21275 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH588544 Caulobacter phage CcrBL10, complete genome 39042-39075 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK494089 Mycobacterium phage Ibrahim, complete genome 21242-21275 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_024135 Mycobacterium phage Bernal13, complete genome 21242-21275 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 KM591905 Mycobacterium phage RonRayGun, complete genome 21242-21275 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN735432 Mycobacteriophage Whitty, complete genome 21242-21275 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 82507-82540 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 82532-82565 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 82528-82561 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 90688-90721 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 82645-82678 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 55533-55566 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 318448-318481 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 81659-81692 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 84861-84894 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 135548-135581 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 498515-498548 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 927230-927263 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 241368-241401 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455289-455322 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 241368-241401 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 239809-239842 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 244056-244089 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 238174-238207 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 131481-131514 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 241368-241401 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 747004-747037 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 KC736071 Mycobacterium phage WIVsmall, complete genome 29683-29716 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 171949-171982 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52095-52128 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 129601-129634 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 301604-301637 9 0.735
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 779027-779060 9 0.735
NC_015758_6 6.9|1209737|37|NC_015758|CRISPRCasFinder 1209737-1209773 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 686592-686628 9 0.757
NC_015758_9 9.50|3097267|37|NC_015758|CRISPRCasFinder,CRT 3097267-3097303 37 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 74714-74750 9 0.757
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NC_015758_2 2.6|363591|33|NC_015758|CRISPRCasFinder 363591-363623 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NC_015758_5 5.2|922769|39|NC_015758|CRT 922769-922807 39 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 107058-107096 10 0.744
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210946-2210979 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1732364-1732397 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 21676-21709 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 CP000620 Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence 96060-96093 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 93944-93977 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 98684-98717 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK524490 Mycobacterium phage Donny, complete genome 33811-33844 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MK494095 Mycobacterium phage Daegal, complete genome 5959-5992 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN699007 Mycobacterium phage Acadian, complete genome 33806-33839 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MT889381 Mycobacterium phage Suigeneris, complete genome 33811-33844 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 47518-47551 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 AP018709 Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence 27460-27493 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 194712-194745 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 362178-362211 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 10252-10285 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 677361-677394 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 8446-8479 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 65893-65926 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 640930-640963 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 104485-104518 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 31366-31399 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_008385 Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence 29995-30028 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 16577-16610 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 15929-15962 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_MN366359 Bacterium plasmid pALTS31, complete sequence 15929-15962 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100724-100757 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 31148-31181 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 12357-12390 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 25168-25201 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 17683-17716 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1350942-1350975 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 136497-136530 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 46815-46848 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 25131-25164 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JX469829 Uncultured bacterium plasmid pB1, complete sequence 16215-16248 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 15929-15962 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 15931-15964 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 15929-15962 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 15932-15965 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 15939-15972 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 15929-15962 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 15929-15962 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 15929-15962 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 15929-15962 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 16066-16099 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_001381 Mycobacterium fortuitum plasmid pAL5000, complete sequence 2682-2715 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 31441-31474 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP021650 Acidovorax sp. T1 plasmid p2-T1, complete sequence 40579-40612 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 15940-15973 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 50284-50317 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 AJ639924 Uncultured bacterium plasmid pB3 complete genome 17431-17464 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 KU356987 Variovorax paradoxus plasmid pBS64, complete sequence 15928-15961 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 KU356988 Variovorax paradoxus plasmid pHB44, complete sequence 15930-15963 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 155712-155745 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP009797 Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence 16433-16466 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_013176 Pseudomonas putida plasmid pW2, complete sequence 10533-10566 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 49358-49391 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP017455 Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence 23524-23557 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 71777-71810 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 15940-15973 10 0.706
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MN234219 Mycobacterium phage Mercurio, complete genome 23308-23341 10 0.706
NC_015758_6 6.9|1209737|37|NC_015758|CRISPRCasFinder 1209737-1209773 37 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 331923-331959 10 0.73
NC_015758_6 6.9|1209737|37|NC_015758|CRISPRCasFinder 1209737-1209773 37 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 716620-716656 10 0.73
NC_015758_9 9.21|3097269|38|NC_015758|PILER-CR 3097269-3097306 38 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 74714-74751 10 0.737
NC_015758_9 9.41|3096599|35|NC_015758|CRISPRCasFinder,CRT 3096599-3096633 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350092-350125 11 0.676
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 239254-239287 11 0.676
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MH051334 Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome 23136-23169 11 0.676
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 MG852086 Escherichia phage vB_EcoS-Ro145clw, complete genome 41310-41343 11 0.676
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261086-261119 11 0.676
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 584732-584765 11 0.676
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 70292-70325 11 0.676
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 507461-507494 11 0.676
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 155836-155869 11 0.676
NC_015758_6 6.5|1209521|40|NC_015758|CRISPRCasFinder 1209521-1209560 40 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261884-261923 11 0.725
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190139-190172 12 0.647
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_CP026703 Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence 14966-14999 12 0.647
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 302491-302524 14 0.588
NC_015758_6 6.3|1209416|34|NC_015758|CRISPRCasFinder 1209416-1209449 34 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 282346-282379 15 0.559

1. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtgcc	Protospacer
********************.*

2. spacer 5.19|923543|27|NC_015758|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcgg	Protospacer
** ******** ***************

3. spacer 5.19|923543|27|NC_015758|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcgg	Protospacer
** ******** ***************

4. spacer 5.19|923543|27|NC_015758|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcgg	Protospacer
** ******** ***************

5. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtggg	Protospacer
********************  

6. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
agtcggcggtgccgacggtgtc	Protospacer
 *************.*******

7. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggcgtc	Protospacer
.*****************.***

8. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgtcggcggtgtc	Protospacer
.**********.**********

9. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggcggcgtc	Protospacer
 *****************.***

10. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

11. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

12. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggccgtgtc	Protospacer
 *************** *****

13. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgacggcggtgccggcggtgtg	Protospacer
** ****************** 

14. spacer 6.15|1210037|22|NC_015758|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909

ggacggtggtaccggcggtcag	CRISPR spacer
tgacggtggtgccggcggtcag	Protospacer
 *********.***********

15. spacer 4.3|836532|25|NC_015758|CRT matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 3, identity: 0.88

aaacgccttcggcgctggcgaggtc	CRISPR spacer
caacgccttcgccgctggcgagatc	Protospacer
 ********** **********.**

16. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgacctcggcggcgcgggcga	Protospacer
.***************** ****.

17. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctgggcggcgctggcgg	Protospacer
 ****.*** **************

18. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

19. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
agccgacctcggcggcgatggcgc	Protospacer
*.*************** ***** 

20. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

21. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

22. spacer 5.18|923501|24|NC_015758|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

23. spacer 5.18|923501|24|NC_015758|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

24. spacer 5.18|923501|24|NC_015758|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

25. spacer 5.18|923501|24|NC_015758|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

26. spacer 5.18|923501|24|NC_015758|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

27. spacer 5.18|923501|24|NC_015758|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

28. spacer 5.18|923501|24|NC_015758|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aaccggcctcggcggcgctgccgc	Protospacer
*****.************** ** 

29. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccgagctcggcggcgctgccgg	Protospacer
 ***** ************* ***

30. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctcggcggcgcgggcgg	Protospacer
 ****.************ *****

31. spacer 5.18|923501|24|NC_015758|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aacccacctcggcggcgatggcgc	Protospacer
**** ************ ***** 

32. spacer 5.19|923543|27|NC_015758|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 3, identity: 0.889

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cgtgatcggcaacggcggaaacggcgg	Protospacer
  **************** ********

33. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 3, identity: 0.889

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcta	Protospacer
******************.****** .

34. spacer 5.19|923543|27|NC_015758|CRT matches to MN549360 (Rhizobium phage RL38J1, complete genome) position: , mismatch: 3, identity: 0.889

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cgctgg-cggcaaaggcggtaacggcgg	Protospacer
 ****. ****** **************

35. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

36. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

37. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

38. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

39. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

40. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

41. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtggt	Protospacer
.******************* .

42. spacer 6.7|1209653|22|NC_015758|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
catcggcggtgccggcggtgtg	Protospacer
..******************* 

43. spacer 6.11|1209836|22|NC_015758|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864

gctgtggggcggcggtggtgcc	CRISPR spacer
cgtgtggggcggcggtggtgca	Protospacer
  ******************* 

44. spacer 7.5|2087818|24|NC_015758|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

45. spacer 7.5|2087818|24|NC_015758|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

46. spacer 2.1|363261|27|NC_015758|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

47. spacer 2.1|363261|27|NC_015758|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

48. spacer 2.7|363657|27|NC_015758|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

49. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

50. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

51. spacer 4.1|836400|34|NC_015758|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

caacggcgggcccggcgggtggttgatcggcaac	CRISPR spacer
caacggcgcacccggcgggtggttgatcggtgac	Protospacer
******** .********************..**

52. spacer 4.3|836532|25|NC_015758|CRT matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
cctcgccttcggcgctggcgaggta	Protospacer
   ********************* 

53. spacer 4.3|836532|25|NC_015758|CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
ccacgccttcggcggtgccgaggtc	Protospacer
  ************ ** *******

54. spacer 4.3|836532|25|NC_015758|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
taaagccttcggcgctggcgacgta	Protospacer
 ** ***************** ** 

55. spacer 4.3|836532|25|NC_015758|CRT matches to NZ_CP021410 (Celeribacter manganoxidans strain DY25 plasmid pDY25-F, complete sequence) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
tgacgcctacggcgcgggcgaggtc	Protospacer
 .****** ****** *********

56. spacer 4.3|836532|25|NC_015758|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
caacgcctacggcgctcgcgaggtg	Protospacer
 ******* ******* ******* 

57. spacer 4.3|836532|25|NC_015758|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
cacagccctcggcgctggcgaggtc	Protospacer
 *  ***.*****************

58. spacer 4.3|836532|25|NC_015758|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

59. spacer 4.3|836532|25|NC_015758|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

60. spacer 4.3|836532|25|NC_015758|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

61. spacer 4.3|836532|25|NC_015758|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

62. spacer 4.3|836532|25|NC_015758|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

63. spacer 4.3|836532|25|NC_015758|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

64. spacer 4.3|836532|25|NC_015758|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

65. spacer 4.3|836532|25|NC_015758|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

66. spacer 4.3|836532|25|NC_015758|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

67. spacer 4.3|836532|25|NC_015758|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

68. spacer 4.3|836532|25|NC_015758|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 4, identity: 0.84

aaacgccttcggcgctggcgaggtc	CRISPR spacer
aaaccccttcggccctggcgaggcg	Protospacer
**** ******** *********. 

69. spacer 5.12|923216|27|NC_015758|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgcatccggcggcggcggttgcgttct	Protospacer
** **************** ***** .

70. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggcctcggcggcggcggtggcgttgc	Protospacer
*** ..*************.*******

71. spacer 5.12|923216|27|NC_015758|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggccgcggcggcggcggtagcggtgc	Protospacer
*** . ***************** ***

72. spacer 5.17|923453|30|NC_015758|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc	Protospacer
 ************ ********* ***.** 

73. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

74. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
gcccgatctcggcggcgctggcgt	Protospacer
. ****.**************** 

75. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

76. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgtcgacgtcggcggcgctggcgg	Protospacer
 ..**** ****************

77. spacer 5.18|923501|24|NC_015758|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cttcgacttcggcggcgctggcgg	Protospacer
  .****.****************

78. spacer 5.18|923501|24|NC_015758|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

79. spacer 5.18|923501|24|NC_015758|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

80. spacer 5.18|923501|24|NC_015758|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

81. spacer 5.18|923501|24|NC_015758|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

82. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgccgacctcggcggcggtggcga	Protospacer
 .*************** *****.

83. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

84. spacer 5.18|923501|24|NC_015758|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

85. spacer 5.18|923501|24|NC_015758|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tctcgacctcggcggcgatggcgg	Protospacer
  .************** ******

86. spacer 5.18|923501|24|NC_015758|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tgccgacctcggctgcgctggcgc	Protospacer
 .*********** ********* 

87. spacer 5.18|923501|24|NC_015758|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ggtcgacctcgacggcgctggcgg	Protospacer
...********.************

88. spacer 5.19|923543|27|NC_015758|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cgttgtcggcaacggcggtaacggcgg	Protospacer
  * .**********************

89. spacer 5.19|923543|27|NC_015758|CRT matches to MG198783 (Gordonia phage Mahdia, complete genome) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ccagaccggcaacggcggtaacggcgt	Protospacer
 * **.******************** 

90. spacer 5.19|923543|27|NC_015758|CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 4, identity: 0.852

--gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggccgg--ggcaacggcggtaacggcgg	Protospacer
  **.*.  ********************

91. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ggtgatcgtcaacggcggcaacggcga	Protospacer
* ****** *********.*******.

92. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgctcggccacggcggtaacggctg	Protospacer
 *** ***** ************** *

93. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgatcggcaacggcggtgacgacag	Protospacer
 ******************.***.*.*

94. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgatcggcaacggcggtgacgacag	Protospacer
 ******************.***.*.*

95. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcgggaacaaccg	Protospacer
****************** ***..* *

96. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

--gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tagcgg--cggcaacggcggtagcggcgg	Protospacer
  ** *  **************.******

97. spacer 5.19|923543|27|NC_015758|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.852

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg	Protospacer
 **.*. ************.********

98. spacer 5.19|923543|27|NC_015758|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.852

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg	Protospacer
 **.*. ************.********

99. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

100. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

101. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

102. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gtccggcggccttggcgtagcgcct	Protospacer
  **********.***********.

103. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

104. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggccccggcgtcgcgcga	Protospacer
***********.****** ****  

105. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtaatggtc	Protospacer
*******************..* .*

106. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcatcggcgtagcggcg	Protospacer
.********* *********** * 

107. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcctccgcgtcgcgcct	Protospacer
.************ **** *****.

108. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcgggc	Protospacer
.*.*******************  *

109. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggccgcgtcgtagcgcca	Protospacer
.********** ** ********* 

110. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

111. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggtgtcctcggcgtagcgcga	Protospacer
******.* **************  

112. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

113. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggctgcctcggcatagcgccg	Protospacer
 ****** ********.******* 

114. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

115. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggtggcctcggcgtagccccg	Protospacer
.*****.************** ** 

116. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

117. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tggcggcggcctcgccgtagcgctt	Protospacer
** *********** ********..

118. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcggac	Protospacer
.*.*******************  *

119. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
agccggcggcctcggcctcgcgccg	Protospacer
 *************** * ***** 

120. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

121. spacer 7.5|2087818|24|NC_015758|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

122. spacer 7.5|2087818|24|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

123. spacer 7.5|2087818|24|NC_015758|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

124. spacer 2.1|363261|27|NC_015758|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

125. spacer 2.1|363261|27|NC_015758|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

126. spacer 2.7|363657|27|NC_015758|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

127. spacer 2.7|363657|27|NC_015758|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

128. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

129. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

130. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

131. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

132. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

133. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

134. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

135. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

136. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

137. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

138. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

139. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

140. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

141. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

142. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

143. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

144. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

145. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

146. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

147. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

148. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

149. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

150. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

151. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

152. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

153. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

154. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

155. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

156. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

157. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

158. spacer 4.3|836532|25|NC_015758|CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 5, identity: 0.8

aaacgccttcggcgctggcgaggtc	CRISPR spacer
cgtcgccttcggcgatggcgaggtt	Protospacer
 . *********** *********.

159. spacer 4.3|836532|25|NC_015758|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.8

aaacgccttcggcgctggcgaggtc	CRISPR spacer
caacgccttcggcgctggcggccac	Protospacer
 *******************.   *

160. spacer 4.3|836532|25|NC_015758|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 5, identity: 0.8

aaacgccttcggcgctggcgaggtc	CRISPR spacer
ggttgcgttcggcgctggcgaggtc	Protospacer
.. .** ******************

161. spacer 4.3|836532|25|NC_015758|CRT matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8

aaacgccttcggcgctggcgaggtc	CRISPR spacer
tctcgccttcggcgctggcgagaac	Protospacer
   *******************. *

162. spacer 5.5|922922|27|NC_015758|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

163. spacer 5.5|922922|27|NC_015758|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

164. spacer 5.5|922922|27|NC_015758|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

165. spacer 5.5|922922|27|NC_015758|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

166. spacer 5.5|922922|27|NC_015758|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

167. spacer 5.8|923057|30|NC_015758|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 5, identity: 0.833

cggattcggcggattccgcggcggggaggg	CRISPR spacer
cggattcgcccgattccgcggcggcccggg	Protospacer
******** * *************   ***

168. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.833

cggattcggcggattccgcggcggggaggg	CRISPR spacer
cggattcgcccgattccgcggcggcacggg	Protospacer
******** * ************* . ***

169. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

170. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

171. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

172. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

173. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgggtccggcggcggcggtggcggttt	Protospacer
***.***************.*** * .

174. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgactccggcggcgggggtagcgttcg	Protospacer
**. *********** *********  

175. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgccgccggcggcggcggtggcgttgg	Protospacer
**   **************.****** 

176. spacer 5.12|923216|27|NC_015758|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

177. spacer 5.12|923216|27|NC_015758|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

178. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgaggccggcctgctggtcgtctccgggct	Protospacer
*** **************** ******   

179. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agattccggcctgttcgtcggctccggcgg	Protospacer
 **. ********.* **************

180. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg	Protospacer
** *..********** ***** *******

181. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg	Protospacer
** ******************* * *  **

182. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
cgacgccggcatgccggtcggcttcctgct-	Protospacer
********** ***.******* *** **  

183. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

184. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

185. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg	Protospacer
*******.***** **********   ***

186. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctg--ttcggctccggcggcgctggcgg	CRISPR spacer
--tactgattacggctccggcggtgctggcgg	Protospacer
  *.***  * ************.********

187. spacer 5.17|923453|30|NC_015758|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833

--cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg	Protospacer
  ***.*  *************** *.*****

188. spacer 5.18|923501|24|NC_015758|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792

aaccgacctcggcggcgctggcgg	CRISPR spacer
gggcgacctcggcggcgctggcct	Protospacer
.. *******************  

189. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggtaacgccgg	Protospacer
 .*.*. ***************** ***

190. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gttcttcggcaacggcggcaacggcgc	Protospacer
*.*  *************.******* 

191. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgatcggcaacggcggcaacgacac	Protospacer
 *****************.****.*. 

192. spacer 5.19|923543|27|NC_015758|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcgacaacggttt	Protospacer
*****************..*****.  

193. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgatcggcaacggcggcaacgacac	Protospacer
 *****************.****.*. 

194. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tctgatcggcaacggcggcaacgacac	Protospacer
 *****************.****.*. 

195. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tctgatcggcaacggcggcaacgacac	Protospacer
 *****************.****.*. 

196. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

197. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

198. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggctgtgacgccac	Protospacer
**************** **.*** *. 

199. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcggcaacgatag	Protospacer
**** *************.****...*

200. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcggcaacgatag	Protospacer
**** *************.****...*

201. spacer 5.19|923543|27|NC_015758|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 5, identity: 0.815

gctgat--cggcaacggcggtaacggcgg	CRISPR spacer
--cgacggcggcaatggcggtaacggcgg	Protospacer
  .**.  ******.**************

202. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgaacggcaacggcggcaacgacac	Protospacer
***** ************.****.*. 

203. spacer 5.19|923543|27|NC_015758|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

204. spacer 5.19|923543|27|NC_015758|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

205. spacer 5.19|923543|27|NC_015758|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

206. spacer 5.19|923543|27|NC_015758|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

207. spacer 5.19|923543|27|NC_015758|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

208. spacer 5.19|923543|27|NC_015758|CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

209. spacer 5.19|923543|27|NC_015758|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

210. spacer 5.19|923543|27|NC_015758|CRT matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

211. spacer 5.19|923543|27|NC_015758|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

212. spacer 5.19|923543|27|NC_015758|CRT matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcatcggcggttacgacaa	Protospacer
*********** ******* ***.*..

213. spacer 5.19|923543|27|NC_015758|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

214. spacer 5.19|923543|27|NC_015758|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

215. spacer 5.19|923543|27|NC_015758|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

216. spacer 5.19|923543|27|NC_015758|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

217. spacer 5.19|923543|27|NC_015758|CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

218. spacer 5.19|923543|27|NC_015758|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

219. spacer 5.19|923543|27|NC_015758|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

220. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

221. spacer 5.19|923543|27|NC_015758|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggtggcaacgactt	Protospacer
***************.**.****.*  

222. spacer 5.19|923543|27|NC_015758|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

223. spacer 5.19|923543|27|NC_015758|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

224. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

225. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggccacggcggcaacgacat	Protospacer
********** *******.****.*. 

226. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

227. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

228. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

229. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

230. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

231. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

232. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

233. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

234. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

235. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

236. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggctgtgacgccac	Protospacer
**************** **.*** *. 

237. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcggcaacgatag	Protospacer
**** *************.****...*

238. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

239. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

240. spacer 5.19|923543|27|NC_015758|CRT matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcatcggcggttacgacaa	Protospacer
*********** ******* ***.*..

241. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc	Protospacer
******************** ********  *. 

242. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gcgcggcggcctcggcgtagagccg	Protospacer
   ***************** *** 

243. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

244. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
caccggcggcctcggcgtagcttgc	Protospacer
..******************* . *

245. spacer 6.4|1209473|25|NC_015758|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

246. spacer 2.1|363261|27|NC_015758|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

247. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

248. spacer 2.7|363657|27|NC_015758|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

249. spacer 2.9|363807|27|NC_015758|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

250. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

251. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

252. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

253. spacer 2.10|363867|27|NC_015758|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

254. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

255. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.806

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
actcggcgggaacgccgcgctgttcggcgcg	Protospacer
. .*************..************ 

256. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
ggtcggcgggaccgccatgctgttcctcgtg	Protospacer
**.******** *************  **. 

257. spacer 4.4|836580|31|NC_015758|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.806

ggccgg--cgggaacgccatgctgttcggcgcc	CRISPR spacer
--cctgtcctggatcgccatgctgttcgccgcc	Protospacer
  ** *  * *** ************** ****

258. spacer 5.5|922922|27|NC_015758|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
gatggccggtaggctgttgaacggcgc	Protospacer
.. *******.******* ******* 

259. spacer 5.5|922922|27|NC_015758|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

260. spacer 5.5|922922|27|NC_015758|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

261. spacer 5.5|922922|27|NC_015758|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

262. spacer 5.5|922922|27|NC_015758|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

263. spacer 5.5|922922|27|NC_015758|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

264. spacer 5.5|922922|27|NC_015758|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

265. spacer 5.5|922922|27|NC_015758|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

266. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

267. spacer 5.8|923057|30|NC_015758|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

268. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

269. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

270. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

271. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

272. spacer 5.8|923057|30|NC_015758|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

273. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

274. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

275. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

276. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

277. spacer 5.8|923057|30|NC_015758|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

278. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

279. spacer 5.8|923057|30|NC_015758|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

280. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
aggattcggcggaggccgcggcggggtccg	Protospacer
 ************  ***********   *

281. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
aggattcggcggaggccgcggcggggtccg	Protospacer
 ************  ***********   *

282. spacer 5.12|923216|27|NC_015758|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggatcctgcggcggcggtagaaagcc	Protospacer
******* ************* .   *

283. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

284. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

285. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctggtggtcggctacctcga	Protospacer
***** ******* ********* *  **.

286. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

287. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

288. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

289. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

290. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

291. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac	Protospacer
**  ** ****************.****. 

292. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

293. spacer 5.15|923357|30|NC_015758|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

294. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

295. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcg----gctccggcgg	CRISPR spacer
cgacgccggccggctggtcggagagctgcg----	Protospacer
*********** ********    *** **    

296. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

297. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

298. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg	Protospacer
** *************.******.*  * *

299. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

300. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

301. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

302. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

303. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

304. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

305. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

306. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

307. spacer 5.15|923357|30|NC_015758|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc	Protospacer
** *..************** * ****** 

308. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccgacctgctggtcggggcggactg	Protospacer
********.************  * *.* *

309. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
caagctggtcggccccggcggcgctggcaa	Protospacer
*  **** *****.**************..

310. spacer 5.17|923453|30|NC_015758|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tcacctgtccggctccggcggcggtggcga	Protospacer
.*  ****.************** *****.

311. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

312. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

313. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg--	CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg	Protospacer
.************* ********  .**.*  

314. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

315. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

316. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

317. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

318. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg	Protospacer
* *  .*.******.***************

319. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

320. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

321. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

322. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

323. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

324. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

325. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

326. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

327. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

328. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt--cggctccggcggcgctggcgg	CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg	Protospacer
  .**.*.*  **** ****************

329. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt----cggctccggcggcgctggcgg	CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg	Protospacer
    * ***    *************** *****

330. spacer 5.17|923453|30|NC_015758|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8

-cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg	Protospacer
 ..** * ****** *.**************

331. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
aacgggcggcaacggcggcaacggcgg	Protospacer
. .*. ************.********

332. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ccccggcggcaacggcggcaacggcgg	Protospacer
 *. . ************.********

333. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
acgcggcggcgacggcggtaacggcgg	Protospacer
.*  . ****.****************

334. spacer 5.19|923543|27|NC_015758|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tgaaagcggcaacggcggtaacggcga	Protospacer
   .* ********************.

335. spacer 5.19|923543|27|NC_015758|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ccacgctggcaacggcggtaacggcgg	Protospacer
 *  ...********************

336. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gaccggcggcaacggcggaaacggcgg	Protospacer
* . . ************ ********

337. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacgccggcaacgatac	Protospacer
************** ***.****... 

338. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gagcggcggcaacggcggcaacggcgg	Protospacer
*   . ************.********

339. spacer 5.19|923543|27|NC_015758|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ggccggcggcagcggcggtaacggcgg	Protospacer
* . . *****.***************

340. spacer 5.19|923543|27|NC_015758|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ggacgccggcaacggcggcaacggcgg	Protospacer
*   ..************.********

341. spacer 5.19|923543|27|NC_015758|CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccatcggcaacggcggtagcggtgg	Protospacer
  . ****************.***.**

342. spacer 5.19|923543|27|NC_015758|CRT matches to KR997929 (Mycobacterium phage Barriga, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggcatgggcaacggcggcaacggcgg	Protospacer
    ** ***********.********

343. spacer 5.19|923543|27|NC_015758|CRT matches to MH576971 (Mycobacterium phage Arlo, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggcatgggcaacggcggcaacggcgg	Protospacer
    ** ***********.********

344. spacer 5.19|923543|27|NC_015758|CRT matches to NC_028815 (Mycobacterium phage Nhonho, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggcatgggcaacggcggcaacggcgg	Protospacer
    ** ***********.********

345. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gagcggcggcaacggcggtaccggcgg	Protospacer
*   . ************** ******

346. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
actgagcggcaacggcggaaacggaat	Protospacer
.**** ************ ***** . 

347. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggcatcggcaacggcggttgcggcgg	Protospacer
    *************** .******

348. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacgccggcaacgatac	Protospacer
************** ***.****... 

349. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
actgagcggcaacggcggaaacggaat	Protospacer
.**** ************ ***** . 

350. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc--	Protospacer
************ ******* *****  * .***  

351. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc--	Protospacer
 .****************** ****** *  ***  

352. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct-	Protospacer
 .*********.*************** ..**** 

353. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac	Protospacer
 * ******************.**. ****** * 

354. spacer 2.4|363456|27|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

355. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

356. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

357. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

358. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

359. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

360. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

361. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

362. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

363. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

364. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

365. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

366. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

367. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

368. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

369. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

370. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

371. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 7, identity: 0.774

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
gtccggcgagaacgcgatgctgttcgcgatc	Protospacer
* ******.****** **********  ..*

372. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 7, identity: 0.774

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
gtccggcgagaacgcgatgctgttcgcgatc	Protospacer
* ******.****** **********  ..*

373. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

cggattcggcggattccgcggcggggaggg	CRISPR spacer
aggattcggcggaggccgcggcgggatccg	Protospacer
 ************  **********.   *

374. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767

cggattcggcggattccgcggcggggaggg	CRISPR spacer
aggattcggcggaggccgcggcgggatccg	Protospacer
 ************  **********.   *

375. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

cggattcggcggattccgcggcggggaggg	CRISPR spacer
cccgctgggcggattccgcgtcggggaagg	Protospacer
*  ..* ************* ******.**

376. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.767

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gggattcggtggattcagcggcggtggtgc	Protospacer
 ********.****** ******* *. * 

377. spacer 5.15|923357|30|NC_015758|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc	Protospacer
 * ****************** *.***   

378. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

379. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

380. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

381. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

382. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

383. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

384. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

385. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

386. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

387. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

388. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

389. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

390. spacer 5.15|923357|30|NC_015758|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggaccggcccgctggtcggccccggctt	Protospacer
**. .******.**********.*****  

391. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gctgggcggcctgctggtcggctggggcgg	Protospacer
    * *****************  *****

392. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

393. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

394. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

395. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

396. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

397. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

398. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt	Protospacer
 ************* ********.*. *  

399. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

400. spacer 5.15|923357|30|NC_015758|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

401. spacer 5.15|923357|30|NC_015758|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

402. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

403. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

404. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

405. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

406. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

407. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

408. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

409. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

410. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

411. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

412. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

413. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

414. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

415. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

416. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

417. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

418. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

419. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

420. spacer 5.15|923357|30|NC_015758|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

421. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

422. spacer 5.15|923357|30|NC_015758|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

423. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

424. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

425. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

426. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

427. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

428. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

429. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

430. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

431. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

432. spacer 5.15|923357|30|NC_015758|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

433. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

434. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

435. spacer 5.15|923357|30|NC_015758|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

436. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

437. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

438. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

439. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

440. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

441. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

442. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

443. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

444. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

445. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

446. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

447. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

448. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

449. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

450. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

451. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

452. spacer 5.15|923357|30|NC_015758|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

453. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

454. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

455. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

456. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

457. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

458. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

459. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

460. spacer 5.15|923357|30|NC_015758|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
acacgccgccctgctggtcggcttaggtcg	Protospacer
  ****** **************. **. *

461. spacer 5.15|923357|30|NC_015758|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc	Protospacer
 .****** **************. * ** 

462. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agacgccggcctgctgttcggcctcgaccc	Protospacer
 *************** *****..**.*  

463. spacer 5.15|923357|30|NC_015758|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggctcggcctgctgctcggcttcggcga	Protospacer
**.  .********** ******.*****.

464. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
gtcggccggcctgctggtcggcgcccggct-	Protospacer
    ****************** .*****  

465. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctgctggtcgacttcatccc	Protospacer
***** **************.**.*. *  

466. spacer 5.15|923357|30|NC_015758|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

467. spacer 5.15|923357|30|NC_015758|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac	Protospacer
**   **************** *.****. 

468. spacer 5.15|923357|30|NC_015758|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga	Protospacer
.******* *************   * **.

469. spacer 5.15|923357|30|NC_015758|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

470. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

471. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

472. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg	Protospacer
*..  .*.*************** ******

473. spacer 5.17|923453|30|NC_015758|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

474. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

475. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

476. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

477. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

478. spacer 5.17|923453|30|NC_015758|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

479. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

480. spacer 5.17|923453|30|NC_015758|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

481. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

482. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

483. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

484. spacer 5.17|923453|30|NC_015758|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
actgctgtccggctccggcggca-tgatgtc	Protospacer
 *******.*************. **..*  

485. spacer 5.17|923453|30|NC_015758|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccggccttcgacttcggcggcgctggcgg	Protospacer
 *.* . ****.**.***************

486. spacer 5.17|923453|30|NC_015758|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

487. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gttcctccacggttccggcggcgctggcgg	Protospacer
 .* ** . ***.*****************

488. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

489. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

490. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

491. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

492. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cgcaggcggcaacggcggtagcggcgg	Protospacer
  ... **************.******

493. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caacggcggcaacggcggcaacggcgg	Protospacer
    . ************.********

494. spacer 5.19|923543|27|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caacggcggcaacggcggcaacggcgg	Protospacer
    . ************.********

495. spacer 5.19|923543|27|NC_015758|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
atctggaggcaacggcggtaacggcgg	Protospacer
... .  ********************

496. spacer 5.19|923543|27|NC_015758|CRT matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

497. spacer 5.19|923543|27|NC_015758|CRT matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

498. spacer 5.19|923543|27|NC_015758|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

499. spacer 5.19|923543|27|NC_015758|CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

500. spacer 5.19|923543|27|NC_015758|CRT matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctcgatcagcaacggcggtaacggttt	Protospacer
 ..****.****************.  

501. spacer 5.19|923543|27|NC_015758|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

502. spacer 5.19|923543|27|NC_015758|CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

503. spacer 5.19|923543|27|NC_015758|CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

504. spacer 5.19|923543|27|NC_015758|CRT matches to MH669001 (Mycobacterium phage EleanorGeorge, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cacccccggaaacggcggtaacggcgg	Protospacer
  .  .*** *****************

505. spacer 5.19|923543|27|NC_015758|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

506. spacer 5.19|923543|27|NC_015758|CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

507. spacer 5.19|923543|27|NC_015758|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

508. spacer 5.19|923543|27|NC_015758|CRT matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

509. spacer 5.19|923543|27|NC_015758|CRT matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

510. spacer 5.19|923543|27|NC_015758|CRT matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

511. spacer 5.19|923543|27|NC_015758|CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

512. spacer 5.19|923543|27|NC_015758|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caacggcggcaacggcggcaacggcgg	Protospacer
    . ************.********

513. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc-	Protospacer
****** **** *************** ..** . 

514. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc--	Protospacer
*.*********.********* *****.  .***  

515. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc-	Protospacer
 ** *************** ******* *. **. 

516. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta----	CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac	Protospacer
****** ************* ****    * ***    

517. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

518. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

519. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc--	Protospacer
 *.********.******** *******  .***  

520. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc--	Protospacer
*********** *****.******* * *  .**  

521. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat	Protospacer
 .******** ********.***** **.*** * 

522. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc-	Protospacer
.* ******** ******** ****** * ***. 

523. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

524. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

525. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

526. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

527. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

528. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

529. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

530. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

531. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

532. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

533. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct-	Protospacer
.* ***.****.*************** *  *** 

534. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg-tggcta	CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt-	Protospacer
**.***** ***************.*.. *** * 

535. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

536. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt	Protospacer
 * ***************** .*** ****** . 

537. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

538. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc--	Protospacer
 **.****************.****.  * ****  

539. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac	Protospacer
 * ***************** .*** *****..* 

540. spacer 6.9|1209737|37|NC_015758|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac	Protospacer
******************..*******  . ***.**

541. spacer 7.3|2087728|30|NC_015758|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

542. spacer 7.3|2087728|30|NC_015758|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

543. spacer 7.3|2087728|30|NC_015758|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

544. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

545. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

546. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

547. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

548. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

549. spacer 4.1|836400|34|NC_015758|CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

caacggcgggcccggcgggtggttgatcggcaac	CRISPR spacer
cctctgcggacccggcgagtggttgatcgagaag	Protospacer
*  * ****.*******.***********. ** 

550. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
tggggccgggaacgacacgctgttcggcgag	Protospacer
 *  * ******** **.***********  

551. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.742

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
cgacggcgggaccgccaagctgttcgaaacg	Protospacer
 * ******** ***** ********. .* 

552. spacer 4.6|836676|34|NC_015758|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggaaacgccggcatgctgttcggcgcc----	CRISPR spacer
agccggcggcaacgccggcatgct----ggagtcgcgc	Protospacer
.******** **************    ** *.*    

553. spacer 4.7|836733|31|NC_015758|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.742

attctcgaacggcggtgccaccggcggggca	CRISPR spacer
accatcgaacggcggcgccaccggcaggcgc	Protospacer
*.. ***********.*********.**   

554. spacer 4.7|836733|31|NC_015758|CRT matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 8, identity: 0.742

attctcgaacggcggtgccaccggcggggca	CRISPR spacer
tcgccggaacggtggtgccaccggccgggta	Protospacer
 . *. ******.************ ***.*

555. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733

cggattcggcggattccgcggcggggaggg	CRISPR spacer
agttcgcggcggaatccgcggcggggaacg	Protospacer
 *  . ******* *************. *

556. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gcccttcggcggatgccgcggcggcgagct	Protospacer
    ********** ********* ***  

557. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccggcctgctggtcgggctgacctc	Protospacer
********************* .. . *  

558. spacer 5.15|923357|30|NC_015758|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

559. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

560. spacer 5.15|923357|30|NC_015758|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

561. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc	Protospacer
*  .   *** ****************** 

562. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

563. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct	Protospacer
 * *************  ********    

564. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

565. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcaccgccctgctgatcggctccggcat	Protospacer
   *.*** *******.***********. 

566. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

567. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

568. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt	Protospacer
 . ******************. ***  * 

569. spacer 5.15|923357|30|NC_015758|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc	Protospacer
 *  ..************** * ****** 

570. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

571. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

572. spacer 5.15|923357|30|NC_015758|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

573. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

574. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

575. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

576. spacer 5.17|923453|30|NC_015758|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgaccatctcggctccgacggcgctggcgc	Protospacer
*   *  .*********.*********** 

577. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

578. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccaccccgcggctccggaggcgctggcgg	Protospacer
 *..*. . ********* ***********

579. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

580. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

581. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

582. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

583. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

584. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

585. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

586. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

587. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

588. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

589. spacer 5.17|923453|30|NC_015758|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

590. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgatcggctccggcgccggcttctc	Protospacer
******* ************ ** .  *  

591. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgtgcggctccggcggcaaccccga	Protospacer
 ******* *************. .  **.

592. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgatgttcgactccggcggcgacgcacc	Protospacer
**** ******.*********** .*    

593. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg	Protospacer
 *  *   .************** ******

594. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt--	Protospacer
 . ***************** ******  *.**.  

595. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc--	Protospacer
  *****************. ******  .** *  

596. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc--	Protospacer
 **********.** **********.*   .***  

597. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc	Protospacer
 *.******.**********.******  .**.*  

598. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

599. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc	Protospacer
 ****** ******.************ .**.  

600. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

601. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

602. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg	Protospacer
  ******* ** **************  * **.

603. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

604. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

605. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg	Protospacer
 ******** *****.***********   * *.

606. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc-	Protospacer
 .**********.** *********** .* **. 

607. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

608. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

609. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

610. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

611. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

612. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

613. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

614. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

615. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

616. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

617. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

618. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

619. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

620. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

621. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

622. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg----gtggcta	CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg----	Protospacer
 * ******** *******.*******    ***    

623. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc	Protospacer
*************** .********   * **..  

624. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcg-gcaacggcggcgccggcgggtggcta	CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc	Protospacer
  * .*** ** ******** ************. 

625. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

626. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

627. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

628. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

629. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

630. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

631. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

632. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

633. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

634. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

635. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

636. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

637. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

638. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

639. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

640. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

641. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

642. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg	Protospacer
 .***************** *.***** * * *.

643. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

644. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

645. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc--	Protospacer
 .*********.********* *****  ..***  

646. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

647. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

648. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat-	Protospacer
  .*******.********* ****** ** * * 

649. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca	Protospacer
.******************  **** * ..**.*

650. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat	Protospacer
*  ******** *******.***** **.**..* 

651. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca	Protospacer
 *.********.******** ******..* *.*

652. spacer 6.9|1209737|37|NC_015758|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc	Protospacer
 ********.* **************** . ***..*

653. spacer 7.3|2087728|30|NC_015758|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

654. spacer 7.3|2087728|30|NC_015758|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

655. spacer 10.30|3100018|29|NC_015758|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724

tccgcgaaattcactgcgcgttattcaag	CRISPR spacer
gacgcgaaatacactgcgctttattttca	Protospacer
  ******** ******** *****.  .

656. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

657. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

658. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

659. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

660. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

661. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

662. spacer 3.1|688911|31|NC_015758|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

663. spacer 4.1|836400|34|NC_015758|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

caacggcgggcccggcgggtggttgatcggcaac	CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg	Protospacer
******* **************.**. **...  

664. spacer 4.1|836400|34|NC_015758|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735

caacggcgggcccggcgggtggttgatcggcaac	CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg	Protospacer
******* **************.**. **...  

665. spacer 4.1|836400|34|NC_015758|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

caacggcgggcccggcgggtggttgatcggcaac	CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg	Protospacer
******* **************.**. **...  

666. spacer 4.1|836400|34|NC_015758|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

caacggcgggcccggcgggtggttgatcggcaac	CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg	Protospacer
******* **************.**. **...  

667. spacer 4.1|836400|34|NC_015758|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735

caacggcgggcccggcgggtggttgatcggcaac	CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg	Protospacer
******* **************.**. **...  

668. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP010616 (Phaeobacter inhibens strain P92 plasmid pP92_f, complete sequence) position: , mismatch: 9, identity: 0.71

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg	Protospacer
 * ** *.******************.  . 

669. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP010635 (Phaeobacter inhibens strain P78 plasmid pP78_f, complete sequence) position: , mismatch: 9, identity: 0.71

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg	Protospacer
 * ** *.******************.  . 

670. spacer 4.4|836580|31|NC_015758|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 9, identity: 0.71

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
cctcggcgggatcgccacgctgttcgacatg	Protospacer
  .******** *****.********.*.. 

671. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP010755 (Phaeobacter inhibens strain P70 plasmid pP70_f, complete sequence) position: , mismatch: 9, identity: 0.71

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg	Protospacer
 * ** *.******************.  . 

672. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP010713 (Phaeobacter inhibens strain P66 plasmid pP66_h, complete sequence) position: , mismatch: 9, identity: 0.71

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg	Protospacer
 * ** *.******************.  . 

673. spacer 4.4|836580|31|NC_015758|CRT matches to NZ_CP010740 (Phaeobacter inhibens strain P72 plasmid pP72_e, complete sequence) position: , mismatch: 9, identity: 0.71

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg	Protospacer
 * ** *.******************.  . 

674. spacer 4.4|836580|31|NC_015758|CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 9, identity: 0.71

ggccggcgggaacgccatgctgttcggcgcc	CRISPR spacer
tttcggcgggaacgccatgccgatcgctatc	Protospacer
  .*****************.* *** ...*

675. spacer 4.6|836676|34|NC_015758|CRT matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggaaacgccggcatgctgttcggcgcc	CRISPR spacer
agccggcgcaaacgccggcaggctgcacctcgtg	Protospacer
.******* *********** ****. *  **. 

676. spacer 4.6|836676|34|NC_015758|CRT matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggaaacgccggcatgctgttcggcgcc	CRISPR spacer
tgcccgcggatacgccggcatgctggctcgcgag	Protospacer
 *** ***** ************** .. ***  

677. spacer 4.6|836676|34|NC_015758|CRT matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggaaacgccggcatgctgttcggcgcc	CRISPR spacer
agccggcgcaaacgccggcaggctgcacctcgtg	Protospacer
.******* *********** ****. *  **. 

678. spacer 4.7|836733|31|NC_015758|CRT matches to NZ_CP046571 (Xanthomonas albilineans strain Xa-FJ1 plasmid pXaFJ1, complete sequence) position: , mismatch: 9, identity: 0.71

attctcgaacggcggtgccaccggcggggca	CRISPR spacer
cttctcaatcggcggtgccaccggtaccggc	Protospacer
 *****.* ***************..  *  

679. spacer 5.8|923057|30|NC_015758|CRT matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 9, identity: 0.7

cggattcggcggattccgcggcggggaggg	CRISPR spacer
tggatccggtggattccgcggcggccgcat	Protospacer
.****.***.**************  . . 

680. spacer 5.15|923357|30|NC_015758|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggcgccggcctgctggtcggactgctcac	Protospacer
**.****************** ..   *. 

681. spacer 5.17|923453|30|NC_015758|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

682. spacer 5.17|923453|30|NC_015758|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

683. spacer 5.19|923543|27|NC_015758|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 9, identity: 0.667

gctgatcggcaacggcggtaacggcgg---------	CRISPR spacer
---------caacggcggtaacggcggtaacggcgg	Protospacer
         ******************         

684. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc--	Protospacer
 . ****************. ******  ..***  

685. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc--	Protospacer
 . ****************  *****  *..***  

686. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc	Protospacer
 ************ ************  .. *  

687. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc--	Protospacer
 . ****.****.*************  * .***  

688. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc	Protospacer
 * ****** * ***************  *  * 

689. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

690. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

691. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

692. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

693. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

694. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa	Protospacer
 *.******* *********.****** ..*  *

695. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc	Protospacer
 .********* ******** ******* *  . 

696. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag	Protospacer
  ********** *************  *. * .

697. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

698. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat	Protospacer
*.********* *********** *** .. *  

699. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

700. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

701. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

702. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

703. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc	Protospacer
 * *********.******.*******   * * 

704. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

705. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

706. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga	Protospacer
  ****************** *.****  *   *

707. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

708. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

709. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

710. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

711. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

712. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

713. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

714. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

715. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

716. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

717. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

718. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

719. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

720. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

721. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

722. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

723. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg	Protospacer
*.****************** ***.** *  ...

724. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

725. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

726. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

727. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

728. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

729. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

730. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

731. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac	Protospacer
 *********  ************* .*. **  

732. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

733. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc--	Protospacer
   *******.********.******  **..**  

734. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt	Protospacer
* .*******.* **************  .**  

735. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

736. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg	Protospacer
 * ****************  ****** *   *.

737. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

738. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga	Protospacer
*  *******. ***************  .*  *

739. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

740. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

741. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc--	Protospacer
 .*****************.*** **  ...***  

742. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

743. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

744. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

745. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

746. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

747. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

748. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

749. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc--	Protospacer
 . ****************. *****  **..**  

750. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

751. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc	Protospacer
*. ****************. ****** *  *. 

752. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac	Protospacer
 * **** *********** *******  **   

753. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

754. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

755. spacer 6.9|1209737|37|NC_015758|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc	Protospacer
 ** **************** ******  *.* *  *

756. spacer 9.50|3097267|37|NC_015758|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757

tgcgtcaagtgcggcaccgccgtcatgtcggtgtcga	CRISPR spacer
ggctgttgctgcagcaccgccgtcatctcggtgtcga	Protospacer
 **  . . ***.************* **********

757. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

758. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

759. spacer 2.6|363591|33|NC_015758|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

760. spacer 5.2|922769|39|NC_015758|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744

cggcgcgggcggggccgtcacgggaaccggcgccaccgg	CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc	Protospacer
*.  * ** ********.**************** *   

761. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcg-----ggtggcta	CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt-----	Protospacer
   *******.********** ****     ***     

762. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc	Protospacer
*. ***************..*******  .  * 

763. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc	Protospacer
. ********* ********* ***** . * . 

764. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg	Protospacer
 ********** ***** ******** *  ....

765. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc	Protospacer
  ********* *** ***********. *  . 

766. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact	Protospacer
. ********. ***************  *. . 

767. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

768. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga	Protospacer
 .********* *******.*******      *

769. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

770. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

771. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

772. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

773. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta-------	CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc	Protospacer
*****.****** *********       **.**       

774. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

775. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

776. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag	Protospacer
 * **********.*****.*******.  *  .

777. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

778. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

779. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

780. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

781. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

782. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

783. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

784. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

785. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

786. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc	Protospacer
 .*****..*****************  *  .* 

787. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

788. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

789. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

790. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

791. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

792. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

793. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

794. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

795. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

796. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

797. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

798. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

799. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

800. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

801. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

802. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

803. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

804. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

805. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

806. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg	Protospacer
*  ********.*********.*****  *  ..

807. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

808. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

809. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

810. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

811. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

812. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

813. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

814. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc	Protospacer
  ********.********* *****  . **  

815. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

816. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

817. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

818. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

819. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

820. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

821. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag	Protospacer
 * ** ***** ***************   *  .

822. spacer 6.9|1209737|37|NC_015758|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

823. spacer 6.9|1209737|37|NC_015758|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

824. spacer 9.21|3097269|38|NC_015758|PILER-CR matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.737

ctgcgtcaagtgcggcaccgccgtcatgtcggtgtcga	CRISPR spacer
aggctgttgctgcagcaccgccgtcatctcggtgtcga	Protospacer
  **  . . ***.************* **********

825. spacer 9.41|3096599|35|NC_015758|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

826. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg	Protospacer
 . ****************. ******   *...

827. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg	Protospacer
  .********.******** ******.   *..

828. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

829. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

830. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg	Protospacer
 .******** ******* ********  .  ..

831. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag	Protospacer
  .********* ********** ***  . * .

832. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg	Protospacer
 .  *************** *****.**  * ..

833. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg	Protospacer
 .. ******.*.***************  * ..

834. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc	Protospacer
*****.****** ***********  .    *. 

835. spacer 6.5|1209521|40|NC_015758|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725

tgccggcggcgccggcggtgtcggcggacccgccgggttg	CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc	Protospacer
 *..******.***************** *** .*.  * 

836. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg	Protospacer
..********.****** ********   . ...

837. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgc-----cggcgggtggcta	CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg----	Protospacer
 ***** ..*. ***** ***     **** ****    

838. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga-----	Protospacer
     ***** ****. ***** . *** **.*      

839. spacer 6.3|1209416|34|NC_015758|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga-----	Protospacer
     ***** ****. **.** . *** **.*      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3690207 : 3740200 27 Burkholderia_virus(25.0%) transposase,tRNA,protease NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_015758.1|WP_013988995.1|3721610_3727361_-|PE-family-protein 3721610_3727361_- 1916 aa aa NA NA NA 3690207-3740200 yes