Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018002 Sulfurospirillum barnesii SES-3, complete sequence 2 crisprs csa3,DEDDh,cas6,cas8b1,cas7b,cas5,cas3,cas4,cas1,cas2,WYL 0 3 1 0

Results visualization

1. NC_018002
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018002_1 934455-937238 TypeI-B NA
42 spacers
cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018002_2 1444484-1444685 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018002_1 1.42|937175|34|NC_018002|CRT 937175-937208 34 MN693625 Marine virus AFVG_250M334, complete genome 30850-30883 7 0.794
NC_018002_1 1.42|937175|34|NC_018002|CRT 937175-937208 34 MN694426 Marine virus AFVG_250M547, complete genome 4024-4057 7 0.794
NC_018002_1 1.19|935667|34|NC_018002|PILER-CR,CRISPRCasFinder,CRT 935667-935700 34 MH884512 Bacillus phage vB_BpsS-140, complete genome 11210-11243 9 0.735
NC_018002_1 1.10|935078|34|NC_018002|PILER-CR,CRISPRCasFinder,CRT 935078-935111 34 NZ_CP040940 Cetia pacifica strain TB6 plasmid unnamed1, complete sequence 59963-59996 11 0.676

1. spacer 1.42|937175|34|NC_018002|CRT matches to MN693625 (Marine virus AFVG_250M334, complete genome) position: , mismatch: 7, identity: 0.794

-gtacctatatcttttgagagtgagttagacgtag	CRISPR spacer
cgtgtttat-ccttttgagagggagttagatgtag	Protospacer
 **...*** .********** ********.****

2. spacer 1.42|937175|34|NC_018002|CRT matches to MN694426 (Marine virus AFVG_250M547, complete genome) position: , mismatch: 7, identity: 0.794

-gtacctatatcttttgagagtgagttagacgtag	CRISPR spacer
cgtgtttat-ccttttgagagggagttagatgtag	Protospacer
 **...*** .********** ********.****

3. spacer 1.19|935667|34|NC_018002|PILER-CR,CRISPRCasFinder,CRT matches to MH884512 (Bacillus phage vB_BpsS-140, complete genome) position: , mismatch: 9, identity: 0.735

aataca-aagacggaagcacaaaaatagcaattag	CRISPR spacer
-tcacagaagacagaagcacaaaaattgcaagata	Protospacer
  .*** *****.************* ****   .

4. spacer 1.10|935078|34|NC_018002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040940 (Cetia pacifica strain TB6 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

atttaataatcaatcttttctgttctaagcttaa	CRISPR spacer
ctttaaaaatcaatcttttatgttcagggtcggt	Protospacer
 ***** ************ ***** ..*.. . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1853431 : 1861003 7 Moumouvirus(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage