Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018011 Alistipes finegoldii DSM 17242, complete sequence 7 crisprs RT,PrimPol,PD-DExK,cas3,DEDDh 1 2 5 2

Results visualization

1. NC_018011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018011_1 460671-460764 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018011_2 863093-863168 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018011_3 1408273-1408342 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018011_4 2066729-2066866 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018011_5 2095109-2095349 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018011_6 3177016-3177126 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018011_7 3290474-3290587 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_018011_1 1.1|460695|46|NC_018011|CRISPRCasFinder 460695-460740 46 NC_018011.1 2743992-2744037 0 1.0

1. spacer 1.1|460695|46|NC_018011|CRISPRCasFinder matches to position: 2743992-2744037, mismatch: 0, identity: 1.0

cggaagaatccgttgccgaagagtccaaacgtcccgactactttcc	CRISPR spacer
cggaagaatccgttgccgaagagtccaaacgtcccgactactttcc	Protospacer
**********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1054216-1054236 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1055299-1055319 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 959969-959989 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1023182-1023202 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 959066-959086 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 957026-957046 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 957015-957035 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 959961-959981 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 959317-959337 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 959952-959972 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1054312-1054332 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1054307-1054327 1 0.952
NC_018011_4 4.1|2066747|21|NC_018011|CRT 2066747-2066767 21 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1054291-1054311 1 0.952
NC_018011_4 4.2|2066786|24|NC_018011|CRT 2066786-2066809 24 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 428179-428202 3 0.875
NC_018011_4 4.2|2066786|24|NC_018011|CRT 2066786-2066809 24 NZ_CP046054 Methylocystis heyeri strain H2 plasmid unnamed2, complete sequence 27061-27084 5 0.792

1. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

2. spacer 4.1|2066747|21|NC_018011|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

3. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

4. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

5. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

6. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

7. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

8. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

9. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

10. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

11. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

12. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

13. spacer 4.1|2066747|21|NC_018011|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcaatgactccggcatccgcc	CRISPR spacer
gcaaggactccggcatccgcc	Protospacer
**** ****************

14. spacer 4.2|2066786|24|NC_018011|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 3, identity: 0.875

tcttccgcaacgccccctgcctct	CRISPR spacer
tcttccgcaacgccgcccgcctcc	Protospacer
************** **.*****.

15. spacer 4.2|2066786|24|NC_018011|CRT matches to NZ_CP046054 (Methylocystis heyeri strain H2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.792

tcttccgcaacgccccctgcctct	CRISPR spacer
ctttccgcaacgccccctgccgac	Protospacer
..*******************  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 525161 : 597173 54 unidentified_phage(20.0%) tRNA,integrase,protease,transposase attL 531484:531498|attR 599780:599794
DBSCAN-SWA_2 1997214 : 2056510 40 Tupanvirus(10.0%) tRNA,integrase,transposase attL 2011536:2011595|attR 2056689:2056810
DBSCAN-SWA_3 2674895 : 2746341 47 Burkholderia_virus(40.0%) tRNA,integrase,transposase attL 2675490:2675505|attR 2748021:2748036
DBSCAN-SWA_4 2903224 : 2959464 51 Yellowstone_lake_phycodnavirus(22.22%) tail,integrase,protease,transposase attL 2947271:2947325|attR 2959631:2959685
DBSCAN-SWA_5 3510595 : 3555291 45 unidentified_phage(22.22%) tail,integrase,transposase attL 3523326:3523341|attR 3563048:3563063
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_018011.1|WP_008653290.1|637255_637684_-|hypothetical-protein 637255_637684_- 142 aa aa 40 NA NA No NA
NC_018011.1|WP_081488113.1|2725498_2725690_+|DDE-type-integrase/transposase/recombinase 2725498_2725690_+ 63 aa aa NA NA NA 2674895-2746341 yes